D11Mit2 Marker Search Result - Rat Genome Database

Send us a Message



Submit Data |  Help |  Video Tutorials |  News |  Publications |  Download |  REST API |  Citing RGD |  Contact   
Pathways

Marker: D11Mit2

Symbol: D11Mit2
Previously known as: oxsts8829; R561; 
RGD ID: 33792
Expected Size: 262 (bp)
Position
Rat AssemblyChrPosition (strand)SourceJBrowse
GRCr81143,646,076 - 43,646,338 (+)Marker Load Pipeline
mRatBN7.21130,159,995 - 30,160,257 (+)MAPPERmRatBN7.2
Rnor_6.01131,072,184 - 31,072,445NCBIRnor6.0
Rnor_5.01134,683,658 - 34,683,919UniSTSRnor5.0
RGSC_v3.41130,888,233 - 30,888,495RGDRGSC3.4
RGSC_v3.41130,888,234 - 30,888,495UniSTSRGSC3.4
Celera1129,827,596 - 29,827,857UniSTS
RGSC_v3.11130,888,130 - 30,888,489RGD
RH 3.4 Map11182.7UniSTS
RH 3.4 Map11182.7RGD
RH 2.0 Map11472.1RGD
Cytogenetic Map11q11UniSTS
Is Marker For: Strains:   ACI/N ; AVN/Orl ; BBDR/Rhw ; BBDP/Rhw ; BC/CpbU ; BDIX/Han ; BDVII/Cub ; BN-Lx/Cub ; BN/SsNHsd ; BP/Cub ; BUF/Pit ; COP/OlaHsd ; DA/PitN ; FHH/Eur ; F344/Pit ; GH/Omr ; GK/KyoSwe ; DON/Melb ; M520/N ; IS/Kyo ; LH/Mav ; LE/Mol ; LEW/Pit ; LOU/CHan ; LN/Mav ; MHS/Gib ; MNR/N ; MNRA/N ; MNS/Gib ; MR/Pit ; NEDH/K ; NP9 ; ODU/N ; OKA/Wsl ; OM/Ztm ; P5C ; PVG/Pit ; SD/Rij ; SHR/OlaHsd ; SR/Jr ; SHRSP/Riv ; SS/Jr ; WAG/RijKyo ; WF/Pit ; WIST/Nhg ; WKY/OlaHsd ; WTC/Kyo
QTLs:   Uae18  
Genes:   Eva1c  


Annotation


References - curated
# Reference Title Reference Citation
1. Data downloaded from Wellcome Trust, University of Oxford Data downloaded from Wellcome Trust, University of Oxford
2. High-density rat radiation hybrid maps containing over 24,000 SSLPs, genes, and ESTs provide a direct link to the rat genome sequence. Kwitek AE, etal., Genome Res. 2004 Apr;14(4):750-7
3. UniSTS Pipeline RGD automated pipelines
4. RH Map Project RH Map Project, Laboratory of Genetic Research Website, 1-JUL-99, Laboratory of Genetic Research, Medical College of Wisconsin, http://www.lgr.mcw.edu/LGR/
5. A high density integrated genetic linkage and radiation hybrid map of the laboratory rat Steen RG, Kwitek-Black AE, etal., Genome Research, 1999, 6:1-8
6. Electronic Submission of SSLP Data Sets Wilder R. Oct.2000. National Institute of Arthritis and Musculoskeletal and Skin Diseases, ARB Rat Genetic Database

Strains and Sequence

Sequence
 
Forward Primer CCCCCAGCCTACACACAG
Reverse Primer GCTATTTCTCACAGAAAGGGG
 

Region

Genes in Region
The following Genes overlap with this region.    Full Report CSV TAB Printer Analysis Tools
RGD IDSymbolNameChrStartStopSpecies
1307569Eva1ceva-1 homolog C114357561343649677Rat

Nucleotide Sequences
GenBank Nucleotide AC094784 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AU028558 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles


QTLs in Region (GRCr8)
The following QTLs overlap with this region.    Full Report CSV TAB Printer Gviewer
RGD IDSymbolNameLODP ValueTraitSub TraitChrStartStopSpecies
1300147Bp187Blood pressure QTL 1873.67arterial blood pressure trait (VT:2000000)blood pressure time series experimental set point of the baroreceptor response (CMO:0002593)112252474682951192Rat
1598841Memor7Memory QTL 7exploratory behavior trait (VT:0010471)total horizontal distance resulting from voluntary locomotion in an experimental apparatus (CMO:0001443)113330600878306008Rat
1598842Glom10Glomerulus QTL 103.4kidney glomerulus morphology trait (VT:0005325)index of glomerular damage (CMO:0001135)11381815448818154Rat
1598811Bp291Blood pressure QTL 2911.9arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)113330600878306008Rat
634339Niddm50Non-insulin dependent diabetes mellitus QTL 503.32blood glucose amount (VT:0000188)plasma glucose level (CMO:0000042)111080612555806125Rat
634341Bw121Body weight QTL 1213.56abdominal fat pad mass (VT:1000711)abdominal fat pad weight (CMO:0000088)113532319955805892Rat
8694376Bw156Body weight QTL 1562.250.001body lean mass (VT:0010483)lean tissue morphological measurement (CMO:0002184)113674945981749459Rat
10755497Bp388Blood pressure QTL 3882.76arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)113294306789836615Rat
724517Uae18Urinary albumin excretion QTL 183.7urine albumin amount (VT:0002871)urine albumin excretion rate (CMO:0000757)112995899657754989Rat
2290451Scl58Serum cholesterol level QTL 583.48blood cholesterol amount (VT:0000180)plasma total cholesterol level (CMO:0000585)112631803155806125Rat
1300130Rf20Renal function QTL 204.44kidney glomerulus integrity trait (VT:0010546)kidney glomerulus diameter (CMO:0001166)113191546976915469Rat
10058952Gmadr6Adrenal mass QTL 62.290.0072adrenal gland mass (VT:0010420)both adrenal glands wet weight to body weight ratio (CMO:0002411)113642841681428416Rat
1600394Edcs1Endometrial carcinoma susceptibility QTL12.90.04uterus morphology trait (VT:0001120)percentage of study population developing endometrioid carcinoma during a period of time (CMO:0001759)111282315257823152Rat
1558659Tescar1Testicular tumor resistance QTL 13.9testis integrity trait (VT:0010572)percentage of study population developing testis tumors during a period of time (CMO:0001261)113461876079618760Rat
724563Uae10Urinary albumin excretion QTL 106urine albumin amount (VT:0002871)urine albumin level (CMO:0000130)112019354996351019Rat
9589032Epfw10Epididymal fat weight QTL 109.290.001epididymal fat pad mass (VT:0010421)epididymal fat pad weight to body weight ratio (CMO:0000658)113674945981749459Rat
9590313Scort20Serum corticosterone level QTL 206.510.001blood corticosterone amount (VT:0005345)plasma corticosterone level (CMO:0001173)113674945981749459Rat
8694424Bw162Body weight QTL 1623.80.001body lean mass (VT:0010483)lean tissue morphological measurement (CMO:0002184)113674945981749459Rat
631510Spl2Serum phospholipid level QTL 24.1blood phospholipid amount (VT:0006084)serum phospholipid level (CMO:0001171)112755668572556685Rat


Additional Information

RGD Curation Notes
Note Type Note Reference
Database Acc Id Source(s)
NCBI Gene 360695 UniSTS
  387433 UniSTS