D5Mgh2 Marker Search Result - Rat Genome Database

Send us a Message



Submit Data |  Help |  Video Tutorials |  News |  Publications |  Download |  REST API |  Citing RGD |  Contact   
Pathways

Marker: D5Mgh2

Symbol: D5Mgh2
Previously known as: Penk; oxsts5099; 
RGD ID: 11072
Expected Size: 135 (bp)
Position
Rat AssemblyChrPosition (strand)SourceJBrowse
Rnor_5.01661,815,479 - 61,816,040UniSTSRnor5.0
Rnor_5.0521,842,228 - 21,842,328UniSTSRnor5.0
RGSC_v3.4517,517,135 - 17,517,235UniSTSRGSC3.4
RGSC_v3.41662,207,989 - 62,208,550UniSTSRGSC3.4
RGSC_v3.4517,517,134 - 17,517,235RGDRGSC3.4
Celera516,536,980 - 16,537,080UniSTS
Celera1656,475,146 - 56,475,707UniSTS
RGSC_v3.1517,517,134 - 17,517,235RGD
RH 3.4 Map5100.9RGD
RH 3.4 Map5100.9UniSTS
RH 2.0 Map5107.5RGD
Cytogenetic Map16q12.3UniSTS
Is Marker For: Strains:   ACI/N ; AVN/Orl ; BBDR/Rhw ; BBDP/Rhw ; BC/CpbU ; BDIX/Han ; BDVII/Cub ; BN-Lx/Cub ; BN/SsNHsd ; BP/Cub ; BUF/Pit ; COP/OlaHsd ; DA/PitN ; FHH/Eur ; F344/Pit ; GH/Omr ; GK/KyoSwe ; DON/Melb ; M520/N ; IS/Kyo ; LE/Mol ; LEW/Pit ; LOU/CHan ; LN/Mav ; MHS/Gib ; MNR/N ; MNRA/N ; MNS/Gib ; MR/Pit ; NEDH/K ; NP9 ; ODU/N ; OKA/Wsl ; OM/Ztm ; P5C ; PVG/Pit ; SD/Rij ; SHR/OlaHsd ; SR/Jr ; SHRSP/Riv ; SS/Jr ; WAG/RijKyo ; WIST/Nhg ; WKY/OlaHsd ; WTC/Kyo
QTLs:   Bp119   Tcas11   Pia33   Gluco59   Slep12  
Genes:   Gtf2e2   LOC100912510   Smim18  


Annotation


References - curated
# Reference Title Reference Citation
1. Data downloaded from Wellcome Trust, University of Oxford Data downloaded from Wellcome Trust, University of Oxford
2. High-density rat radiation hybrid maps containing over 24,000 SSLPs, genes, and ESTs provide a direct link to the rat genome sequence. Kwitek AE, etal., Genome Res. 2004 Apr;14(4):750-7
3. UniSTS Pipeline RGD automated pipelines
4. RH Map Project RH Map Project, Laboratory of Genetic Research Website, 1-JUL-99, Laboratory of Genetic Research, Medical College of Wisconsin, http://www.lgr.mcw.edu/LGR/
5. A high density integrated genetic linkage and radiation hybrid map of the laboratory rat Steen RG, Kwitek-Black AE, etal., Genome Research, 1999, 6:1-8
6. Electronic Submission of SSLP Data Sets Wilder R. Oct.2000. National Institute of Arthritis and Musculoskeletal and Skin Diseases, ARB Rat Genetic Database

Strains and Sequence

Sequence
 
Forward Primer TACCTAGGAAGCGCAAGGC
Reverse Primer AGCTTGGCTACAGCATGGTT
 

Region

Nucleotide Sequences
GenBank Nucleotide U03026 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles


Additional Information

RGD Curation Notes
Note Type Note Reference
Database Acc Id Source(s)
NCBI Gene 100302826 UniSTS
  100302986 UniSTS
  100381191 UniSTS
  100909793 UniSTS
  100912510 UniSTS
  306516 UniSTS
  369183 UniSTS
NCBI Nucleotide U03026