D7Mgh11 Marker Search Result - Rat Genome Database

Send us a Message



Submit Data |  Help |  Video Tutorials |  News |  Publications |  Download |  REST API |  Citing RGD |  Contact   
Pathways

Marker: D7Mgh11

Symbol: D7Mgh11
Previously known as: R3543; oxsts5232; 
RGD ID: 34164
Expected Size: 137 (bp)
Position
Rat AssemblyChrPosition (strand)SourceJBrowse
GRCr871,740,957 - 1,741,094 (+)Marker Load Pipeline
mRatBN7.271,156,446 - 1,156,583 (+)MAPPERmRatBN7.2
Rnor_6.073,151,537 - 3,151,673NCBIRnor6.0
Rnor_5.073,124,185 - 3,124,321UniSTSRnor5.0
RGSC_v3.472,026,568 - 2,026,705RGDRGSC3.4
RGSC_v3.472,026,569 - 2,026,705UniSTSRGSC3.4
Celera71,026,718 - 1,026,854UniSTS
RGSC_v3.1289,737,808 - 89,738,090RGD
Cytogenetic Map7q11UniSTS
Is Marker For: Strains:   ACI/N ; AVN/Orl ; BBDR/Rhw ; BBDP/Rhw ; BC/CpbU ; BDIX/Han ; BDVII/Cub ; BN-Lx/Cub ; BN/SsNHsd ; BP/Cub ; BUF/Pit ; COP/OlaHsd ; DA/PitN ; FHH/Eur ; F344/Pit ; GH/Omr ; GK/KyoSwe ; DON/Melb ; M520/N ; IS/Kyo ; WN/N ; LH/Mav ; LE/Mol ; LEW/Pit ; LOU/CHan ; LN/Mav ; MNR/N ; MNRA/N ; MNS/Gib ; MR/Pit ; NEDH/K ; NP9 ; ODU/N ; OKA/Wsl ; OM/Ztm ; P5C ; PVG/Pit ; SD/Rij ; SHR/OlaHsd ; SR/Jr ; SHRSP/Riv ; SS/Jr ; WAG/RijKyo ; WF/Pit ; WIST/Nhg ; WKY/OlaHsd
QTLs:   Anxrr17  
Genes:   Dgka  


Annotation


References - curated
# Reference Title Reference Citation
1. Data downloaded from Wellcome Trust, University of Oxford Data downloaded from Wellcome Trust, University of Oxford
2. UniSTS Pipeline RGD automated pipelines
3. Electronic Submission of SSLP Data Sets Wilder R. Oct.2000. National Institute of Arthritis and Musculoskeletal and Skin Diseases, ARB Rat Genetic Database

Strains and Sequence

Sequence
 
Forward Primer GGAGCATCCAGATAACCCAA
Reverse Primer CTGGACAACACAGTAAGATTTTGC
 

Region

Genes in Region
The following Genes overlap with this region.    Full Report CSV TAB Printer Analysis Tools
RGD IDSymbolNameChrStartStopSpecies
70904Dgkadiacylglycerol kinase, alpha717332471761181Rat

Nucleotide Sequences
GenBank Nucleotide CH474104 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  CM000237 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles


QTLs in Region (GRCr8)
The following QTLs overlap with this region.    Full Report CSV TAB Printer Gviewer
RGD IDSymbolNameLODP ValueTraitSub TraitChrStartStopSpecies
61410Bw19Body weight QTL 196.20.001body mass (VT:0001259)body weight (CMO:0000012)7166965846669658Rat
1300176Hrtrt10Heart rate QTL 103.19heart pumping trait (VT:2000009)heart rate (CMO:0000002)7123748937Rat
2290372Gluco33Glucose level QTL 332.71blood glucose amount (VT:0000188)blood glucose level area under curve (AUC) (CMO:0000350)7131777942Rat
1300149Cm6Cardiac mass QTL 64.09heart mass (VT:0007028)heart left ventricle weight to body weight ratio (CMO:0000530)71104117804Rat
631503Bp102Blood pressure QTL 1021.9arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)7170952746709527Rat
634336Anxrr17Anxiety related response QTL 173.66locomotor behavior trait (VT:0001392)number of entries into a discrete space in an experimental apparatus (CMO:0000960)71509236116977875Rat
9590142Scort5Serum corticosterone level QTL 524.40.001blood corticosterone amount (VT:0005345)plasma corticosterone level (CMO:0001173)7132612984Rat
1582260Bw72Body weight QTL 723.20.0043body mass (VT:0001259)body weight (CMO:0000012)7139960528Rat
1582261Bw69Body weight QTL 693.20.0048body mass (VT:0001259)body weight (CMO:0000012)7139960528Rat
1582262Bw75Body weight QTL 7530.0038body mass (VT:0001259)body weight (CMO:0000012)7139960528Rat
2298550Neuinf6Neuroinflammation QTL 63.3nervous system integrity trait (VT:0010566)spinal cord RT1-B protein level (CMO:0002132)7129716167Rat
724560Plsm3Polydactyly-luxate syndrome (PLS) morphotypes QTL 30.0003tibia length (VT:0004357)tibia length (CMO:0000450)7134650782Rat
7411566Bw136Body weight QTL 13610.40.001body mass (VT:0001259)body weight gain (CMO:0000420)7132612984Rat


Additional Information

RGD Curation Notes
Note Type Note Reference
Database Acc Id Source(s)
NCBI Gene 140866 UniSTS
  387411 UniSTS