D6Mit9 Marker Search Result - Rat Genome Database

Send us a Message
Submit Data |  Help |  Video Tutorials |  News |  Publications |  Download |  REST API |  Citing RGD |  Contact   
Search RGD Grant Resources Citing RGD About Us Contact Us
Genes Variants Community Projects QTLs Strains Markers Genome Information Ontologies Cell Lines References Download Submit Data
OntoMate (Literature Search) JBrowse (Genome Browser) Synteny Browser (VCMap) Variant Visualizer Multi-Ontology Enrichment (MOET) Gene-Ortholog Location Finder (GOLF) InterViewer (Protein-Protein Interactions) PhenoMiner (Quatitative Phenotypes) Gene Annotator OLGA (Gene List Generator) AllianceMine GViewer (Genome Viewer)
Aging & Age-Related Disease Behavioral & Substance Use Disorder Cancer & Neoplastic Disease Cardiovascular Disease Coronavirus Disease Developmental Disease Diabetes Hematologic Disease Immune & Inflammatory Disease Infectious Disease Liver Disease Neurological Disease Obesity & Metabolic Syndrome Renal Disease Respiratory Disease Sensory Organ Disease
Find Models Genetic Models Autism Models Rat PhenoMiner (Quantitative Phenotypes) Chinchilla PhenoMiner Expected Ranges (Quantitative Phenotype) PhenoMiner Term Comparison Hybrid Rat Diversity Panel Phenotypes Phenotypes in Other Animal Models Animal Husbandry Strain Medical Records Phylogenetics Strain Availability Calendar Rats 101 Submissions Photo Archive
Pathways
Rat Community Forum Directory of Rat Laboratories Video Tutorials News RGD Publications RGD Presentations Archive Nomenclature Guidelines Resource Links Laboratory Resources Employment Resources
Advanced Search (OLGA)

Marker: D6Mit9

Symbol: D6Mit9
Previously known as: MIT721; R1101-C02; R721; oxsts5173; 
RGD ID: 33828
Expected Size: 158 (bp)
Position
Rat AssemblyChrPosition (strand)SourceJBrowse
GRCr8639,028,501 - 39,028,659 (+)Marker Load Pipeline
mRatBN7.2633,309,391 - 33,309,549 (+)MAPPERmRatBN7.2
Rnor_6.0636,260,131 - 36,260,288NCBIRnor6.0
Rnor_5.0646,021,237 - 46,021,394UniSTSRnor5.0
RGSC_v3.4634,039,303 - 34,039,461RGDRGSC3.4
RGSC_v3.4634,039,304 - 34,039,461UniSTSRGSC3.4
Celera632,744,086 - 32,744,243UniSTS
RGSC_v3.1634,042,257 - 34,042,414RGD
RH 3.4 Map6123.2UniSTS
RH 3.4 Map6123.2RGD
RH 2.0 Map6277.3RGD
SHRSP x BN Map628.5599RGD
Cytogenetic Map6 RGD
Is Marker For: Strains:   AVN/Orl ; BBDR/Rhw ; BBDP/Rhw ; BDIX/Han ; BDVII/Cub ; BN-Lx/Cub ; BN/SsNHsd ; BP/Cub ; BUF/Pit ; COP/OlaHsd ; DA/PitN ; FHH/Eur ; F344/Pit ; GH/Omr ; GK/KyoSwe ; DON/Melb ; M520/N ; IS/Kyo ; WN/N ; LH/Mav ; LE/Mol ; LEW/Pit ; LOU/CHan ; LN/Mav ; MHS/Gib ; MNR/N ; MNRA/N ; MNS/Gib ; MR/Pit ; NEDH/K ; NP9 ; ODU/N ; OKA/Wsl ; OM/Ztm ; P5C ; PVG/Pit ; SD/Rij ; SHR/OlaHsd ; SR/Jr ; SHRSP/Riv ; SS/Jr ; WAG/RijKyo ; WF/Pit ; WIST/Nhg ; WKY/OlaHsd
QTLs:   Coreg1   Bw118   Bp323   Bp325   Cm77  


Annotation


References - curated
# Reference Title Reference Citation
1. Data downloaded from Wellcome Trust, University of Oxford Data downloaded from Wellcome Trust, University of Oxford
2. High-density rat radiation hybrid maps containing over 24,000 SSLPs, genes, and ESTs provide a direct link to the rat genome sequence. Kwitek AE, etal., Genome Res. 2004 Apr;14(4):750-7
3. Rat Genetic Map Data Rat Genetic Map Data, Whitehead Institute for Biomedical Research/MIT Center for Genome Research Website, http://waldo.wi.mit.edu/rat/public/distribution/rat_sslp_releases/jan00/
4. Electronic Transfer of SSLP Data Rat Genetic Mapping Project, Whitehead Institute for Biomedical Research. APR. 2001.
5. UniSTS Pipeline RGD automated pipelines
6. RH Map Project RH Map Project, Laboratory of Genetic Research Website, 1-JUL-99, Laboratory of Genetic Research, Medical College of Wisconsin, http://www.lgr.mcw.edu/LGR/
7. A high density integrated genetic linkage and radiation hybrid map of the laboratory rat Steen RG, Kwitek-Black AE, etal., Genome Research, 1999, 6:1-8
8. Electronic Submission of SSLP Data Sets Wilder R. Oct.2000. National Institute of Arthritis and Musculoskeletal and Skin Diseases, ARB Rat Genetic Database

Strains and Sequence

Sequence
 
Forward Primer AGAGTCAGCGAAAGGCTGG
Reverse Primer TTAATTACAATAGGGAAACATTTGT
 

Region

Genes in Region
The following Genes overlap with this region.    Full Report CSV TAB Printer Analysis Tools
RGD IDSymbolNameChrStartStopSpecies
41370558LOC120103512uncharacterized LOC12010351263897473539044631Rat



QTLs in Region (GRCr8)
The following QTLs overlap with this region.    Full Report CSV TAB Printer Gviewer
RGD IDSymbolNameLODP ValueTraitSub TraitChrStartStopSpecies
8552962Pigfal16Plasma insulin-like growth factor 1 level QTL 169.4blood insulin-like growth factor amount (VT:0010479)plasma insulin-like growth factor 1 level (CMO:0001299)6197587946975879Rat
634318Bw118Body weight QTL 1183.55abdominal fat pad mass (VT:1000711)abdominal fat pad weight (CMO:0000088)63902865963457441Rat
10401812Kidm54Kidney mass QTL 54kidney mass (VT:0002707)both kidneys wet weight (CMO:0000085)62009763565097635Rat
8552910Pigfal5Plasma insulin-like growth factor 1 level QTL 54.3blood insulin-like growth factor amount (VT:0010479)plasma insulin-like growth factor 1 level (CMO:0001299)62265388967653889Rat
10401800Kidm49Kidney mass QTL 49kidney mass (VT:0002707)both kidneys wet weight (CMO:0000085)62009763565097635Rat
1300164Rf15Renal function QTL 153.12renal blood flow trait (VT:2000006)absolute change in renal blood flow rate (CMO:0001168)6323998948239989Rat
1331779Rf38Renal function QTL 382.876kidney blood vessel physiology trait (VT:0100012)absolute change in renal vascular resistance (CMO:0001900)63118500276185002Rat
9589129Insul24Insulin level QTL 2419.060.001blood insulin amount (VT:0001560)plasma insulin level (CMO:0000342)6197587946975879Rat
7411603Foco13Food consumption QTL 135.50.001eating behavior trait (VT:0001431)feed conversion ratio (CMO:0001312)6197587946975879Rat
1598843Cm63Cardiac mass QTL 632.6heart mass (VT:0007028)heart weight to body weight ratio (CMO:0000074)6144788383Rat
7411542Bw127Body weight QTL 1275.50.001body mass (VT:0001259)body weight gain (CMO:0000420)6197587946975879Rat
2292616Ept15Estrogen-induced pituitary tumorigenesis QTL 154.4pituitary gland mass (VT:0010496)pituitary gland wet weight (CMO:0000853)6144788383Rat
9589048Scfw3Subcutaneous fat weight QTL 34.570.001subcutaneous adipose mass (VT:1000472)abdominal subcutaneous fat pad weight (CMO:0002069)6197587946975879Rat
2293839Kiddil2Kidney dilation QTL 24.8kidney pelvis morphology trait (VT:0004194)hydronephrosis severity score (CMO:0001208)62661831486868070Rat
1576309Emca7Estrogen-induced mammary cancer QTL 74mammary gland integrity trait (VT:0010552)mammary tumor number (CMO:0000343)620859430113082285Rat
2301964Bp323Blood pressure QTL 3234.3arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)6186868070Rat
2293709Bss23Bone structure and strength QTL 235.180.0001femur morphology trait (VT:0000559)femur cross-sectional area (CMO:0001661)6323998948239989Rat
2293650Bss31Bone structure and strength QTL 315.050.0001femur strength trait (VT:0010010)femur midshaft polar moment of inertia (CMO:0001669)6323998948239989Rat
1578665Bss16Bone structure and strength QTL 164.4femur morphology trait (VT:0000559)bone trabecular cross-sectional area (CMO:0002311)63332884178328841Rat
2293841Kiddil4Kidney dilation QTL 44.4kidney pelvis morphology trait (VT:0004194)hydronephrosis severity score (CMO:0001208)62661831486868070Rat
1300128Rf16Renal function QTL 163.89renal blood flow trait (VT:2000006)absolute change in renal blood flow rate (CMO:0001168)6140163351Rat
1641898Colcr4Colorectal carcinoma resistance QTL43.710.0007intestine integrity trait (VT:0010554)well differentiated malignant colorectal tumor surface area measurement (CMO:0002077)63093763275937632Rat
1578668Bmd14Bone mineral density QTL 143.8femur mineral mass (VT:0010011)total volumetric bone mineral density (CMO:0001728)63332884178328841Rat
6893340Cm77Cardiac mass QTL 770.260.57heart mass (VT:0007028)heart weight to body weight ratio (CMO:0000074)63902865986867923Rat
70199Coreg1Compensatory renal growth QTL 111.8kidney mass (VT:0002707)compensatory renal growth score (CMO:0001894)61459947363457687Rat
2301972Bp325Blood pressure QTL 3254.8arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)61608937261967788Rat
1358190Ept1Estrogen-induced pituitary tumorigenesis QTL 14.4pituitary gland mass (VT:0010496)pituitary gland wet weight (CMO:0000853)6144788383Rat
2293656Bss28Bone structure and strength QTL 286.790.0001femur morphology trait (VT:0000559)femur midshaft cortical cross-sectional area (CMO:0001663)6323998948239989Rat
1354664Slep2Serum leptin concentration QTL 24.49blood leptin amount (VT:0005667)serum leptin level (CMO:0000780)62228825767288257Rat


Additional Information

RGD Curation Notes
Note Type Note Reference
Database Acc Id Source(s)
NCBI Gene 100302983 UniSTS
  100303401 UniSTS
  101027069 UniSTS
  326525 UniSTS
  387394 UniSTS