D9Mit3 Marker Search Result - Rat Genome Database

Send us a Message



Submit Data |  Help |  Video Tutorials |  News |  Publications |  Download |  REST API |  Citing RGD |  Contact   

Marker: D9Mit3

Symbol: D9Mit3
Previously known as: R1102-A08; MIT1315; R1315; oxsts5350; 
RGD ID: 34013
Expected Size: 144 (bp)
Position
Rat AssemblyChrPosition (strand)SourceJBrowse
mRatBN7.2958,162,863 - 58,163,035 (+)MAPPERmRatBN7.2
Rnor_6.0963,269,904 - 63,270,073NCBIRnor6.0
Rnor_5.0963,077,375 - 63,077,544UniSTSRnor5.0
RGSC_v3.4955,475,965 - 55,476,135RGDRGSC3.4
RGSC_v3.4955,475,966 - 55,476,135UniSTSRGSC3.4
RGSC_v3.1955,622,948 - 55,623,117RGD
Celera955,627,158 - 55,627,327UniSTS
RH 3.4 Map9484.1UniSTS
RH 3.4 Map9484.1RGD
RH 2.0 Map9554.4RGD
SHRSP x BN Map941.0298RGD
FHH x ACI Map939.0RGD
Cytogenetic Map9 RGD
Is Marker For: Strains:   AVN/Orl   BBDP/Rhw   BBDR/Rhw   BC/CpbU   BDIX/Han   BDVII/Cub   BN/SsNHsd   BP/Cub   BUF/Pit   DA/PitN   DON/Melb   F344/Pit   FHH/Eur   IS/Kyo   LE/Mol   LEW/Pit   LH/Mav   MHS/Gib   MNRA/N   WN/N   WKY/OlaHsd   WTC/Kyo   LOU/CHan   MNR/N   MR/Pit   ODU/N   WF/Pit   WIST/Nhg   SR/Jr   MNS/Gib   NP9   OKA/Wsl   OM/Ztm   P5C   PVG/Pit   SD/Rij   SHR/OlaHsd   WAG/RijKyo   GK/KyoSwe   M520/N   ACI/N   BN-Lx/Cub   LN/Mav   GH/Omr   NEDH/K   SS/Jr  
QTLs:   Uae16  


Annotation


References - curated
# Reference Title Reference Citation
1. Data downloaded from Wellcome Trust, University of Oxford Data downloaded from Wellcome Trust, University of Oxford
2. High-density rat radiation hybrid maps containing over 24,000 SSLPs, genes, and ESTs provide a direct link to the rat genome sequence. Kwitek AE, etal., Genome Res. 2004 Apr;14(4):750-7
3. Rat Genetic Map Data Rat Genetic Map Data, Whitehead Institute for Biomedical Research/MIT Center for Genome Research Website, http://waldo.wi.mit.edu/rat/public/distribution/rat_sslp_releases/jan00/
4. Electronic Transfer of SSLP Data Rat Genetic Mapping Project, Whitehead Institute for Biomedical Research. APR. 2001.
5. UniSTS Pipeline RGD automated pipelines
6. RH Map Project RH Map Project, Laboratory of Genetic Research Website, 1-JUL-99, Laboratory of Genetic Research, Medical College of Wisconsin, http://www.lgr.mcw.edu/LGR/
7. A high density integrated genetic linkage and radiation hybrid map of the laboratory rat Steen RG, Kwitek-Black AE, etal., Genome Research, 1999, 6:1-8
8. Electronic Submission of SSLP Data Sets Wilder R. Oct.2000. National Institute of Arthritis and Musculoskeletal and Skin Diseases, ARB Rat Genetic Database

Strains and Sequence

Sequence
 
Forward Primer TGAGACTTGTATTCACTCCTCCC
Reverse Primer CTATCCCTGTCTCTGTGTCTACCA
 

Region

Nucleotide Sequences
GenBank Nucleotide CH473965 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  CM000239 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles


QTLs in Region (mRatBN7.2)
The following QTLs overlap with this region.    Full Report CSV TAB Printer Gviewer
RGD IDSymbolNameLODP ValueTraitSub TraitChrStartStopSpecies
10054125Srcrt7Stress Responsive Cort QTL 73.330.0011blood corticosterone amount (VT:0005345)plasma corticosterone level (CMO:0001173)9187073594Rat
1331757Cdexp1CD45RC expression in CD8 T cells QTL 14.3CD8-positive T cell quantity (VT:0008077)blood CD45RC(high) CD8 T cell count to CD45RC(low) CD8 T cell count ratio (CMO:0001990)9102453767509080Rat
631680Cm11Cardiac mass QTL 113.10.00089heart left ventricle mass (VT:0007031)heart left ventricle weight to body weight ratio (CMO:0000530)92043051965430519Rat
70186Niddm26Non-insulin dependent diabetes mellitus QTL 263.87blood glucose amount (VT:0000188)blood glucose level area under curve (AUC) (CMO:0000350)92207116986369743Rat
631643Bp120Blood pressure QTL 12030.004arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)92207120067071200Rat
1300180Bw14Body weight QTL 143.776body mass (VT:0001259)body weight (CMO:0000012)92375402461381613Rat
7207814Bmd91Bone mineral density QTL 913.5femur size trait (VT:1000369)femoral neck cross-sectional area (CMO:0001697)92375414483851531Rat
70218Cm28Cardiac mass QTL 288.30.0001heart mass (VT:0007028)heart wet weight (CMO:0000069)92526804479271759Rat
724544Uae9Urinary albumin excretion QTL 94.5urine albumin amount (VT:0002871)urine albumin level (CMO:0000130)925268044114175309Rat
731164Uae25Urinary albumin excretion QTL 253.50.0001urine albumin amount (VT:0002871)urine albumin excretion rate (CMO:0000757)925661188100929786Rat
1641894Alcrsp12Alcohol response QTL 12response to alcohol trait (VT:0010489)brain neurotensin receptor 1 density (CMO:0002068)92746863972468639Rat
7411656Foco26Food consumption QTL 269.80.001eating behavior trait (VT:0001431)feed conversion ratio (CMO:0001312)93253550577535505Rat
7411571Bw138Body weight QTL 13814.30.001body mass (VT:0001259)body weight gain (CMO:0000420)93253550577535505Rat
1598834Memor11Memory QTL 112.5exploratory behavior trait (VT:0010471)average horizontal distance between subject and target during voluntary locomotion in an experimental apparatus (CMO:0002674)93696235977814038Rat
8662828Vetf6Vascular elastic tissue fragility QTL 63.9artery integrity trait (VT:0010639)patent ductus arteriosus score (CMO:0002566)93696235992058970Rat
2290450Scl57Serum cholesterol level QTL 574.15blood cholesterol amount (VT:0000180)plasma total cholesterol level (CMO:0000585)93696235995410867Rat
6903941Pur31Proteinuria QTL 310.036urine total protein amount (VT:0000032)urine protein excretion rate (CMO:0000759)94019418885194188Rat
11353949Bp393Blood pressure QTL 393arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)94019418885194188Rat
61352Bp34Blood pressure QTL 345arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)94249534379271511Rat
10058949Gmadr5Adrenal mass QTL 520.014adrenal gland mass (VT:0010420)both adrenal glands wet weight to body weight ratio (CMO:0002411)94279151387976209Rat
11353951Bp394Blood pressure QTL 394arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)94464992189649921Rat
12879506Pur33Proteinuria QTL 33urine total protein amount (VT:0000032)urine total protein excretion rate (CMO:0000756)94464992189649921Rat
11353957Bmd92Bone mineral density QTL 920.01tibia mineral mass (VT:1000283)volumetric bone mineral density (CMO:0001553)94611419991114199Rat
631656Bp108Blood pressure QTL 1085.970.0001arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)94859825193598251Rat
1598849Memor17Memory QTL 172.2exploratory behavior trait (VT:0010471)difference between time of physical contact/close proximity of test subject and social stimulus during sample phase and test phase (CMO:0002678)94996854671098346Rat
2303170Bp332Blood pressure QTL 3323.730.027arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)95584784177026453Rat
2303180Bp333Blood pressure QTL 3330.001arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)95662771378595166Rat
2303180Bp333Blood pressure QTL 3330.001arterial blood pressure trait (VT:2000000)diastolic blood pressure (CMO:0000005)95662771378595166Rat
2303180Bp333Blood pressure QTL 3330.001arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)95662771378595166Rat
1578760Cm53Cardiac mass QTL 533.30.0001heart mass (VT:0007028)heart wet weight (CMO:0000069)956771635101771635Rat
724515Uae16Urinary albumin excretion QTL 168urine albumin amount (VT:0002871)urine albumin excretion rate (CMO:0000757)958163035100929646Rat


Additional Information

RGD Curation Notes
Note Type Note Reference
Database Acc Id Source(s)
NCBI Gene 387431 UniSTS
UniSTS 119145 UniSTS