D20Mgh1 Marker Search Result - Rat Genome Database

Send us a Message



Submit Data |  Help |  Video Tutorials |  News |  Publications |  Download |  REST API |  Citing RGD |  Contact   

Marker: D20Mgh1

Symbol: D20Mgh1
Previously known as: R3823; oxsts5770; 
RGD ID: 34188
Expected Size: 185 (bp)
Position
Rat AssemblyChrPosition (strand)SourceJBrowse
Rnor_6.02051,892,390 - 51,892,559NCBIRnor6.0
Rnor_5.02053,500,151 - 53,500,320UniSTSRnor5.0
RGSC_v3.42051,121,948 - 51,122,133RGDRGSC3.4
RGSC_v3.42051,121,949 - 51,122,133UniSTSRGSC3.4
RGSC_v3.12051,150,646 - 51,150,830RGD
Celera2049,795,496 - 49,795,680UniSTS
RH 3.4 Map20520.7UniSTS
RH 3.4 Map20520.7RGD
RH 2.0 Map20636.5RGD
Cytogenetic Map20 RGD
Is Marker For: Strains:   AVN/Orl   BBDP/Rhw   BBDR/Rhw   BC/CpbU   BDIX/Han   BDVII/Cub   BN/SsNHsd   BP/Cub   BUF/Pit   DA/PitN   DON/Melb   F344/Pit   FHH/Eur   IS/Kyo   LE/Mol   LH/Mav   MHS/Gib   MNRA/N   WN/N   WKY/OlaHsd   WTC/Kyo   LOU/CHan   MNR/N   MR/Pit   ODU/N   WF/Pit   WIST/Nhg   SR/Jr   MNS/Gib   OKA/Wsl   OM/Ztm   P5C   PVG/Pit   SD/Rij   SHR/OlaHsd   SHRSP/Riv   WAG/RijKyo   GK/KyoSwe   M520/N   ACI/N   BN-Lx/Cub   LN/Mav   NEDH/K   SS/Jr   COP/OlaHsd  


Annotation


References - curated
# Reference Title Reference Citation
1. Data downloaded from Wellcome Trust, University of Oxford Data downloaded from Wellcome Trust, University of Oxford
2. High-density rat radiation hybrid maps containing over 24,000 SSLPs, genes, and ESTs provide a direct link to the rat genome sequence. Kwitek AE, etal., Genome Res. 2004 Apr;14(4):750-7
3. UniSTS Pipeline RGD automated pipelines
4. RH Map Project RH Map Project, Laboratory of Genetic Research Website, 1-JUL-99, Laboratory of Genetic Research, Medical College of Wisconsin, http://www.lgr.mcw.edu/LGR/
5. A high density integrated genetic linkage and radiation hybrid map of the laboratory rat Steen RG, Kwitek-Black AE, etal., Genome Research, 1999, 6:1-8
6. Electronic Submission of SSLP Data Sets Wilder R. Oct.2000. National Institute of Arthritis and Musculoskeletal and Skin Diseases, ARB Rat Genetic Database

Strains and Sequence

Sequence
 
Forward Primer CTCTCCCTTCAGTCCCATTG
Reverse Primer TCCTAGAGCCCCTTTTCACA
 

Region

Nucleotide Sequences
GenBank Nucleotide CH474025 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  CM000250 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles


Additional Information

RGD Curation Notes
Note Type Note Reference
Database Acc Id Source(s)
UniSTS 118634 UniSTS