D11Mit2 Marker Search Result - Rat Genome Database

Advanced Search (OLGA)

General

Marker: D11Mit2

Symbol:

D11Mit2

Previously known as:

oxsts8829; R561;

RGD ID:

33792

Expected Size:

262 (bp)

Position

Rat Assembly	Chr	Position (strand)	Source	JBrowse
GRCr8	11	43,646,076 - 43,646,338 (+)	Marker Load Pipeline
mRatBN7.2	11	30,159,995 - 30,160,257 (+)	MAPPER	mRatBN7.2
Rnor_6.0	11	31,072,184 - 31,072,445	NCBI	Rnor6.0
Rnor_5.0	11	34,683,658 - 34,683,919	UniSTS	Rnor5.0
RGSC_v3.4	11	30,888,233 - 30,888,495	RGD	RGSC3.4
RGSC_v3.4	11	30,888,234 - 30,888,495	UniSTS	RGSC3.4
Celera	11	29,827,596 - 29,827,857	UniSTS
RGSC_v3.1	11	30,888,130 - 30,888,489	RGD
RH 3.4 Map	11	182.7	UniSTS
RH 3.4 Map	11	182.7	RGD
RH 2.0 Map	11	472.1	RGD
Cytogenetic Map	11	q11	UniSTS

Is Marker For:

Strains: ACI/N ; AVN/Orl ; BBDR/Rhw ; BBDP/Rhw ; BC/CpbU ; BDIX/Han ; BDVII/Cub ; BN-Lx/Cub ; BN/SsNHsd ; BP/Cub ; BUF/Pit ; COP/OlaHsd ; DA/PitN ; FHH/Eur ; F344/Pit ; GH/Omr ; GK/KyoSwe ; DON/Melb ; M520/N ; IS/Kyo ; LH/Mav ; LE/Mol ; LEW/Pit ; LOU/CHan ; LN/Mav ; MHS/Gib ; MNR/N ; MNRA/N ; MNS/Gib ; MR/Pit ; NEDH/K ; NP9 ; ODU/N ; OKA/Wsl ; OM/Ztm ; P5C ; PVG/Pit ; SD/Rij ; SHR/OlaHsd ; SR/Jr ; SHRSP/Riv ; SS/Jr ; WAG/RijKyo ; WF/Pit ; WIST/Nhg ; WKY/OlaHsd ; WTC/Kyo
QTLs: Uae18
Genes: Eva1c

Annotation

References - curated

#	Reference Title	Reference Citation
1.	Data downloaded from Wellcome Trust, University of Oxford	Data downloaded from Wellcome Trust, University of Oxford
2.	High-density rat radiation hybrid maps containing over 24,000 SSLPs, genes, and ESTs provide a direct link to the rat genome sequence.	Kwitek AE, etal., Genome Res. 2004 Apr;14(4):750-7
3.	UniSTS Pipeline	RGD automated pipelines
4.	RH Map Project	RH Map Project, Laboratory of Genetic Research Website, 1-JUL-99, Laboratory of Genetic Research, Medical College of Wisconsin, http://www.lgr.mcw.edu/LGR/
5.	A high density integrated genetic linkage and radiation hybrid map of the laboratory rat	Steen RG, Kwitek-Black AE, etal., Genome Research, 1999, 6:1-8
6.	Electronic Submission of SSLP Data Sets	Wilder R. Oct.2000. National Institute of Arthritis and Musculoskeletal and Skin Diseases, ARB Rat Genetic Database

Strains and Sequence

Sequence


Forward Primer	CCCCCAGCCTACACACAG
Reverse Primer	GCTATTTCTCACAGAAAGGGG

Strain Variation

Strain, Expected Size(s)

ACI/N	259
AVN/Orl	259
BBDP/Rhw	229
BBDR/Rhw	229
BC/CpbU	229
BDIX/Han	261
BDVII/Cub	229
BN-Lx/Cub	265
BN/SsNHsd	265
BP/Cub	261
BUF/Pit	229
COP/OlaHsd	261

DA/PitN	261
DON/Melb	261
F344/Pit	261
FHH/Eur	261
GH/Omr	261
GK/KyoSwe	261
IS/Kyo	261
LE/Mol	271
LEW/Pit	261
LH/Mav	261
LN/Mav	261
LOU/CHan	261

M520/N	261
MHS/Gib	263
MNR/N	263
MNRA/N	263
MNS/Gib	265
MR/Pit	263
NEDH/K	265
NP9	229
ODU/N	261
OKA/Wsl	241
OM/Ztm	261
P5C	229

PVG/Pit	261
SD/Rij	229
SHR/OlaHsd	241
SHRSP/Riv	241
SR/Jr	261
SS/Jr	261
WAG/RijKyo	229
WF/Pit	229
WIST/Nhg	229
WKY/OlaHsd	261
WTC/Kyo	261

Region

Genes in Region

The following Genes overlap with this region.

RGD ID	Symbol	Name	Chr	Start	Stop	Species
1307569	Eva1c	eva-1 homolog C	11	43575613	43649677	Rat

Nucleotide Sequences


GenBank Nucleotide	AC094784	(Get FASTA)	NCBI Sequence Viewer	Search GEO for Microarray Profiles
	AU028558	(Get FASTA)	NCBI Sequence Viewer	Search GEO for Microarray Profiles

QTLs in Region (GRCr8)

The following QTLs overlap with this region.

RGD ID	Symbol	Name	LOD	P Value	Trait	Sub Trait	Chr	Start	Stop	Species
1300147	Bp187	Blood pressure QTL 187	3.67		arterial blood pressure trait (VT:2000000)	blood pressure time series experimental set point of the baroreceptor response (CMO:0002593)	11	22524746	82951192	Rat
1598841	Memor7	Memory QTL 7			exploratory behavior trait (VT:0010471)	total horizontal distance resulting from voluntary locomotion in an experimental apparatus (CMO:0001443)	11	33306008	78306008	Rat
1598842	Glom10	Glomerulus QTL 10	3.4		kidney glomerulus morphology trait (VT:0005325)	index of glomerular damage (CMO:0001135)	11	3818154	48818154	Rat
1598811	Bp291	Blood pressure QTL 291	1.9		arterial blood pressure trait (VT:2000000)	systolic blood pressure (CMO:0000004)	11	33306008	78306008	Rat
634339	Niddm50	Non-insulin dependent diabetes mellitus QTL 50	3.32		blood glucose amount (VT:0000188)	plasma glucose level (CMO:0000042)	11	10806125	55806125	Rat
634341	Bw121	Body weight QTL 121	3.56		abdominal fat pad mass (VT:1000711)	abdominal fat pad weight (CMO:0000088)	11	35323199	55805892	Rat
8694376	Bw156	Body weight QTL 156	2.25	0.001	body lean mass (VT:0010483)	lean tissue morphological measurement (CMO:0002184)	11	36749459	81749459	Rat
10755497	Bp388	Blood pressure QTL 388	2.76		arterial blood pressure trait (VT:2000000)	systolic blood pressure (CMO:0000004)	11	32943067	89836615	Rat
724517	Uae18	Urinary albumin excretion QTL 18	3.7		urine albumin amount (VT:0002871)	urine albumin excretion rate (CMO:0000757)	11	29958996	57754989	Rat
2290451	Scl58	Serum cholesterol level QTL 58	3.48		blood cholesterol amount (VT:0000180)	plasma total cholesterol level (CMO:0000585)	11	26318031	55806125	Rat
1300130	Rf20	Renal function QTL 20	4.44		kidney glomerulus integrity trait (VT:0010546)	kidney glomerulus diameter (CMO:0001166)	11	31915469	76915469	Rat
10058952	Gmadr6	Adrenal mass QTL 6	2.29	0.0072	adrenal gland mass (VT:0010420)	both adrenal glands wet weight to body weight ratio (CMO:0002411)	11	36428416	81428416	Rat
1600394	Edcs1	Endometrial carcinoma susceptibility QTL1	2.9	0.04	uterus morphology trait (VT:0001120)	percentage of study population developing endometrioid carcinoma during a period of time (CMO:0001759)	11	12823152	57823152	Rat
1558659	Tescar1	Testicular tumor resistance QTL 1	3.9		testis integrity trait (VT:0010572)	percentage of study population developing testis tumors during a period of time (CMO:0001261)	11	34618760	79618760	Rat
724563	Uae10	Urinary albumin excretion QTL 10	6		urine albumin amount (VT:0002871)	urine albumin level (CMO:0000130)	11	20193549	96351019	Rat
9589032	Epfw10	Epididymal fat weight QTL 10	9.29	0.001	epididymal fat pad mass (VT:0010421)	epididymal fat pad weight to body weight ratio (CMO:0000658)	11	36749459	81749459	Rat
9590313	Scort20	Serum corticosterone level QTL 20	6.51	0.001	blood corticosterone amount (VT:0005345)	plasma corticosterone level (CMO:0001173)	11	36749459	81749459	Rat
8694424	Bw162	Body weight QTL 162	3.8	0.001	body lean mass (VT:0010483)	lean tissue morphological measurement (CMO:0002184)	11	36749459	81749459	Rat
631510	Spl2	Serum phospholipid level QTL 2	4.1		blood phospholipid amount (VT:0006084)	serum phospholipid level (CMO:0001171)	11	27556685	72556685	Rat

Additional Information

RGD Curation Notes

Note Type	Note	Reference

External Database Links

Database	Acc Id	Source(s)
NCBI Gene	360695	UniSTS
	387433	UniSTS

Gene Annotator (Functional Annotation) unavailable	Gene Annotator (Annotation Distribution) unavailable	Variant Visualizer (Genomic Variants) unavailble Variant Visualizer (Genomic Variants) unavailable
Gene Annotator (Functional Annotation)	Gene Annotator (Annotation Distribution)	Variant Visualizer (Genomic Variants)

InterViewer (Protein-Protein Interactions) unavailable	Gviewer (Genome Viewer) unavailable	Variant Visualizer (Damaging Variants) unavailble Variant Visualizer (Damaging Variants) unavailable
InterViewer (Protein-Protein Interactions)	GViewer (Genome Viewer)	Variant Visualizer (Damaging Variants)

Gene Annotator (Annotation Comparison) unavailable	OLGA (Gene List Generator) unavailable
Gene Annotator (Annotation Comparison)	OLGA (Gene List Generator)	Excel (Download)

MOET (Multi-Ontology Enrichement) unavailable	GOLF (Gene-Ortholog Location Finder) unavailable
MOET (Multi-Ontology Enrichement)	GOLF (Gene-Ortholog Location Finder)

Create Name:

Description:

Send us a Message

Marker: D11Mit2