D9Mit6 Marker Search Result - Rat Genome Database

Advanced Search (OLGA)

General

Marker: D9Mit6

Symbol:

D9Mit6

Previously known as:

oxsts9234; D9Wox17; oxsts5315; R750;

RGD ID:

33842

Expected Size:

196 (bp)

Position

Rat Assembly	Chr	Position (strand)	Source	JBrowse
GRCr8	9	6,714,692 - 6,714,888 (+)	Marker Load Pipeline
RGSC_v3.4	9	1,526,763 - 1,526,958	UniSTS	RGSC3.4
RGSC_v3.1	9	1,526,762 - 1,526,958	RGD

Is Marker For:

Strains: ACI/N ; AVN/Orl ; BBDR/Rhw ; BBDP/Rhw ; BC/CpbU ; BDIX/Han ; BDVII/Cub ; BN-Lx/Cub ; BN/SsNHsd ; BP/Cub ; BUF/Pit ; COP/OlaHsd ; DA/PitN ; FHH/Eur ; F344/Pit ; GH/Omr ; GK/KyoSwe ; DON/Melb ; M520/N ; IS/Kyo ; WN/N ; LH/Mav ; LE/Mol ; LEW/Pit ; LOU/CHan ; LN/Mav ; MHS/Gib ; MNR/N ; MNRA/N ; MNS/Gib ; MR/Pit ; NEDH/K ; NP9 ; ODU/N ; OKA/Wsl ; OM/Ztm ; P5C ; PVG/Pit ; SD/Rij ; SHR/OlaHsd ; SR/Jr ; SHRSP/Riv ; SS/Jr ; WAG/RijKyo ; WF/Pit ; WIST/Nhg ; WKY/OlaHsd ; WTC/Kyo ; DA.BN-(D9Mit6-D9Rat29)/Kini ; DA.BN-(D9Mit6-D9Got15)/Kini
QTLs: Eae4 Bp120 Bp332

Annotation

References - curated

#	Reference Title	Reference Citation
1.	Data downloaded from Wellcome Trust, University of Oxford	Data downloaded from Wellcome Trust, University of Oxford
2.	UniSTS Pipeline	RGD automated pipelines

Strains and Sequence

Sequence


Forward Primer	CGGGCTATTTCTCTGATGCT
Reverse Primer	CCCAGAGGCTCTTCCAGAC

Strain Variation

Strain, Expected Size(s)

ACI/N	151
AVN/Orl	146
BBDP/Rhw	151
BBDR/Rhw	151
BC/CpbU	146
BDIX/Han	146
BDVII/Cub	151
BN-Lx/Cub	198
BN/SsNHsd	198
BP/Cub	146
BUF/Pit	146
COP/OlaHsd	151
DA/PitN	151

DON/Melb	238
F344/Pit	238
FHH/Eur	200
GH/Omr	146
GK/KyoSwe	148
IS/Kyo	150
LE/Mol	146
LEW/Pit	202
LH/Mav	146
LN/Mav	146
LOU/CHan	151
M520/N	151
MHS/Gib	148

MNR/N	146
MNRA/N	146
MNS/Gib	202
MR/Pit	151
NEDH/K	146
NP9	148
ODU/N	202
OKA/Wsl	151
OM/Ztm	148
P5C	151
PVG/Pit	222
SD/Rij	146
SHR/OlaHsd	151

SHRSP/Riv	151
SR/Jr	146
SS/Jr	202
WAG/RijKyo	146
WF/Pit	202
WIST/Nhg	202
WKY/OlaHsd	202
WN/N	202
WTC/Kyo	202

Region

Nucleotide Sequences


GenBank Nucleotide	CH474184.1	(Get FASTA)	NCBI Sequence Viewer	Search GEO for Microarray Profiles

QTLs in Region (GRCr8)

The following QTLs overlap with this region.

RGD ID	Symbol	Name	LOD	P Value	Trait	Sub Trait	Chr	Start	Stop	Species
2303170	Bp332	Blood pressure QTL 332	3.73	0.027	arterial blood pressure trait (VT:2000000)	mean arterial blood pressure (CMO:0000009)	9	6714888	84474983	Rat
631211	Bw4	Body weight QTL4	5.31		retroperitoneal fat pad mass (VT:0010430)	retroperitoneal fat pad weight to body weight ratio (CMO:0000635)	9	5346479	50346479	Rat
10054141	Gmadr4	Adrenal mass QTL 4	2.45	0.0074	adrenal gland mass (VT:0010420)	both adrenal glands wet weight (CMO:0000164)	9	1	21707400	Rat
7207814	Bmd91	Bone mineral density QTL 91	3.5		femur size trait (VT:1000369)	femoral neck cross-sectional area (CMO:0001697)	9	1	31250552	Rat
1578675	Bss17	Bone structure and strength QTL 17	3.8		femur morphology trait (VT:0000559)	femoral neck cortical cross-sectional area (CMO:0001702)	9	3605355	21031556	Rat
9589055	Scfw5	Subcutaneous fat weight QTL 5	5.55	0.001	subcutaneous adipose mass (VT:1000472)	abdominal subcutaneous fat pad weight (CMO:0002069)	9	496645	45496645	Rat
1641911	Alcrsp13	Alcohol response QTL 13			response to alcohol trait (VT:0010489)	brain neurotensin receptor 1 density (CMO:0002068)	9	6214995	51214995	Rat
1300124	Cm4	Cardiac mass QTL 4	3.55		heart mass (VT:0007028)	heart weight to body weight ratio (CMO:0000074)	9	1	41763315	Rat
61425	Cia15	Collagen induced arthritis QTL 15	4.6		joint integrity trait (VT:0010548)	joint inflammation composite score (CMO:0000919)	9	5346479	50416711	Rat
631643	Bp120	Blood pressure QTL 120	3	0.004	arterial blood pressure trait (VT:2000000)	systolic blood pressure (CMO:0000004)	9	6714888	29567695	Rat
70226	Eae4	Experimental allergic encephalomyelitis QTL 4			nervous system integrity trait (VT:0010566)	experimental autoimmune encephalomyelitis incidence/prevalence measurement (CMO:0001046)	9	5474096	6714888	Rat
9589158	Gluco65	Glucose level QTL 65	6.82	0.001	blood glucose amount (VT:0000188)	plasma glucose level (CMO:0000042)	9	496645	45496645	Rat
7411592	Foco8	Food consumption QTL 8	7.4	0.001	eating behavior trait (VT:0001431)	feed conversion ratio (CMO:0001312)	9	496645	45496645	Rat
1298088	Edpm11	Estrogen-dependent pituitary mass QTL 11	2.5		pituitary gland mass (VT:0010496)	pituitary gland wet weight (CMO:0000853)	9	6214995	51214995	Rat

Additional Information

External Database Links

Database	Acc Id	Source(s)
NCBI Gene	100302998	UniSTS
	326551	UniSTS

Gene Annotator (Functional Annotation) unavailable	Gene Annotator (Annotation Distribution) unavailable	Variant Visualizer (Genomic Variants) unavailble Variant Visualizer (Genomic Variants) unavailable
Gene Annotator (Functional Annotation)	Gene Annotator (Annotation Distribution)	Variant Visualizer (Genomic Variants)

InterViewer (Protein-Protein Interactions) unavailable	Gviewer (Genome Viewer) unavailable	Variant Visualizer (Damaging Variants) unavailble Variant Visualizer (Damaging Variants) unavailable
InterViewer (Protein-Protein Interactions)	GViewer (Genome Viewer)	Variant Visualizer (Damaging Variants)

Gene Annotator (Annotation Comparison) unavailable	OLGA (Gene List Generator) unavailable
Gene Annotator (Annotation Comparison)	OLGA (Gene List Generator)	Excel (Download)

MOET (Multi-Ontology Enrichement) unavailable	GOLF (Gene-Ortholog Location Finder) unavailable
MOET (Multi-Ontology Enrichement)	GOLF (Gene-Ortholog Location Finder)

Create Name:

Description:

Send us a Message

Marker: D9Mit6