Symbol:
Mmp3
Name:
matrix metallopeptidase 3
RGD ID:
621317
Description:
Predicted to enable metalloendopeptidase activity. Involved in several processes, including cellular response to cell-matrix adhesion; cellular response to interleukin-1; and response to estradiol. Located in cell body; dendrite; and extracellular space. Part of protein-containing complex. Biomarker of several diseases, including abdominal aortic aneurysm; degenerative disc disease; gastric ulcer; glomerulonephritis (multiple); and type 2 diabetes mellitus. Human ortholog(s) of this gene implicated in several diseases, including artery disease (multiple); carcinoma (multiple); end stage renal disease; osteoarthritis; and von Hippel-Lindau disease. Orthologous to human MMP3 (matrix metallopeptidase 3); PARTICIPATES IN rheumatoid arthritis pathway; INTERACTS WITH (+)-schisandrin B; (S)-nicotine; 17alpha-ethynylestradiol.
Type:
protein-coding
RefSeq Status:
VALIDATED
Previously known as:
matrix metalloproteinase 3; matrix metalloproteinase-3; MMP-3; PTR1 protein; SL-1; stromelysin-1; transin-1
RGD Orthologs
Alliance Orthologs
More Info
more info ...
More Info
Latest Assembly:
GRCr8 - GRCr8 Assembly
Position:
Rat Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl GRCr8 8 12,925,267 - 12,938,828 (+) NCBI GRCr8 mRatBN7.2 8 4,640,397 - 4,653,963 (+) NCBI mRatBN7.2 mRatBN7.2 mRatBN7.2 Ensembl 8 4,640,416 - 4,653,961 (+) Ensembl mRatBN7.2 Ensembl UTH_Rnor_SHR_Utx 8 8,600,140 - 8,613,640 (+) NCBI Rnor_SHR UTH_Rnor_SHR_Utx UTH_Rnor_SHRSP_BbbUtx_1.0 8 6,897,910 - 6,911,412 (+) NCBI Rnor_SHRSP UTH_Rnor_SHRSP_BbbUtx_1.0 UTH_Rnor_WKY_Bbb_1.0 8 4,900,079 - 4,913,622 (+) NCBI Rnor_WKY UTH_Rnor_WKY_Bbb_1.0 Rnor_6.0 8 5,676,608 - 5,698,579 (+) NCBI Rnor6.0 Rnor_6.0 rn6 Rnor6.0 Rnor_6.0 Ensembl 8 5,676,665 - 5,698,579 (+) Ensembl Rnor6.0 rn6 Rnor6.0 Rnor_5.0 8 5,680,382 - 5,701,427 (+) NCBI Rnor5.0 Rnor_5.0 rn5 Rnor5.0 RGSC_v3.4 8 4,315,601 - 4,329,146 (+) NCBI RGSC3.4 RGSC_v3.4 rn4 RGSC3.4 RGSC_v3.1 8 4,315,600 - 4,329,146 (+) NCBI Celera 8 6,200,234 - 6,213,783 (+) NCBI Celera Cytogenetic Map 8 q11 NCBI
JBrowse:
View Region in Genome Browser (JBrowse)
Model
Only show annotations with direct experimental evidence (0 objects hidden)
Mmp3 Rat (+)-schisandrin B multiple interactions EXP 6480464 schizandrin B inhibits the reaction [Carbon Tetrachloride results in increased expression of MMP3 mRNA] CTD PMID:31150632 Mmp3 Rat (-)-citrinin multiple interactions ISO MMP3 (Homo sapiens) 6480464 pyrazolanthrone inhibits the reaction [Citrinin results in increased expression of MMP3 mRNA] CTD PMID:19361540 Mmp3 Rat (-)-citrinin increases expression ISO MMP3 (Homo sapiens) 6480464 Citrinin results in increased expression of MMP3 mRNA CTD PMID:19361540 Mmp3 Rat (R)-lipoic acid multiple interactions ISO MMP3 (Homo sapiens) 6480464 Thioctic Acid inhibits the reaction [IL1B protein results in increased expression of MMP3 mRNA] and Thioctic Acid inhibits the reaction [IL1B protein results in increased expression of MMP3 protein] CTD PMID:24975507 Mmp3 Rat (S)-nicotine multiple interactions ISO MMP3 (Homo sapiens) 6480464 lipopolysaccharide more ... CTD PMID:18986645 and PMID:39098741 Mmp3 Rat (S)-nicotine increases expression EXP 6480464 Nicotine results in increased expression of MMP3 mRNA CTD PMID:39098741 Mmp3 Rat (S)-nicotine increases expression ISO MMP3 (Homo sapiens) 6480464 Nicotine results in increased expression of MMP3 mRNA and Nicotine results in increased expression of MMP3 protein CTD PMID:17151781 more ... Mmp3 Rat 1,2-dichloroethane decreases expression ISO Mmp3 (Mus musculus) 6480464 ethylene dichloride results in decreased expression of MMP3 mRNA CTD PMID:28960355 Mmp3 Rat 1-chloro-2,4-dinitrobenzene increases expression ISO MMP3 (Homo sapiens) 6480464 Dinitrochlorobenzene results in increased expression of MMP3 mRNA CTD PMID:20146380 Mmp3 Rat 1-naphthyl isothiocyanate increases expression ISO Mmp3 (Mus musculus) 6480464 1-Naphthylisothiocyanate results in increased expression of MMP3 mRNA CTD PMID:15913567 Mmp3 Rat 17alpha-ethynylestradiol affects expression ISO Mmp3 (Mus musculus) 6480464 Ethinyl Estradiol affects the expression of MMP3 mRNA CTD PMID:17555576 Mmp3 Rat 17alpha-ethynylestradiol multiple interactions EXP 6480464 [Ethinyl Estradiol co-treated with Megestrol Acetate] results in increased expression of MMP3 protein CTD PMID:22085904 Mmp3 Rat 17alpha-ethynylestradiol multiple interactions ISO Mmp3 (Mus musculus) 6480464 [Tetrachlorodibenzodioxin co-treated with Ethinyl Estradiol] results in increased expression of MMP3 mRNA CTD PMID:17942748 Mmp3 Rat 17alpha-ethynylestradiol increases expression ISO Mmp3 (Mus musculus) 6480464 Ethinyl Estradiol results in increased expression of MMP3 mRNA CTD PMID:17942748 Mmp3 Rat 17beta-estradiol increases expression ISO MMP3 (Homo sapiens) 6480464 Estradiol results in increased expression of MMP3 mRNA CTD PMID:20106945 Mmp3 Rat 17beta-estradiol decreases expression ISO MMP3 (Homo sapiens) 6480464 Estradiol results in decreased expression of MMP3 mRNA CTD PMID:25878060 Mmp3 Rat 17beta-estradiol multiple interactions ISO Mmp3 (Mus musculus) 6480464 bisphenol A inhibits the reaction [Estradiol results in decreased expression of MMP3 mRNA] and Progesterone inhibits the reaction [Estradiol results in increased expression of MMP3 mRNA] CTD PMID:19416213 and PMID:27312807 Mmp3 Rat 17beta-estradiol increases expression ISO Mmp3 (Mus musculus) 6480464 Estradiol results in increased expression of MMP3 mRNA CTD PMID:19416213 and PMID:19484750 Mmp3 Rat 17beta-estradiol decreases expression ISO Mmp3 (Mus musculus) 6480464 Estradiol results in decreased expression of MMP3 mRNA CTD PMID:19693291 and PMID:27312807 Mmp3 Rat 17beta-estradiol multiple interactions ISO MMP3 (Homo sapiens) 6480464 [Estradiol co-treated with Progesterone] results in decreased secretion of MMP3 protein more ... CTD PMID:16009159 more ... Mmp3 Rat 17beta-estradiol increases secretion ISO MMP3 (Homo sapiens) 6480464 Estradiol results in increased secretion of MMP3 protein CTD PMID:16009159 Mmp3 Rat 17beta-hydroxy-17-methylestra-4,9,11-trien-3-one multiple interactions ISO MMP3 (Homo sapiens) 6480464 Metribolone inhibits the reaction [Tetradecanoylphorbol Acetate results in increased expression of MMP3 mRNA] CTD PMID:8798622 Mmp3 Rat 17beta-hydroxy-5alpha-androstan-3-one multiple interactions ISO MMP3 (Homo sapiens) 6480464 Dihydrotestosterone inhibits the reaction [Tetradecanoylphorbol Acetate results in increased expression of MMP3 mRNA] CTD PMID:8798622 Mmp3 Rat 2,2',4,4'-Tetrabromodiphenyl ether increases expression ISO MMP3 (Homo sapiens) 6480464 2 more ... CTD PMID:32142752 Mmp3 Rat 2,2',4,4'-Tetrabromodiphenyl ether increases secretion ISO MMP3 (Homo sapiens) 6480464 2 more ... CTD PMID:32142752 Mmp3 Rat 2,3,7,8-tetrachlorodibenzodioxine increases expression ISO MMP3 (Homo sapiens) 6480464 Tetrachlorodibenzodioxin results in increased expression of MMP3 mRNA and Tetrachlorodibenzodioxin results in increased expression of MMP3 protein CTD PMID:15531779 more ... Mmp3 Rat 2,3,7,8-tetrachlorodibenzodioxine affects expression EXP 6480464 Tetrachlorodibenzodioxin affects the expression of MMP3 mRNA CTD PMID:34747641 Mmp3 Rat 2,3,7,8-tetrachlorodibenzodioxine affects expression ISO Mmp3 (Mus musculus) 6480464 Tetrachlorodibenzodioxin affects the expression of MMP3 mRNA CTD PMID:21570461 Mmp3 Rat 2,3,7,8-tetrachlorodibenzodioxine decreases expression ISO Mmp3 (Mus musculus) 6480464 Tetrachlorodibenzodioxin results in decreased expression of MMP3 mRNA CTD PMID:21354282 Mmp3 Rat 2,3,7,8-tetrachlorodibenzodioxine multiple interactions ISO Mmp3 (Mus musculus) 6480464 [Tetrachlorodibenzodioxin co-treated with Ethinyl Estradiol] results in increased expression of MMP3 mRNA CTD PMID:17942748 Mmp3 Rat 2,3,7,8-tetrachlorodibenzodioxine multiple interactions ISO MMP3 (Homo sapiens) 6480464 13-hydroxy-10-oxo-11-octadecenoic acid inhibits the reaction [Tetrachlorodibenzodioxin results in increased expression of MMP3 mRNA] more ... CTD PMID:16009159 and PMID:20865247 Mmp3 Rat 2,4-diaminotoluene increases expression ISO Mmp3 (Mus musculus) 6480464 2 and 4-diaminotoluene results in increased expression of MMP3 mRNA CTD PMID:20713471 Mmp3 Rat 2,4-dibromophenyl 2,4,5-tribromophenyl ether affects expression ISO Mmp3 (Mus musculus) 6480464 2 more ... CTD PMID:38648751 Mmp3 Rat 2-amino-2-deoxy-D-glucopyranose multiple interactions ISO MMP3 (Homo sapiens) 6480464 [Glucosamine co-treated with Chondroitin Sulfates] results in decreased expression of MMP3 mRNA more ... CTD PMID:12801482 more ... Mmp3 Rat 2-amino-2-deoxy-D-glucopyranose increases expression EXP 6480464 Glucosamine results in increased expression of MMP3 mRNA CTD PMID:17109745 Mmp3 Rat 2-amino-2-deoxy-D-glucopyranose multiple interactions EXP 6480464 Glucosamine inhibits the reaction [IL1B protein results in increased expression of MMP3 mRNA] more ... CTD PMID:11229466 and PMID:17109745 Mmp3 Rat 2-amino-2-deoxy-D-glucopyranose decreases expression ISO MMP3 (Homo sapiens) 6480464 Glucosamine analog results in decreased expression of MMP3 mRNA CTD PMID:16300972 Mmp3 Rat 2-hydroxypropanoic acid increases expression ISO MMP3 (Homo sapiens) 6480464 Lactic Acid results in increased expression of MMP3 mRNA CTD PMID:30851411 Mmp3 Rat 3,3',4,4',5-pentachlorobiphenyl increases expression ISO MMP3 (Homo sapiens) 6480464 3 more ... CTD PMID:35618242 Mmp3 Rat 3,4-dichloroaniline increases expression EXP 6480464 3 and 4-dichloroaniline results in increased expression of MMP3 mRNA CTD PMID:24172598 Mmp3 Rat 3-hydroxypicolinic acid decreases activity ISO MMP3 (Homo sapiens) 6480464 3-hydroxypicolinic acid results in decreased activity of MMP3 protein CTD PMID:21189019 Mmp3 Rat 3-isobutyl-1-methyl-7H-xanthine multiple interactions ISO Mmp3 (Mus musculus) 6480464 [Zinc co-treated with Nickel co-treated with Cobalt co-treated with 1-Methyl-3-isobutylxanthine co-treated with Dexamethasone co-treated with INS1 protein] results in increased expression of MMP3 mRNA and TNF protein inhibits the reaction [[Zinc co-treated with Nickel co-treated with Cobalt co-treated with 1-Methyl-3-isobutylxanthine co-treated with Dexamethasone co-treated with INS1 protein] results in increased expression of MMP3 mRNA] CTD PMID:23503329 Mmp3 Rat 3-methylcholanthrene increases expression ISO Mmp3 (Mus musculus) 6480464 Methylcholanthrene results in increased expression of MMP3 mRNA CTD PMID:20713471 Mmp3 Rat 3-phenylprop-2-enal increases expression ISO MMP3 (Homo sapiens) 6480464 cinnamaldehyde results in increased expression of MMP3 mRNA CTD PMID:30806763 Mmp3 Rat 4,4'-sulfonyldiphenol decreases expression ISO Mmp3 (Mus musculus) 6480464 bisphenol S results in decreased expression of MMP3 mRNA CTD PMID:32071231 Mmp3 Rat 4-nitroquinoline N-oxide increases expression ISO Mmp3 (Mus musculus) 6480464 4-Nitroquinoline-1-oxide results in increased expression of MMP3 mRNA CTD PMID:22561872 Mmp3 Rat 5-aminolevulinic acid affects expression ISO MMP3 (Homo sapiens) 6480464 Aminolevulinic Acid affects the expression of MMP3 mRNA and Aminolevulinic Acid affects the expression of MMP3 protein CTD PMID:12542540 Mmp3 Rat 5-aminolevulinic acid multiple interactions ISO MMP3 (Homo sapiens) 6480464 Sodium Azide inhibits the reaction [Aminolevulinic Acid affects the expression of MMP3 protein] CTD PMID:12542540 Mmp3 Rat 5-aza-2'-deoxycytidine multiple interactions EXP 6480464 Raloxifene Hydrochloride inhibits the reaction [Decitabine results in increased expression of MMP3 mRNA] CTD PMID:23385821 Mmp3 Rat 5-aza-2'-deoxycytidine increases expression EXP 6480464 Decitabine results in increased expression of MMP3 mRNA CTD PMID:23385821 Mmp3 Rat 5-chloro-7-iodoquinolin-8-ol multiple interactions ISO MMP3 (Homo sapiens) 6480464 [Clioquinol co-treated with Copper] results in increased expression of and results in increased activity of MMP3 protein CTD PMID:16648635 Mmp3 Rat 5-fluorouracil multiple interactions ISO MMP3 (Homo sapiens) 6480464 MMP3 promoter polymorphism affects the susceptibility to [Fluorouracil co-treated with Cisplatin] CTD PMID:15102660 Mmp3 Rat 5-iodotubercidin increases expression ISO MMP3 (Homo sapiens) 6480464 5-iodotubercidin results in increased expression of MMP3 mRNA CTD PMID:26953159 Mmp3 Rat 6-chloro-2,3,4,9-tetrahydro-1H-carbazole-1-carboxamide multiple interactions ISO MMP3 (Homo sapiens) 6480464 [6-chloro-2 more ... CTD PMID:20426787 Mmp3 Rat acetylsalicylic acid multiple interactions EXP 6480464 Aspirin inhibits the reaction [Azoxymethane results in increased expression of MMP3 mRNA] CTD PMID:20043115 Mmp3 Rat aflatoxin B1 affects expression ISO MMP3 (Homo sapiens) 6480464 Aflatoxin B1 affects the expression of MMP3 protein CTD PMID:20106945 Mmp3 Rat aflatoxin B1 increases expression ISO MMP3 (Homo sapiens) 6480464 Aflatoxin B1 results in increased expression of MMP3 mRNA CTD PMID:21641981 and PMID:22100608 Mmp3 Rat aldehydo-D-glucosamine multiple interactions ISO MMP3 (Homo sapiens) 6480464 [Glucosamine co-treated with Chondroitin Sulfates] results in decreased expression of MMP3 mRNA more ... CTD PMID:12801482 more ... Mmp3 Rat aldehydo-D-glucosamine increases expression EXP 6480464 Glucosamine results in increased expression of MMP3 mRNA CTD PMID:17109745 Mmp3 Rat aldehydo-D-glucosamine multiple interactions EXP 6480464 Glucosamine inhibits the reaction [IL1B protein results in increased expression of MMP3 mRNA] more ... CTD PMID:11229466 and PMID:17109745 Mmp3 Rat aldehydo-D-glucosamine decreases expression ISO MMP3 (Homo sapiens) 6480464 Glucosamine analog results in decreased expression of MMP3 mRNA CTD PMID:16300972 Mmp3 Rat all-trans-retinoic acid increases expression ISO MMP3 (Homo sapiens) 6480464 Tretinoin results in increased expression of MMP3 mRNA CTD PMID:16249480 Mmp3 Rat all-trans-retinoic acid multiple interactions ISO MMP3 (Homo sapiens) 6480464 Tretinoin inhibits the reaction [Tetradecanoylphorbol Acetate results in increased expression of MMP3 mRNA] CTD PMID:16176868 Mmp3 Rat alpha-naphthoflavone multiple interactions EXP 6480464 alpha-naphthoflavone inhibits the reaction [Benzo(a)pyrene results in increased expression of MMP3 mRNA] CTD PMID:19022365 Mmp3 Rat aluminium oxide increases expression ISO MMP3 (Homo sapiens) 6480464 Aluminum Oxide results in increased expression of MMP3 mRNA CTD PMID:16488289 Mmp3 Rat ammonium chloride affects expression EXP 6480464 Ammonium Chloride affects the expression of MMP3 mRNA CTD PMID:16483693 Mmp3 Rat anandamide increases expression ISO MMP3 (Homo sapiens) 6480464 anandamide results in increased expression of MMP3 mRNA CTD PMID:16330497 Mmp3 Rat anthra[1,9-cd]pyrazol-6(2H)-one multiple interactions ISO MMP3 (Homo sapiens) 6480464 pyrazolanthrone inhibits the reaction [2 more ... CTD PMID:12832416 more ... Mmp3 Rat antirheumatic drug multiple interactions ISO MMP3 (Homo sapiens) 6480464 [Antirheumatic Agents co-treated with Methotrexate] results in decreased expression of MMP3 protein CTD PMID:23146660 Mmp3 Rat apigenin multiple interactions ISO MMP3 (Homo sapiens) 6480464 Apigenin inhibits the reaction [Bleomycin results in increased expression of MMP3 mRNA] CTD PMID:32554301 Mmp3 Rat arsenite(3-) decreases expression ISO Mmp3 (Mus musculus) 6480464 arsenite results in decreased expression of MMP3 mRNA CTD PMID:18929588 Mmp3 Rat arsenite(3-) multiple interactions ISO Mmp3 (Mus musculus) 6480464 TRP53 protein affects the reaction [arsenite results in decreased expression of MMP3 mRNA] CTD PMID:18929588 Mmp3 Rat arsenous acid decreases expression ISO MMP3 (Homo sapiens) 6480464 Arsenic Trioxide results in decreased expression of MMP3 mRNA CTD PMID:34108876 Mmp3 Rat avobenzone decreases expression ISO MMP3 (Homo sapiens) 6480464 avobenzone results in decreased expression of MMP3 mRNA CTD PMID:31016361 Mmp3 Rat azathioprine increases expression ISO MMP3 (Homo sapiens) 6480464 Azathioprine results in increased expression of MMP3 mRNA CTD PMID:22623647 Mmp3 Rat azithromycin increases secretion ISO MMP3 (Homo sapiens) 6480464 Azithromycin results in increased secretion of MMP3 protein CTD PMID:24890593 Mmp3 Rat azithromycin decreases secretion ISO MMP3 (Homo sapiens) 6480464 Azithromycin results in decreased secretion of MMP3 protein CTD PMID:24890593 Mmp3 Rat Azoxymethane increases expression EXP 6480464 Azoxymethane results in increased expression of MMP3 mRNA CTD PMID:20043115 Mmp3 Rat Azoxymethane multiple interactions EXP 6480464 Aspirin inhibits the reaction [Azoxymethane results in increased expression of MMP3 mRNA] CTD PMID:20043115 Mmp3 Rat benzene increases expression ISO MMP3 (Homo sapiens) 6480464 Benzene results in increased expression of MMP3 mRNA CTD PMID:19446245 Mmp3 Rat benzo[a]pyrene increases expression EXP 6480464 Benzo(a)pyrene results in increased expression of MMP3 mRNA CTD PMID:19022365 Mmp3 Rat benzo[a]pyrene affects methylation ISO MMP3 (Homo sapiens) 6480464 Benzo(a)pyrene affects the methylation of MMP3 promoter CTD PMID:27901495 Mmp3 Rat benzo[a]pyrene increases methylation ISO MMP3 (Homo sapiens) 6480464 Benzo(a)pyrene results in increased methylation of MMP3 3' UTR and Benzo(a)pyrene results in increased methylation of MMP3 exon CTD PMID:27901495 Mmp3 Rat benzo[a]pyrene multiple interactions ISO MMP3 (Homo sapiens) 6480464 [Benzo(a)pyrene co-treated with dibenzo(a and l)pyrene] results in increased expression of MMP3 mRNA CTD PMID:17690111 Mmp3 Rat benzo[a]pyrene increases expression ISO MMP3 (Homo sapiens) 6480464 Benzo(a)pyrene results in increased expression of MMP3 mRNA CTD PMID:21632981 and PMID:32234424 Mmp3 Rat benzo[a]pyrene increases expression ISO Mmp3 (Mus musculus) 6480464 Benzo(a)pyrene results in increased expression of MMP3 mRNA CTD PMID:22228805 Mmp3 Rat benzo[a]pyrene multiple interactions EXP 6480464 alpha-naphthoflavone inhibits the reaction [Benzo(a)pyrene results in increased expression of MMP3 mRNA] CTD PMID:19022365 Mmp3 Rat benzo[a]pyrene diol epoxide I increases expression ISO MMP3 (Homo sapiens) 6480464 7 more ... CTD PMID:20382639 Mmp3 Rat beta-D-glucosamine multiple interactions ISO MMP3 (Homo sapiens) 6480464 [Glucosamine co-treated with Chondroitin Sulfates] results in decreased expression of MMP3 mRNA more ... CTD PMID:12801482 more ... Mmp3 Rat beta-D-glucosamine increases expression EXP 6480464 Glucosamine results in increased expression of MMP3 mRNA CTD PMID:17109745 Mmp3 Rat beta-D-glucosamine multiple interactions EXP 6480464 Glucosamine inhibits the reaction [IL1B protein results in increased expression of MMP3 mRNA] more ... CTD PMID:11229466 and PMID:17109745 Mmp3 Rat beta-D-glucosamine decreases expression ISO MMP3 (Homo sapiens) 6480464 Glucosamine analog results in decreased expression of MMP3 mRNA CTD PMID:16300972 Mmp3 Rat beta-naphthoflavone increases expression ISO MMP3 (Homo sapiens) 6480464 beta-Naphthoflavone results in increased expression of MMP3 mRNA CTD PMID:32151702 Mmp3 Rat bisphenol A increases expression ISO MMP3 (Homo sapiens) 6480464 bisphenol A results in increased expression of MMP3 mRNA CTD PMID:26604029 Mmp3 Rat bisphenol A increases expression ISO Mmp3 (Mus musculus) 6480464 bisphenol A results in increased expression of MMP3 mRNA CTD PMID:32156529 Mmp3 Rat bisphenol A decreases expression ISO Mmp3 (Mus musculus) 6480464 bisphenol A results in decreased expression of MMP3 mRNA CTD PMID:32071231 Mmp3 Rat bisphenol A decreases expression EXP 6480464 bisphenol A results in decreased expression of MMP3 mRNA CTD PMID:29552716 Mmp3 Rat bisphenol A multiple interactions ISO Mmp3 (Mus musculus) 6480464 bisphenol A inhibits the reaction [Estradiol results in decreased expression of MMP3 mRNA] CTD PMID:27312807 Mmp3 Rat bisphenol A affects expression EXP 6480464 bisphenol A affects the expression of MMP3 mRNA CTD PMID:25181051 Mmp3 Rat bisphenol A multiple interactions EXP 6480464 [enzacamene co-treated with octylmethoxycinnamate co-treated with bisphenol A co-treated with butylparaben] results in increased expression of MMP3 mRNA CTD PMID:25305543 Mmp3 Rat bisphenol F decreases expression ISO Mmp3 (Mus musculus) 6480464 bisphenol F results in decreased expression of MMP3 mRNA CTD PMID:38685157 Mmp3 Rat bleomycin A2 multiple interactions ISO Mmp3 (Mus musculus) 6480464 [MMP3 protein co-treated with Dinoprostone] affects the reaction [Bleomycin results in increased expression of CCN2 mRNA] more ... CTD PMID:28434932 Mmp3 Rat bleomycin A2 increases expression ISO MMP3 (Homo sapiens) 6480464 Bleomycin results in increased expression of MMP3 mRNA CTD PMID:28299617 and PMID:32554301 Mmp3 Rat bleomycin A2 multiple interactions ISO MMP3 (Homo sapiens) 6480464 5 more ... CTD PMID:28299617 and PMID:32554301 Mmp3 Rat bleomycin A2 increases expression ISO Mmp3 (Mus musculus) 6480464 Bleomycin results in increased expression of MMP3 mRNA CTD PMID:28434932 Mmp3 Rat BQ 123 multiple interactions ISO MMP3 (Homo sapiens) 6480464 [BQ 788 co-treated with cyclo(Trp-Asp-Pro-Val-Leu)] inhibits the reaction [EDN1 protein results in increased secretion of and results in increased activity of MMP3 protein] and cyclo(Trp-Asp-Pro-Val-Leu) inhibits the reaction [EDN1 protein results in increased secretion of and results in increased activity of MMP3 protein] CTD PMID:12875994 Mmp3 Rat Butylbenzyl phthalate increases expression ISO MMP3 (Homo sapiens) 6480464 butylbenzyl phthalate results in increased expression of MMP3 protein CTD PMID:33965509 Mmp3 Rat Butylbenzyl phthalate multiple interactions ISO MMP3 (Homo sapiens) 6480464 butylbenzyl phthalate promotes the reaction [ETS1 protein binds to MMP3 promoter] and butylbenzyl phthalate promotes the reaction [NR1I2 protein binds to MMP3 promoter] CTD PMID:33965509 Mmp3 Rat Butylparaben multiple interactions EXP 6480464 [enzacamene co-treated with octylmethoxycinnamate co-treated with bisphenol A co-treated with butylparaben] results in increased expression of MMP3 mRNA CTD PMID:25305543 Mmp3 Rat C.I. Natural Red 20 decreases expression ISO MMP3 (Homo sapiens) 6480464 shikonin results in decreased expression of MMP3 protein CTD PMID:37268198 Mmp3 Rat C60 fullerene increases expression ISO Mmp3 (Mus musculus) 6480464 fullerene C60 results in increased expression of MMP3 mRNA CTD PMID:20064541 Mmp3 Rat cadmium atom multiple interactions ISO Mmp3 (Mus musculus) 6480464 [Cadmium Chloride results in increased abundance of Cadmium] which results in increased expression of MMP3 protein and caffeic acid phenethyl ester inhibits the reaction [[Cadmium Chloride results in increased abundance of Cadmium] which results in increased expression of MMP3 protein] CTD PMID:34791780 Mmp3 Rat cadmium dichloride increases secretion ISO MMP3 (Homo sapiens) 6480464 Cadmium Chloride results in increased secretion of MMP3 protein CTD PMID:30572105 Mmp3 Rat cadmium dichloride multiple interactions ISO Mmp3 (Mus musculus) 6480464 [Cadmium Chloride results in increased abundance of Cadmium] which results in increased expression of MMP3 protein and caffeic acid phenethyl ester inhibits the reaction [[Cadmium Chloride results in increased abundance of Cadmium] which results in increased expression of MMP3 protein] CTD PMID:34791780 Mmp3 Rat calcitriol increases expression ISO MMP3 (Homo sapiens) 6480464 Calcitriol results in increased expression of MMP3 mRNA CTD PMID:12040012 and PMID:16002434 Mmp3 Rat cannabidiol decreases expression ISO MMP3 (Homo sapiens) 6480464 Cannabidiol results in decreased expression of MMP3 mRNA CTD PMID:27932991 Mmp3 Rat carbon nanotube increases expression ISO Mmp3 (Mus musculus) 6480464 Nanotubes more ... CTD PMID:25554681 Mmp3 Rat carvacrol multiple interactions EXP 6480464 carvacrol inhibits the reaction [Thioacetamide results in increased expression of MMP3 protein] CTD PMID:34155936 Mmp3 Rat CGP 52608 multiple interactions ISO MMP3 (Homo sapiens) 6480464 CGP 52608 promotes the reaction [RORA protein binds to MMP3 gene] CTD PMID:28238834 Mmp3 Rat chloramphenicol increases expression ISO MMP3 (Homo sapiens) 6480464 Chloramphenicol results in increased expression of MMP3 mRNA CTD PMID:20338993 Mmp3 Rat chlorothalonil decreases expression ISO MMP3 (Homo sapiens) 6480464 tetrachloroisophthalonitrile metabolite results in decreased expression of MMP3 mRNA CTD PMID:32289622 Mmp3 Rat choline multiple interactions ISO Mmp3 (Mus musculus) 6480464 [Methionine deficiency co-treated with Choline deficiency co-treated with Folic Acid deficiency] results in increased expression of MMP3 mRNA CTD PMID:20548288 and PMID:20938992 Mmp3 Rat chondroitin sulfate multiple interactions ISO MMP3 (Homo sapiens) 6480464 [Glucosamine co-treated with Chondroitin Sulfates] results in decreased expression of MMP3 mRNA and [Glucosamine co-treated with Chondroitin Sulfates] results in decreased secretion of MMP3 protein CTD PMID:20110869 Mmp3 Rat ciprofloxacin multiple interactions ISO MMP3 (Homo sapiens) 6480464 Ciprofloxacin promotes the reaction [IL1B protein results in increased expression of MMP3 mRNA] and Ciprofloxacin promotes the reaction [IL1B protein results in increased secretion of MMP3 protein] CTD PMID:12428247 Mmp3 Rat ciprofloxacin increases expression ISO MMP3 (Homo sapiens) 6480464 Ciprofloxacin results in increased expression of MMP3 mRNA CTD PMID:12428247 Mmp3 Rat cisplatin multiple interactions ISO MMP3 (Homo sapiens) 6480464 [Cisplatin co-treated with Paclitaxel] results in increased expression of MMP3 mRNA and MMP3 promoter polymorphism affects the susceptibility to [Fluorouracil co-treated with Cisplatin] CTD PMID:15102660 and PMID:20705681 Mmp3 Rat cobalt atom multiple interactions ISO Mmp3 (Mus musculus) 6480464 [Zinc co-treated with Nickel co-treated with Cobalt co-treated with 1-Methyl-3-isobutylxanthine co-treated with Dexamethasone co-treated with INS1 protein] results in increased expression of MMP3 mRNA and TNF protein inhibits the reaction [[Zinc co-treated with Nickel co-treated with Cobalt co-treated with 1-Methyl-3-isobutylxanthine co-treated with Dexamethasone co-treated with INS1 protein] results in increased expression of MMP3 mRNA] CTD PMID:23503329 Mmp3 Rat copper atom multiple interactions ISO MMP3 (Homo sapiens) 6480464 [Clioquinol co-treated with Copper] results in increased expression of and results in increased activity of MMP3 protein more ... CTD PMID:16648635 more ... Mmp3 Rat copper(0) multiple interactions ISO MMP3 (Homo sapiens) 6480464 [Clioquinol co-treated with Copper] results in increased expression of and results in increased activity of MMP3 protein more ... CTD PMID:16648635 more ... Mmp3 Rat copper(II) sulfate increases expression ISO MMP3 (Homo sapiens) 6480464 Copper Sulfate results in increased expression of MMP3 mRNA CTD PMID:19549813 Mmp3 Rat cordycepin multiple interactions EXP 6480464 cordycepin inhibits the reaction [Lidocaine results in increased expression of MMP3 mRNA] and cordycepin inhibits the reaction [Lidocaine results in increased expression of MMP3 protein] CTD PMID:29382532 Mmp3 Rat cordycepin multiple interactions ISO MMP3 (Homo sapiens) 6480464 cordycepin inhibits the reaction [IL1B protein results in increased expression of MMP3 mRNA] and cordycepin inhibits the reaction [IL1B protein results in increased expression of MMP3 protein] CTD PMID:19056796 Mmp3 Rat crocidolite asbestos increases expression ISO MMP3 (Homo sapiens) 6480464 Asbestos and Crocidolite results in increased expression of MMP3 mRNA CTD PMID:24160326 Mmp3 Rat crocidolite asbestos decreases expression ISO Mmp3 (Mus musculus) 6480464 Asbestos and Crocidolite results in decreased expression of MMP3 mRNA CTD PMID:29279043 Mmp3 Rat crotonaldehyde increases expression ISO MMP3 (Homo sapiens) 6480464 2-butenal results in increased expression of MMP3 mRNA CTD PMID:20471460 Mmp3 Rat curcumin increases expression ISO MMP3 (Homo sapiens) 6480464 Curcumin results in increased expression of MMP3 mRNA CTD PMID:15713895 and PMID:18321735 Mmp3 Rat cyclophosphamide increases expression ISO Mmp3 (Mus musculus) 6480464 Cyclophosphamide results in increased expression of MMP3 mRNA CTD PMID:15331540 Mmp3 Rat cyclosporin A increases expression ISO MMP3 (Homo sapiens) 6480464 Cyclosporine results in increased expression of MMP3 mRNA CTD PMID:20106945 and PMID:21632981 Mmp3 Rat DDT multiple interactions ISO MMP3 (Homo sapiens) 6480464 13-hydroxy-10-oxo-11-octadecenoic acid inhibits the reaction [DDT results in increased expression of MMP3 mRNA] and zerumbone inhibits the reaction [DDT results in increased expression of MMP3 mRNA] CTD PMID:20865247 Mmp3 Rat DDT increases expression ISO MMP3 (Homo sapiens) 6480464 DDT results in increased expression of MMP3 mRNA CTD PMID:20865247 Mmp3 Rat desferrioxamine B multiple interactions ISO MMP3 (Homo sapiens) 6480464 [Deferoxamine co-treated with tert-Butylhydroperoxide] results in increased expression of MMP3 mRNA and MIR184 mRNA inhibits the reaction [[Deferoxamine co-treated with tert-Butylhydroperoxide] results in increased expression of MMP3 mRNA] CTD PMID:35690295 Mmp3 Rat dexamethasone multiple interactions ISO MMP3 (Homo sapiens) 6480464 Dexamethasone inhibits the reaction [Tetradecanoylphorbol Acetate results in increased expression of MMP3 mRNA] CTD PMID:20858459 Mmp3 Rat dexamethasone increases secretion ISO MMP3 (Homo sapiens) 6480464 Dexamethasone results in increased secretion of MMP3 protein CTD PMID:32294208 Mmp3 Rat dexamethasone multiple interactions ISO Mmp3 (Mus musculus) 6480464 [Zinc co-treated with Nickel co-treated with Cobalt co-treated with 1-Methyl-3-isobutylxanthine co-treated with Dexamethasone co-treated with INS1 protein] results in increased expression of MMP3 mRNA and TNF protein inhibits the reaction [[Zinc co-treated with Nickel co-treated with Cobalt co-treated with 1-Methyl-3-isobutylxanthine co-treated with Dexamethasone co-treated with INS1 protein] results in increased expression of MMP3 mRNA] CTD PMID:23503329 Mmp3 Rat dexamethasone decreases expression ISO MMP3 (Homo sapiens) 6480464 Dexamethasone results in decreased expression of MMP3 mRNA CTD PMID:25047013 Mmp3 Rat dextran sulfate multiple interactions ISO Mmp3 (Mus musculus) 6480464 Minocycline inhibits the reaction [Dextran Sulfate results in increased expression of MMP3 mRNA] and Qingdai compound inhibits the reaction [Dextran Sulfate results in increased expression of MMP3 mRNA] CTD PMID:19285099 and PMID:32033881 Mmp3 Rat dextran sulfate increases expression ISO Mmp3 (Mus musculus) 6480464 Dextran Sulfate results in increased expression of MMP3 mRNA CTD PMID:19285099 more ... Mmp3 Rat diallyl trisulfide increases expression ISO MMP3 (Homo sapiens) 6480464 diallyl trisulfide results in increased expression of MMP3 mRNA CTD PMID:34995734 Mmp3 Rat diarsenic trioxide decreases expression ISO MMP3 (Homo sapiens) 6480464 Arsenic Trioxide results in decreased expression of MMP3 mRNA CTD PMID:34108876 Mmp3 Rat dibenzo[a,l]pyrene multiple interactions ISO MMP3 (Homo sapiens) 6480464 [Benzo(a)pyrene co-treated with dibenzo(a and l)pyrene] results in increased expression of MMP3 mRNA CTD PMID:17690111 Mmp3 Rat dibenzo[a,l]pyrene decreases expression ISO Mmp3 (Mus musculus) 6480464 dibenzo(a and l)pyrene results in decreased expression of MMP3 mRNA CTD PMID:25908611 Mmp3 Rat dieckol decreases expression ISO MMP3 (Homo sapiens) 6480464 dieckol results in decreased expression of MMP3 mRNA and dieckol results in decreased expression of MMP3 protein CTD PMID:19330880 Mmp3 Rat diethyl malate increases expression ISO MMP3 (Homo sapiens) 6480464 diethyl malate results in increased expression of MMP3 mRNA CTD PMID:38498338 Mmp3 Rat diethyl maleate increases expression ISO MMP3 (Homo sapiens) 6480464 diethyl maleate results in increased expression of MMP3 mRNA CTD PMID:33545341 Mmp3 Rat diethylstilbestrol decreases expression EXP 6480464 Diethylstilbestrol results in decreased expression of MMP3 mRNA CTD PMID:22504913 Mmp3 Rat dioxygen multiple interactions ISO Mmp3 (Mus musculus) 6480464 [NFE2L2 protein affects the susceptibility to Oxygen] which affects the expression of MMP3 mRNA CTD PMID:30529165 Mmp3 Rat disulfiram multiple interactions ISO MMP3 (Homo sapiens) 6480464 [Disulfiram binds to Copper] which results in decreased expression of MMP3 mRNA CTD PMID:24690739 Mmp3 Rat diuron increases expression EXP 6480464 Diuron metabolite results in increased expression of MMP3 mRNA and Diuron results in increased expression of MMP3 mRNA CTD PMID:24172598 and PMID:25152437 Mmp3 Rat doxorubicin increases expression ISO Mmp3 (Mus musculus) 6480464 Doxorubicin results in increased expression of MMP3 mRNA CTD PMID:28710503 and PMID:36227756 Mmp3 Rat doxorubicin decreases expression ISO MMP3 (Homo sapiens) 6480464 Doxorubicin results in decreased expression of MMP3 mRNA CTD PMID:29803840 Mmp3 Rat doxorubicin multiple interactions ISO Mmp3 (Mus musculus) 6480464 Lovastatin inhibits the reaction [Doxorubicin results in increased expression of MMP3 mRNA] and NSC 23766 inhibits the reaction [Doxorubicin results in increased expression of MMP3 mRNA] CTD PMID:28710503 Mmp3 Rat doxycycline multiple interactions ISO MMP3 (Homo sapiens) 6480464 Doxycycline inhibits the reaction [IL1B protein results in increased expression of MMP3 mRNA] CTD PMID:17267227 Mmp3 Rat doxycycline multiple interactions ISO Mmp3 (Mus musculus) 6480464 Doxycycline inhibits the reaction [Isoproterenol results in increased expression of MMP3 mRNA] CTD PMID:18089841 Mmp3 Rat doxycycline decreases activity ISO MMP3 (Homo sapiens) 6480464 Doxycycline results in decreased activity of MMP3 protein CTD PMID:17267227 Mmp3 Rat EC 3.1.1.4 (phospholipase A2) inhibitor multiple interactions ISO MMP3 (Homo sapiens) 6480464 Phospholipase A2 Inhibitors inhibits the reaction [IL1B protein results in increased expression of MMP3 mRNA] and Phospholipase A2 Inhibitors inhibits the reaction [IL1B protein results in increased secretion of MMP3 protein] CTD PMID:19765281 Mmp3 Rat EC 3.1.1.4 (phospholipase A2) inhibitor decreases expression ISO MMP3 (Homo sapiens) 6480464 Phospholipase A2 Inhibitors results in decreased expression of MMP3 mRNA CTD PMID:19765281 Mmp3 Rat enalapril decreases expression ISO Mmp3 (Mus musculus) 6480464 Enalapril results in decreased expression of MMP3 mRNA CTD PMID:25037058 Mmp3 Rat endosulfan increases expression ISO MMP3 (Homo sapiens) 6480464 Endosulfan results in increased expression of MMP3 mRNA and Endosulfan results in increased expression of MMP3 protein CTD PMID:28108160 and PMID:30090376 Mmp3 Rat endosulfan affects expression ISO MMP3 (Homo sapiens) 6480464 Endosulfan affects the expression of MMP3 protein CTD PMID:34856488 Mmp3 Rat endosulfan increases expression EXP 6480464 Endosulfan results in increased expression of MMP3 mRNA CTD PMID:29391264 Mmp3 Rat enzacamene multiple interactions EXP 6480464 [enzacamene co-treated with octylmethoxycinnamate co-treated with bisphenol A co-treated with butylparaben] results in increased expression of MMP3 mRNA CTD PMID:25305543 Mmp3 Rat epoxiconazole decreases expression ISO Mmp3 (Mus musculus) 6480464 epoxiconazole results in decreased expression of MMP3 mRNA CTD PMID:35436446 Mmp3 Rat ethanol multiple interactions ISO Mmp3 (Mus musculus) 6480464 [Ethanol co-treated with Carbon Tetrachloride co-treated with 4-O-methylhonokiol] results in increased expression of MMP3 mRNA more ... CTD PMID:21863215 and PMID:28689299 Mmp3 Rat ethanol multiple interactions EXP 6480464 [Ethanol co-treated with Dietary Fats] results in increased expression of MMP3 mRNA CTD PMID:21051528 Mmp3 Rat farnesol increases expression ISO MMP3 (Homo sapiens) 6480464 Farnesol results in increased expression of MMP3 mRNA CTD PMID:30806763 Mmp3 Rat fluoranthene multiple interactions ISO Mmp3 (Mus musculus) 6480464 [1-methylanthracene co-treated with fluoranthene] results in increased expression of MMP3 mRNA CTD PMID:28329830 Mmp3 Rat folic acid affects expression ISO MMP3 (Homo sapiens) 6480464 Folic Acid affects the expression of MMP3 mRNA CTD PMID:17320366 Mmp3 Rat folic acid increases secretion ISO MMP3 (Homo sapiens) 6480464 Folic Acid results in increased secretion of MMP3 protein CTD PMID:21349824 Mmp3 Rat folic acid multiple interactions ISO Mmp3 (Mus musculus) 6480464 [Methionine deficiency co-treated with Choline deficiency co-treated with Folic Acid deficiency] results in increased expression of MMP3 mRNA CTD PMID:20548288 and PMID:20938992 Mmp3 Rat formaldehyde increases expression ISO MMP3 (Homo sapiens) 6480464 Formaldehyde results in increased expression of MMP3 mRNA CTD PMID:27664576 Mmp3 Rat formaldehyde decreases expression ISO MMP3 (Homo sapiens) 6480464 Formaldehyde results in decreased expression of MMP3 mRNA CTD PMID:28937961 Mmp3 Rat fucoidan multiple interactions ISO MMP3 (Homo sapiens) 6480464 fucoidan inhibits the reaction [IL1B protein results in increased secretion of MMP3 protein] CTD PMID:16364234 Mmp3 Rat galaxolide multiple interactions ISO MMP3 (Homo sapiens) 6480464 [galaxolide co-treated with acetyl methyl tetramethyl tetralin] results in increased expression of MMP3 mRNA CTD PMID:34687775 Mmp3 Rat galaxolide increases expression ISO MMP3 (Homo sapiens) 6480464 galaxolide results in increased expression of MMP3 mRNA CTD PMID:34687775 Mmp3 Rat gemcitabine decreases expression ISO MMP3 (Homo sapiens) 6480464 Gemcitabine results in decreased expression of MMP3 protein CTD PMID:20531411 Mmp3 Rat genistein decreases expression EXP 6480464 Genistein results in decreased expression of MMP3 mRNA and Genistein results in decreased expression of MMP3 protein CTD PMID:22504913 and PMID:24552547 Mmp3 Rat geraniol increases expression ISO MMP3 (Homo sapiens) 6480464 geraniol results in increased expression of MMP3 mRNA CTD PMID:30806763 Mmp3 Rat glycitein decreases expression ISO MMP3 (Homo sapiens) 6480464 glycitein results in decreased expression of MMP3 mRNA and glycitein results in decreased expression of MMP3 protein CTD PMID:20188714 Mmp3 Rat gold atom increases expression ISO MMP3 (Homo sapiens) 6480464 Gold results in increased expression of MMP3 mRNA CTD PMID:24022940 Mmp3 Rat gold(0) increases expression ISO MMP3 (Homo sapiens) 6480464 Gold results in increased expression of MMP3 mRNA CTD PMID:24022940 Mmp3 Rat graphene oxide increases expression ISO Mmp3 (Mus musculus) 6480464 graphene oxide results in increased expression of MMP3 mRNA CTD PMID:33227293 Mmp3 Rat HU-308 multiple interactions ISO MMP3 (Homo sapiens) 6480464 HU 308 inhibits the reaction [IL1B protein results in increased expression of MMP3 mRNA] CTD PMID:34537380 Mmp3 Rat hyaluronic acid multiple interactions ISO Mmp3 (Mus musculus) 6480464 [Hyaluronic Acid co-treated with resveratrol] results in decreased expression of MMP3 mRNA CTD PMID:23595953 Mmp3 Rat hydrogen peroxide multiple interactions ISO MMP3 (Homo sapiens) 6480464 loliolide inhibits the reaction [Hydrogen Peroxide results in increased expression of MMP3 mRNA] more ... CTD PMID:30231594 and PMID:33522089 Mmp3 Rat hydrogen peroxide decreases expression ISO MMP3 (Homo sapiens) 6480464 Hydrogen Peroxide results in decreased expression of MMP3 mRNA CTD PMID:32949572 Mmp3 Rat hydrogen peroxide increases expression ISO MMP3 (Homo sapiens) 6480464 Hydrogen Peroxide results in increased expression of MMP3 mRNA and Hydrogen Peroxide results in increased expression of MMP3 protein CTD PMID:30231594 more ... Mmp3 Rat hydroquinone affects expression ISO MMP3 (Homo sapiens) 6480464 hydroquinone affects the expression of MMP3 mRNA CTD PMID:15452088 Mmp3 Rat hydroquinone increases expression ISO MMP3 (Homo sapiens) 6480464 hydroquinone results in increased expression of MMP3 mRNA CTD PMID:31256213 Mmp3 Rat ibuprofen increases expression ISO MMP3 (Homo sapiens) 6480464 Ibuprofen results in increased expression of MMP3 mRNA CTD PMID:16580899 Mmp3 Rat Indeno[1,2,3-cd]pyrene decreases expression ISO Mmp3 (Mus musculus) 6480464 indeno(1 more ... CTD PMID:26377693 Mmp3 Rat irigenin multiple interactions ISO MMP3 (Homo sapiens) 6480464 irigenin inhibits the reaction [TNF protein results in increased expression of MMP3 mRNA] and irigenin inhibits the reaction [TNF protein results in increased expression of MMP3 protein] CTD PMID:34600870 Mmp3 Rat isoprenaline multiple interactions ISO Mmp3 (Mus musculus) 6480464 Doxycycline inhibits the reaction [Isoproterenol results in increased expression of MMP3 mRNA] CTD PMID:18089841 Mmp3 Rat isoprenaline increases expression EXP 6480464 Isoproterenol results in increased expression of MMP3 CTD PMID:12883319 Mmp3 Rat isoprenaline multiple interactions EXP 6480464 SI 27 inhibits the reaction [Isoproterenol results in increased expression of MMP3] CTD PMID:12883319 Mmp3 Rat isoprenaline increases expression ISO Mmp3 (Mus musculus) 6480464 Isoproterenol results in increased expression of MMP3 mRNA CTD PMID:18089841 and PMID:20003209 Mmp3 Rat L-methionine multiple interactions ISO Mmp3 (Mus musculus) 6480464 [Methionine deficiency co-treated with Choline deficiency co-treated with Folic Acid deficiency] results in increased expression of MMP3 mRNA CTD PMID:20548288 and PMID:20938992 Mmp3 Rat L-proline betaine multiple interactions ISO MMP3 (Homo sapiens) 6480464 stachydrine inhibits the reaction [IL1B protein results in increased secretion of MMP3 protein] CTD PMID:32417162 Mmp3 Rat lidocaine multiple interactions EXP 6480464 cordycepin inhibits the reaction [Lidocaine results in increased expression of MMP3 mRNA] and cordycepin inhibits the reaction [Lidocaine results in increased expression of MMP3 protein] CTD PMID:29382532 Mmp3 Rat lidocaine increases expression EXP 6480464 Lidocaine results in increased expression of MMP3 mRNA and Lidocaine results in increased expression of MMP3 protein CTD PMID:29382532 Mmp3 Rat lipoic acid multiple interactions ISO MMP3 (Homo sapiens) 6480464 Thioctic Acid inhibits the reaction [IL1B protein results in increased expression of MMP3 mRNA] and Thioctic Acid inhibits the reaction [IL1B protein results in increased expression of MMP3 protein] CTD PMID:24975507 Mmp3 Rat lipopolysaccharide increases expression ISO MMP3 (Homo sapiens) 6480464 Lipopolysaccharides results in increased expression of MMP3 mRNA and Lipopolysaccharides results in increased expression of MMP3 protein CTD PMID:17303203 more ... Mmp3 Rat lipopolysaccharide multiple interactions ISO MMP3 (Homo sapiens) 6480464 [S-(1 more ... CTD PMID:17303203 more ... Mmp3 Rat loliolide multiple interactions ISO MMP3 (Homo sapiens) 6480464 loliolide inhibits the reaction [Hydrogen Peroxide results in increased expression of MMP3 mRNA] CTD PMID:30231594 Mmp3 Rat lovastatin multiple interactions ISO Mmp3 (Mus musculus) 6480464 Lovastatin inhibits the reaction [Doxorubicin results in increased expression of MMP3 mRNA] CTD PMID:28710503 Mmp3 Rat malathion increases expression ISO MMP3 (Homo sapiens) 6480464 Malathion results in increased expression of MMP3 mRNA CTD PMID:37047231 Mmp3 Rat manganese atom increases expression EXP 6480464 Manganese results in increased expression of MMP3 mRNA CTD PMID:26745496 Mmp3 Rat manganese(0) increases expression EXP 6480464 Manganese results in increased expression of MMP3 mRNA CTD PMID:26745496 Mmp3 Rat manganese(II) chloride increases expression EXP 6480464 manganese chloride results in increased expression of MMP3 mRNA CTD PMID:26745496 Mmp3 Rat megestrol acetate multiple interactions EXP 6480464 [Ethinyl Estradiol co-treated with Megestrol Acetate] results in increased expression of MMP3 protein CTD PMID:22085904 Mmp3 Rat melittin multiple interactions ISO MMP3 (Homo sapiens) 6480464 Melitten inhibits the reaction [Lipopolysaccharides results in increased expression of MMP3 protein] CTD PMID:17303203 Mmp3 Rat Methanandamide increases expression ISO MMP3 (Homo sapiens) 6480464 methanandamide results in increased expression of MMP3 mRNA and methanandamide results in increased expression of MMP3 protein CTD PMID:16330497 Mmp3 Rat methotrexate decreases expression ISO MMP3 (Homo sapiens) 6480464 Methotrexate results in decreased expression of MMP3 mRNA CTD PMID:15476228 Mmp3 Rat methotrexate multiple interactions ISO MMP3 (Homo sapiens) 6480464 [Antirheumatic Agents co-treated with Methotrexate] results in decreased expression of MMP3 protein CTD PMID:23146660 Mmp3 Rat methyl caffeate multiple interactions ISO MMP3 (Homo sapiens) 6480464 methyl caffeate inhibits the reaction [Bleomycin results in increased expression of MMP3 mRNA] CTD PMID:28299617 Mmp3 Rat methylisothiazolinone increases expression ISO MMP3 (Homo sapiens) 6480464 2-methyl-4-isothiazolin-3-one results in increased expression of MMP3 mRNA CTD PMID:30806763 and PMID:31629900 Mmp3 Rat methylisothiazolinone increases secretion ISO MMP3 (Homo sapiens) 6480464 2-methyl-4-isothiazolin-3-one results in increased secretion of MMP3 protein CTD PMID:31629900 Mmp3 Rat mibolerone multiple interactions ISO MMP3 (Homo sapiens) 6480464 mibolerone inhibits the reaction [Tetradecanoylphorbol Acetate results in increased expression of MMP3 mRNA] CTD PMID:8798622 Mmp3 Rat mifepristone increases expression ISO MMP3 (Homo sapiens) 6480464 Mifepristone results in increased expression of MMP3 mRNA CTD PMID:17584828 Mmp3 Rat mifepristone multiple interactions ISO Mmp3 (Mus musculus) 6480464 Mifepristone inhibits the reaction [Progesterone results in decreased expression of MMP3 mRNA] CTD PMID:27264040 Mmp3 Rat minocycline multiple interactions ISO Mmp3 (Mus musculus) 6480464 Minocycline inhibits the reaction [Dextran Sulfate results in increased expression of MMP3 mRNA] CTD PMID:19285099 Mmp3 Rat Morroniside multiple interactions ISO Mmp3 (Mus musculus) 6480464 morroniside inhibits the reaction [IL1B protein results in increased expression of MMP3 mRNA] and morroniside inhibits the reaction [IL1B protein results in increased expression of MMP3 protein] CTD PMID:33804203 Mmp3 Rat moxifloxacin decreases secretion ISO MMP3 (Homo sapiens) 6480464 Moxifloxacin results in decreased secretion of MMP3 protein CTD PMID:24890593 Mmp3 Rat moxifloxacin increases secretion ISO MMP3 (Homo sapiens) 6480464 Moxifloxacin results in increased secretion of MMP3 protein CTD PMID:24890593 Mmp3 Rat Muraglitazar decreases expression EXP 6480464 muraglitazar results in decreased expression of MMP3 mRNA CTD PMID:21515302 Mmp3 Rat N-acetyl-L-cysteine multiple interactions ISO MMP3 (Homo sapiens) 6480464 Acetylcysteine inhibits the reaction [FN1 protein modified form results in increased expression of and results in increased secretion of MMP3 protein] more ... CTD PMID:17395008 and PMID:34791735 Mmp3 Rat N-methyl-N-nitrosourea increases expression EXP 6480464 Methylnitrosourea results in increased expression of MMP3 mRNA CTD PMID:17412507 Mmp3 Rat N-nitrosodiethylamine increases expression EXP 6480464 Diethylnitrosamine results in increased expression of MMP3 mRNA CTD PMID:20360939 Mmp3 Rat N-nitrosodiethylamine multiple interactions EXP 6480464 [Diethylnitrosamine co-treated with caffeic acid phenethyl ester] results in increased expression of MMP3 mRNA CTD PMID:20360939 Mmp3 Rat nickel atom multiple interactions ISO Mmp3 (Mus musculus) 6480464 [Zinc co-treated with Nickel co-treated with Cobalt co-treated with 1-Methyl-3-isobutylxanthine co-treated with Dexamethasone co-treated with INS1 protein] results in increased expression of MMP3 mRNA and TNF protein inhibits the reaction [[Zinc co-treated with Nickel co-treated with Cobalt co-treated with 1-Methyl-3-isobutylxanthine co-treated with Dexamethasone co-treated with INS1 protein] results in increased expression of MMP3 mRNA] CTD PMID:23503329 Mmp3 Rat nickel atom increases expression ISO MMP3 (Homo sapiens) 6480464 Nickel results in increased expression of MMP3 mRNA CTD PMID:25583101 Mmp3 Rat nickel sulfate increases expression ISO MMP3 (Homo sapiens) 6480464 nickel sulfate results in increased expression of MMP3 mRNA CTD PMID:16780908 Mmp3 Rat nickel sulfate increases expression ISO Mmp3 (Mus musculus) 6480464 nickel sulfate results in increased expression of MMP3 mRNA CTD PMID:16166746 Mmp3 Rat nicotine multiple interactions ISO MMP3 (Homo sapiens) 6480464 lipopolysaccharide more ... CTD PMID:18986645 and PMID:39098741 Mmp3 Rat nicotine increases expression EXP 6480464 Nicotine results in increased expression of MMP3 mRNA CTD PMID:39098741 Mmp3 Rat nicotine increases expression ISO MMP3 (Homo sapiens) 6480464 Nicotine results in increased expression of MMP3 mRNA and Nicotine results in increased expression of MMP3 protein CTD PMID:17151781 more ... Mmp3 Rat NSC 23766 multiple interactions ISO Mmp3 (Mus musculus) 6480464 NSC 23766 inhibits the reaction [Doxorubicin results in increased expression of MMP3 mRNA] CTD PMID:28710503 Mmp3 Rat ofloxacin increases expression EXP 6480464 Ofloxacin results in increased expression of MMP3 mRNA CTD PMID:20688128 Mmp3 Rat oroxylin A multiple interactions ISO MMP3 (Homo sapiens) 6480464 5 and 7-dihydroxy-6-methoxy-2-phenylchromen-4-one inhibits the reaction [Bleomycin results in increased expression of MMP3 mRNA] CTD PMID:32554301 Mmp3 Rat ozone increases expression EXP 6480464 Ozone results in increased expression of MMP3 mRNA CTD PMID:20980218 Mmp3 Rat ozone multiple interactions ISO Mmp3 (Mus musculus) 6480464 [Air Pollutants results in increased abundance of Ozone] which results in increased expression of MMP3 mRNA CTD PMID:34911549 Mmp3 Rat paclitaxel increases expression EXP 6480464 Paclitaxel results in increased expression of MMP3 and Paclitaxel results in increased expression of MMP3 mRNA CTD PMID:18754875 Mmp3 Rat paclitaxel multiple interactions ISO MMP3 (Homo sapiens) 6480464 [Cisplatin co-treated with Paclitaxel] results in increased expression of MMP3 mRNA CTD PMID:20705681 Mmp3 Rat paracetamol affects expression ISO Mmp3 (Mus musculus) 6480464 Acetaminophen affects the expression of MMP3 mRNA CTD PMID:17562736 Mmp3 Rat paracetamol increases expression ISO MMP3 (Homo sapiens) 6480464 Acetaminophen results in increased expression of MMP3 mRNA CTD PMID:29067470 Mmp3 Rat paraquat increases expression ISO Mmp3 (Mus musculus) 6480464 Paraquat results in increased expression of MMP3 mRNA and Paraquat results in increased expression of MMP3 protein CTD PMID:17215068 more ... Mmp3 Rat paraquat affects expression ISO Mmp3 (Mus musculus) 6480464 Paraquat affects the expression of MMP3 mRNA CTD PMID:26345256 Mmp3 Rat PD 168393 multiple interactions ISO MMP3 (Homo sapiens) 6480464 PD168393 inhibits the reaction [2 more ... CTD PMID:29535049 Mmp3 Rat perfluorohexanesulfonic acid increases expression ISO Mmp3 (Mus musculus) 6480464 perfluorohexanesulfonic acid results in increased expression of MMP3 mRNA CTD PMID:37315490 Mmp3 Rat phenethyl caffeate multiple interactions EXP 6480464 [Diethylnitrosamine co-treated with caffeic acid phenethyl ester] results in increased expression of MMP3 mRNA CTD PMID:20360939 Mmp3 Rat phenethyl caffeate multiple interactions ISO Mmp3 (Mus musculus) 6480464 caffeic acid phenethyl ester inhibits the reaction [[Cadmium Chloride results in increased abundance of Cadmium] which results in increased expression of MMP3 protein] CTD PMID:34791780 Mmp3 Rat phenobarbital affects expression ISO MMP3 (Homo sapiens) 6480464 Phenobarbital affects the expression of MMP3 mRNA CTD PMID:19159669 Mmp3 Rat phenytoin decreases expression ISO MMP3 (Homo sapiens) 6480464 Phenytoin results in decreased expression of MMP3 mRNA CTD PMID:15948689 Mmp3 Rat phorbol 13-acetate 12-myristate multiple interactions ISO MMP3 (Homo sapiens) 6480464 BAG1 protein promotes the reaction [Tetradecanoylphorbol Acetate results in increased expression of MMP3 mRNA] more ... CTD PMID:16176868 more ... Mmp3 Rat phorbol 13-acetate 12-myristate increases expression ISO MMP3 (Homo sapiens) 6480464 Tetradecanoylphorbol Acetate results in increased expression of MMP3 mRNA and Tetradecanoylphorbol Acetate results in increased expression of MMP3 protein CTD PMID:16176868 more ... Mmp3 Rat pirinixic acid multiple interactions ISO MMP3 (Homo sapiens) 6480464 [pirinixic acid binds to and results in increased activity of PPARA protein] which results in decreased expression of MMP3 mRNA CTD PMID:19710929 Mmp3 Rat pravastatin affects response to substance ISO MMP3 (Homo sapiens) 6480464 MMP3 promoter polymorphism affects the susceptibility to Pravastatin CTD PMID:8662692 Mmp3 Rat prinomastat decreases activity ISO MMP3 (Homo sapiens) 6480464 prinomastat results in decreased activity of MMP3 protein CTD PMID:17267227 Mmp3 Rat progesterone multiple interactions ISO MMP3 (Homo sapiens) 6480464 [Estradiol co-treated with Progesterone] results in decreased secretion of MMP3 protein more ... CTD PMID:16009159 more ... Mmp3 Rat progesterone decreases expression ISO Mmp3 (Mus musculus) 6480464 Progesterone results in decreased expression of MMP3 mRNA CTD PMID:27264040 Mmp3 Rat progesterone decreases expression ISO MMP3 (Homo sapiens) 6480464 Progesterone results in decreased expression of MMP3 mRNA CTD PMID:26604029 Mmp3 Rat progesterone multiple interactions ISO Mmp3 (Mus musculus) 6480464 Mifepristone inhibits the reaction [Progesterone results in decreased expression of MMP3 mRNA] and Progesterone inhibits the reaction [Estradiol results in increased expression of MMP3 mRNA] CTD PMID:19416213 and PMID:27264040 Mmp3 Rat progesterone decreases secretion ISO MMP3 (Homo sapiens) 6480464 Progesterone results in decreased secretion of MMP3 protein CTD PMID:16009159 Mmp3 Rat prostaglandin E2 multiple interactions ISO Mmp3 (Mus musculus) 6480464 [MMP3 protein co-treated with Dinoprostone] affects the reaction [Bleomycin results in increased expression of CCN2 mRNA] more ... CTD PMID:28434932 Mmp3 Rat quercetin decreases expression ISO MMP3 (Homo sapiens) 6480464 Quercetin results in decreased expression of MMP3 mRNA and Quercetin results in decreased expression of MMP3 protein CTD PMID:22592909 Mmp3 Rat quercetin increases expression ISO MMP3 (Homo sapiens) 6480464 Quercetin results in increased expression of MMP3 mRNA CTD PMID:21632981 Mmp3 Rat quercetin multiple interactions ISO MMP3 (Homo sapiens) 6480464 Quercetin inhibits the reaction [IL1B protein results in increased expression of MMP3 mRNA] more ... CTD PMID:22592909 and PMID:34791735 Mmp3 Rat rac-lactic acid increases expression ISO MMP3 (Homo sapiens) 6480464 Lactic Acid results in increased expression of MMP3 mRNA CTD PMID:30851411 Mmp3 Rat raloxifene multiple interactions EXP 6480464 Raloxifene Hydrochloride inhibits the reaction [Decitabine results in increased expression of MMP3 mRNA] CTD PMID:23385821 Mmp3 Rat resorcinol increases expression ISO MMP3 (Homo sapiens) 6480464 resorcinol results in increased expression of MMP3 mRNA CTD PMID:30806763 Mmp3 Rat resveratrol multiple interactions ISO MMP3 (Homo sapiens) 6480464 [Resveratrol results in increased activity of SIRT1 protein] inhibits the reaction [IL1B protein results in increased expression of MMP3 protein] more ... CTD PMID:18759268 more ... Mmp3 Rat resveratrol multiple interactions ISO Mmp3 (Mus musculus) 6480464 [Hyaluronic Acid co-treated with resveratrol] results in decreased expression of MMP3 mRNA CTD PMID:23595953 Mmp3 Rat rifampicin decreases secretion ISO MMP3 (Homo sapiens) 6480464 Rifampin results in decreased secretion of MMP3 protein CTD PMID:24890593 Mmp3 Rat rofecoxib increases expression ISO MMP3 (Homo sapiens) 6480464 rofecoxib results in increased expression of MMP3 mRNA CTD PMID:16580899 Mmp3 Rat rotenone increases expression ISO MMP3 (Homo sapiens) 6480464 Rotenone results in increased expression of MMP3 mRNA CTD PMID:32949572 Mmp3 Rat Ruscogenin multiple interactions ISO Mmp3 (Mus musculus) 6480464 NFE2L2 protein affects the reaction [ruscogenin inhibits the reaction [IL1B protein results in increased expression of MMP3 protein]] and ruscogenin inhibits the reaction [IL1B protein results in increased expression of MMP3 protein] CTD PMID:38122922 Mmp3 Rat S-(1,2-dichlorovinyl)-L-cysteine multiple interactions ISO MMP3 (Homo sapiens) 6480464 [S-(1 and 2-dichlorovinyl)cysteine affects the susceptibility to Lipopolysaccharides] which results in increased expression of MMP3 mRNA CTD PMID:35811015 Mmp3 Rat SB 203580 multiple interactions ISO MMP3 (Homo sapiens) 6480464 SB 203580 inhibits the reaction [Tetradecanoylphorbol Acetate results in increased expression of MMP3 protein] CTD PMID:20004183 Mmp3 Rat serpentine asbestos decreases expression ISO Mmp3 (Mus musculus) 6480464 Asbestos and Serpentine results in decreased expression of MMP3 mRNA CTD PMID:16251409 Mmp3 Rat serpentine asbestos increases expression ISO MMP3 (Homo sapiens) 6480464 Asbestos and Serpentine results in increased expression of MMP3 mRNA CTD PMID:24160326 Mmp3 Rat serpentine asbestos increases expression ISO Mmp3 (Mus musculus) 6480464 Asbestos and Serpentine results in increased expression of MMP3 mRNA CTD PMID:23917077 Mmp3 Rat Shikonin decreases expression ISO MMP3 (Homo sapiens) 6480464 shikonin results in decreased expression of MMP3 protein CTD PMID:37268198 Mmp3 Rat silver atom increases expression ISO Mmp3 (Mus musculus) 6480464 Silver results in increased expression of MMP3 mRNA CTD PMID:19969064 Mmp3 Rat silver atom increases expression ISO MMP3 (Homo sapiens) 6480464 Silver results in increased expression of MMP3 mRNA CTD PMID:24022940 Mmp3 Rat silver(0) increases expression ISO Mmp3 (Mus musculus) 6480464 Silver results in increased expression of MMP3 mRNA CTD PMID:19969064 Mmp3 Rat silver(0) increases expression ISO MMP3 (Homo sapiens) 6480464 Silver results in increased expression of MMP3 mRNA CTD PMID:24022940 Mmp3 Rat simvastatin decreases expression EXP 6480464 Simvastatin results in decreased expression of MMP3 mRNA CTD PMID:16414398 Mmp3 Rat simvastatin multiple interactions ISO MMP3 (Homo sapiens) 6480464 Simvastatin inhibits the reaction [IL1B protein results in increased expression of MMP3 mRNA] CTD PMID:31260663 Mmp3 Rat sodium arsenite decreases expression ISO MMP3 (Homo sapiens) 6480464 sodium arsenite results in decreased expression of MMP3 mRNA CTD PMID:29301061 Mmp3 Rat sodium arsenite increases expression ISO MMP3 (Homo sapiens) 6480464 sodium arsenite results in increased expression of MMP3 mRNA CTD PMID:36089002 Mmp3 Rat sodium azide multiple interactions ISO MMP3 (Homo sapiens) 6480464 Sodium Azide inhibits the reaction [Aminolevulinic Acid affects the expression of MMP3 protein] CTD PMID:12542540 Mmp3 Rat sodium dodecyl sulfate increases expression ISO MMP3 (Homo sapiens) 6480464 Sodium Dodecyl Sulfate results in increased expression of MMP3 mRNA CTD PMID:30806763 Mmp3 Rat Soman increases expression EXP 6480464 Soman results in increased expression of MMP3 mRNA CTD PMID:19281266 Mmp3 Rat sotorasib multiple interactions ISO MMP3 (Homo sapiens) 6480464 [sotorasib co-treated with trametinib co-treated with NVP-BKM120] results in decreased expression of MMP3 mRNA CTD PMID:36139627 Mmp3 Rat streptozocin increases expression ISO Mmp3 (Mus musculus) 6480464 Streptozocin results in increased expression of MMP3 mRNA CTD PMID:20446767 Mmp3 Rat streptozocin decreases expression EXP 6480464 Streptozocin results in decreased expression of MMP3 mRNA CTD PMID:18246672 Mmp3 Rat streptozocin multiple interactions ISO MMP3 (Homo sapiens) 6480464 PRDX4 protein inhibits the reaction [Streptozocin results in increased expression of MMP3 mRNA] CTD PMID:20446767 Mmp3 Rat T-2 toxin increases expression ISO Mmp3 (Mus musculus) 6480464 T-2 Toxin results in increased expression of MMP3 mRNA CTD PMID:22800716 Mmp3 Rat tamoxifen affects expression ISO Mmp3 (Mus musculus) 6480464 Tamoxifen affects the expression of MMP3 mRNA CTD PMID:17555576 Mmp3 Rat tert-butyl hydroperoxide multiple interactions ISO MMP3 (Homo sapiens) 6480464 [Deferoxamine co-treated with tert-Butylhydroperoxide] results in increased expression of MMP3 mRNA and MIR184 mRNA inhibits the reaction [[Deferoxamine co-treated with tert-Butylhydroperoxide] results in increased expression of MMP3 mRNA] CTD PMID:35690295 Mmp3 Rat Tesaglitazar decreases expression EXP 6480464 tesaglitazar results in decreased expression of MMP3 mRNA CTD PMID:21515302 Mmp3 Rat testosterone decreases expression ISO Mmp3 (Mus musculus) 6480464 Testosterone results in decreased expression of MMP3 mRNA CTD PMID:19693291 Mmp3 Rat testosterone decreases expression ISO MMP3 (Homo sapiens) 6480464 Testosterone results in decreased expression of MMP3 mRNA CTD PMID:33359661 Mmp3 Rat testosterone increases expression ISO Mmp3 (Mus musculus) 6480464 Testosterone results in increased expression of MMP3 mRNA CTD PMID:19693291 Mmp3 Rat tetrachloroethene decreases expression ISO MMP3 (Homo sapiens) 6480464 Tetrachloroethylene results in decreased expression of MMP3 mRNA CTD PMID:16010555 Mmp3 Rat tetrachloromethane affects expression ISO Mmp3 (Mus musculus) 6480464 Carbon Tetrachloride affects the expression of MMP3 mRNA CTD PMID:17484886 Mmp3 Rat tetrachloromethane multiple interactions ISO Mmp3 (Mus musculus) 6480464 [Ethanol co-treated with Carbon Tetrachloride co-treated with 4-O-methylhonokiol] results in increased expression of MMP3 mRNA CTD PMID:28689299 Mmp3 Rat tetrachloromethane multiple interactions EXP 6480464 PLAU protein promotes the reaction [Carbon Tetrachloride results in increased expression of MMP3 mRNA] and schizandrin B inhibits the reaction [Carbon Tetrachloride results in increased expression of MMP3 mRNA] CTD PMID:18481824 and PMID:31150632 Mmp3 Rat tetrachloromethane increases expression EXP 6480464 Carbon Tetrachloride results in increased expression of MMP3 mRNA and Carbon Tetrachloride results in increased expression of MMP3 protein CTD PMID:17094476 more ... Mmp3 Rat tetrachloromethane increases expression ISO Mmp3 (Mus musculus) 6480464 Carbon Tetrachloride results in increased expression of MMP3 mRNA CTD PMID:15056808 Mmp3 Rat tetracycline multiple interactions ISO MMP3 (Homo sapiens) 6480464 Tetracycline inhibits the reaction [IL1B protein results in increased expression of MMP3 mRNA] CTD PMID:17267227 Mmp3 Rat tetracycline decreases expression ISO Mmp3 (Mus musculus) 6480464 Tetracycline results in decreased expression of MMP3 mRNA CTD PMID:24489787 Mmp3 Rat tetracycline decreases activity ISO MMP3 (Homo sapiens) 6480464 Tetracycline results in decreased activity of MMP3 protein CTD PMID:17267227 Mmp3 Rat Theaflavin 3,3'-digallate multiple interactions EXP 6480464 theaflavin-3 more ... CTD PMID:35847580 Mmp3 Rat Theaflavin 3,3'-digallate decreases expression ISO Mmp3 (Mus musculus) 6480464 theaflavin-3 and 3'-digallate results in decreased expression of MMP3 protein CTD PMID:30874838 Mmp3 Rat thioacetamide multiple interactions EXP 6480464 carvacrol inhibits the reaction [Thioacetamide results in increased expression of MMP3 protein] more ... CTD PMID:16489207 and PMID:34155936 Mmp3 Rat thioacetamide multiple interactions ISO Mmp3 (Mus musculus) 6480464 [Ethanol co-treated with Thioacetamide] results in increased expression of MMP3 mRNA and CNR1 gene mutant form inhibits the reaction [[Ethanol co-treated with Thioacetamide] results in increased expression of MMP3 mRNA] CTD PMID:21863215 Mmp3 Rat thioacetamide increases expression EXP 6480464 Thioacetamide results in increased expression of MMP3 mRNA and Thioacetamide results in increased expression of MMP3 protein CTD PMID:16489207 more ... Mmp3 Rat thiram increases expression ISO MMP3 (Homo sapiens) 6480464 Thiram results in increased expression of MMP3 mRNA CTD PMID:38568856 Mmp3 Rat titanium dioxide increases expression ISO Mmp3 (Mus musculus) 6480464 titanium dioxide results in increased expression of MMP3 mRNA CTD PMID:23557971 and PMID:27760801 Mmp3 Rat tofacitinib decreases expression ISO MMP3 (Homo sapiens) 6480464 tofacitinib results in decreased expression of MMP3 mRNA CTD PMID:25398374 Mmp3 Rat trametinib multiple interactions ISO MMP3 (Homo sapiens) 6480464 [sotorasib co-treated with trametinib co-treated with NVP-BKM120] results in decreased expression of MMP3 mRNA CTD PMID:36139627 Mmp3 Rat triclosan multiple interactions ISO MMP3 (Homo sapiens) 6480464 Triclosan inhibits the reaction [Progesterone results in decreased expression of MMP3 mRNA] CTD PMID:26604029 Mmp3 Rat triclosan increases expression ISO MMP3 (Homo sapiens) 6480464 Triclosan results in increased expression of MMP3 mRNA CTD PMID:26604029 Mmp3 Rat tunicamycin increases expression ISO MMP3 (Homo sapiens) 6480464 Tunicamycin results in increased expression of MMP3 mRNA CTD PMID:33545341 and PMID:38498338 Mmp3 Rat ursodeoxycholic acid multiple interactions EXP 6480464 Ursodeoxycholic Acid inhibits the reaction [Thioacetamide results in increased expression of MMP3 protein] CTD PMID:34155936 Mmp3 Rat varespladib methyl multiple interactions ISO MMP3 (Homo sapiens) 6480464 varespladib methyl inhibits the reaction [IL1B protein results in increased expression of MMP3 mRNA] and varespladib methyl inhibits the reaction [IL1B protein results in increased secretion of MMP3 protein] CTD PMID:19765281 Mmp3 Rat zerumbone multiple interactions ISO MMP3 (Homo sapiens) 6480464 zerumbone inhibits the reaction [DDT results in increased expression of MMP3 mRNA] and zerumbone inhibits the reaction [Tetrachlorodibenzodioxin results in increased expression of MMP3 mRNA] CTD PMID:20865247 Mmp3 Rat zinc atom increases secretion ISO MMP3 (Homo sapiens) 6480464 Zinc results in increased secretion of MMP3 protein CTD PMID:12972402 Mmp3 Rat zinc atom multiple interactions ISO Mmp3 (Mus musculus) 6480464 [Zinc co-treated with Nickel co-treated with Cobalt co-treated with 1-Methyl-3-isobutylxanthine co-treated with Dexamethasone co-treated with INS1 protein] results in increased expression of MMP3 mRNA and TNF protein inhibits the reaction [[Zinc co-treated with Nickel co-treated with Cobalt co-treated with 1-Methyl-3-isobutylxanthine co-treated with Dexamethasone co-treated with INS1 protein] results in increased expression of MMP3 mRNA] CTD PMID:23503329 Mmp3 Rat zinc oxide decreases expression EXP 6480464 Zinc Oxide results in decreased expression of MMP3 protein CTD PMID:33205376 Mmp3 Rat zinc(0) increases secretion ISO MMP3 (Homo sapiens) 6480464 Zinc results in increased secretion of MMP3 protein CTD PMID:12972402 Mmp3 Rat zinc(0) multiple interactions ISO Mmp3 (Mus musculus) 6480464 [Zinc co-treated with Nickel co-treated with Cobalt co-treated with 1-Methyl-3-isobutylxanthine co-treated with Dexamethasone co-treated with INS1 protein] results in increased expression of MMP3 mRNA and TNF protein inhibits the reaction [[Zinc co-treated with Nickel co-treated with Cobalt co-treated with 1-Methyl-3-isobutylxanthine co-treated with Dexamethasone co-treated with INS1 protein] results in increased expression of MMP3 mRNA] CTD PMID:23503329
Imported Annotations - KEGG (archival)
(+)-schisandrin B (EXP) (-)-citrinin (ISO) (R)-lipoic acid (ISO) (S)-nicotine (EXP,ISO) 1,2-dichloroethane (ISO) 1-chloro-2,4-dinitrobenzene (ISO) 1-naphthyl isothiocyanate (ISO) 17alpha-ethynylestradiol (EXP,ISO) 17beta-estradiol (ISO) 17beta-hydroxy-17-methylestra-4,9,11-trien-3-one (ISO) 17beta-hydroxy-5alpha-androstan-3-one (ISO) 2,2',4,4'-Tetrabromodiphenyl ether (ISO) 2,3,7,8-tetrachlorodibenzodioxine (EXP,ISO) 2,4-diaminotoluene (ISO) 2,4-dibromophenyl 2,4,5-tribromophenyl ether (ISO) 2-amino-2-deoxy-D-glucopyranose (EXP,ISO) 2-hydroxypropanoic acid (ISO) 3,3',4,4',5-pentachlorobiphenyl (ISO) 3,4-dichloroaniline (EXP) 3-hydroxypicolinic acid (ISO) 3-isobutyl-1-methyl-7H-xanthine (ISO) 3-methylcholanthrene (ISO) 3-phenylprop-2-enal (ISO) 4,4'-sulfonyldiphenol (ISO) 4-nitroquinoline N-oxide (ISO) 5-aminolevulinic acid (ISO) 5-aza-2'-deoxycytidine (EXP) 5-chloro-7-iodoquinolin-8-ol (ISO) 5-fluorouracil (ISO) 5-iodotubercidin (ISO) 6-chloro-2,3,4,9-tetrahydro-1H-carbazole-1-carboxamide (ISO) acetylsalicylic acid (EXP) aflatoxin B1 (ISO) aldehydo-D-glucosamine (EXP,ISO) all-trans-retinoic acid (ISO) alpha-naphthoflavone (EXP) aluminium oxide (ISO) ammonium chloride (EXP) anandamide (ISO) anthra[1,9-cd]pyrazol-6(2H)-one (ISO) antirheumatic drug (ISO) apigenin (ISO) arsenite(3-) (ISO) arsenous acid (ISO) avobenzone (ISO) azathioprine (ISO) azithromycin (ISO) Azoxymethane (EXP) benzene (ISO) benzo[a]pyrene (EXP,ISO) benzo[a]pyrene diol epoxide I (ISO) beta-D-glucosamine (EXP,ISO) beta-naphthoflavone (ISO) bisphenol A (EXP,ISO) bisphenol F (ISO) bleomycin A2 (ISO) BQ 123 (ISO) Butylbenzyl phthalate (ISO) Butylparaben (EXP) C.I. Natural Red 20 (ISO) C60 fullerene (ISO) cadmium atom (ISO) cadmium dichloride (ISO) calcitriol (ISO) cannabidiol (ISO) carbon nanotube (ISO) carvacrol (EXP) CGP 52608 (ISO) chloramphenicol (ISO) chlorothalonil (ISO) choline (ISO) chondroitin sulfate (ISO) ciprofloxacin (ISO) cisplatin (ISO) cobalt atom (ISO) copper atom (ISO) copper(0) (ISO) copper(II) sulfate (ISO) cordycepin (EXP,ISO) crocidolite asbestos (ISO) crotonaldehyde (ISO) curcumin (ISO) cyclophosphamide (ISO) cyclosporin A (ISO) DDT (ISO) desferrioxamine B (ISO) dexamethasone (ISO) dextran sulfate (ISO) diallyl trisulfide (ISO) diarsenic trioxide (ISO) dibenzo[a,l]pyrene (ISO) dieckol (ISO) diethyl malate (ISO) diethyl maleate (ISO) diethylstilbestrol (EXP) dioxygen (ISO) disulfiram (ISO) diuron (EXP) doxorubicin (ISO) doxycycline (ISO) EC 3.1.1.4 (phospholipase A2) inhibitor (ISO) enalapril (ISO) endosulfan (EXP,ISO) enzacamene (EXP) epoxiconazole (ISO) ethanol (EXP,ISO) farnesol (ISO) fluoranthene (ISO) folic acid (ISO) formaldehyde (ISO) fucoidan (ISO) galaxolide (ISO) gemcitabine (ISO) genistein (EXP) geraniol (ISO) glycitein (ISO) gold atom (ISO) gold(0) (ISO) graphene oxide (ISO) HU-308 (ISO) hyaluronic acid (ISO) hydrogen peroxide (ISO) hydroquinone (ISO) ibuprofen (ISO) Indeno[1,2,3-cd]pyrene (ISO) irigenin (ISO) isoprenaline (EXP,ISO) L-methionine (ISO) L-proline betaine (ISO) lidocaine (EXP) lipoic acid (ISO) lipopolysaccharide (ISO) loliolide (ISO) lovastatin (ISO) malathion (ISO) manganese atom (EXP) manganese(0) (EXP) manganese(II) chloride (EXP) megestrol acetate (EXP) melittin (ISO) Methanandamide (ISO) methotrexate (ISO) methyl caffeate (ISO) methylisothiazolinone (ISO) mibolerone (ISO) mifepristone (ISO) minocycline (ISO) Morroniside (ISO) moxifloxacin (ISO) Muraglitazar (EXP) N-acetyl-L-cysteine (ISO) N-methyl-N-nitrosourea (EXP) N-nitrosodiethylamine (EXP) nickel atom (ISO) nickel sulfate (ISO) nicotine (EXP,ISO) NSC 23766 (ISO) ofloxacin (EXP) oroxylin A (ISO) ozone (EXP,ISO) paclitaxel (EXP,ISO) paracetamol (ISO) paraquat (ISO) PD 168393 (ISO) perfluorohexanesulfonic acid (ISO) phenethyl caffeate (EXP,ISO) phenobarbital (ISO) phenytoin (ISO) phorbol 13-acetate 12-myristate (ISO) pirinixic acid (ISO) pravastatin (ISO) prinomastat (ISO) progesterone (ISO) prostaglandin E2 (ISO) quercetin (ISO) rac-lactic acid (ISO) raloxifene (EXP) resorcinol (ISO) resveratrol (ISO) rifampicin (ISO) rofecoxib (ISO) rotenone (ISO) Ruscogenin (ISO) S-(1,2-dichlorovinyl)-L-cysteine (ISO) SB 203580 (ISO) serpentine asbestos (ISO) Shikonin (ISO) silver atom (ISO) silver(0) (ISO) simvastatin (EXP,ISO) sodium arsenite (ISO) sodium azide (ISO) sodium dodecyl sulfate (ISO) Soman (EXP) sotorasib (ISO) streptozocin (EXP,ISO) T-2 toxin (ISO) tamoxifen (ISO) tert-butyl hydroperoxide (ISO) Tesaglitazar (EXP) testosterone (ISO) tetrachloroethene (ISO) tetrachloromethane (EXP,ISO) tetracycline (ISO) Theaflavin 3,3'-digallate (EXP,ISO) thioacetamide (EXP,ISO) thiram (ISO) titanium dioxide (ISO) tofacitinib (ISO) trametinib (ISO) triclosan (ISO) tunicamycin (ISO) ursodeoxycholic acid (EXP) varespladib methyl (ISO) zerumbone (ISO) zinc atom (ISO) zinc oxide (EXP) zinc(0) (ISO)
Biological Process
cellular response to amino acid stimulus (IEA,ISO) cellular response to cell-matrix adhesion (IEP) cellular response to interleukin-1 (IEP) cellular response to reactive oxygen species (IEA,ISO) cellular response to UV-A (IEA,ISO,ISS) collagen catabolic process (IBA,IEA) extracellular matrix organization (IBA) female pregnancy (IEP) innate immune response (IEA) negative regulation of phosphatidylinositol 3-kinase/protein kinase B signal transduction (IEA,ISO) negative regulation of reactive oxygen species metabolic process (IEA,ISO) positive regulation of cell migration (IMP) positive regulation of protein-containing complex assembly (IEA,ISO) protein catabolic process (IEA,ISO) proteolysis (IEA,ISO) regulation of cell migration (IEA,ISO) response to amino acid (IEP) response to cytokine (IEP) response to estradiol (IEP) response to hypoxia (IEP) response to interleukin-1 (IEP) response to lipopolysaccharide (IEP) response to mechanical stimulus (IEP) response to tumor necrosis factor (IEP)
1.
Changes in matrix metalloproteinases and their inhibitors in kidney transplant recipients.
Ahmed AK, etal., Exp Clin Transplant. 2012 Aug;10(4):332-43.
2.
Type 2 diabetes impairs tendon repair after injury in a rat model.
Ahmed AS, etal., J Appl Physiol (1985). 2012 Dec 1;113(11):1784-91. doi: 10.1152/japplphysiol.00767.2012. Epub 2012 Oct 4.
3.
Long-term administration of aspirin inhibits tumour formation and triggers anti-neoplastic molecular changes in a pre-clinical model of colon carcinogenesis.
Bousserouel S, etal., Oncol Rep. 2010 Feb;23(2):511-7.
4.
Novel phosphoinositide 3-kinase delta,gamma inhibitor: potent anti-inflammatory effects and joint protection in models of rheumatoid arthritis.
Boyle DL, etal., J Pharmacol Exp Ther. 2014 Feb;348(2):271-80. doi: 10.1124/jpet.113.205955. Epub 2013 Nov 15.
5.
Matrix metalloproteinase 1, 3 and 12 polymorphisms and esophageal adenocarcinoma risk and prognosis.
Bradbury PA, etal., Carcinogenesis. 2009 May;30(5):793-8. doi: 10.1093/carcin/bgp065. Epub 2009 Mar 25.
6.
Spatial and temporal pattern of expression of interstitial collagenase, stromelysin/transin, gelatinase A, and TIMP-1 during experimental gastric ulcer healing.
Calabro A, etal., Digestion. 2004;70(2):127-38. Epub 2004 Sep 16.
7.
Cyclooxygenase inhibition limits blood-brain barrier disruption following intracerebral injection of tumor necrosis factor-alpha in the rat.
Candelario-Jalil E, etal., J Pharmacol Exp Ther. 2007 Nov;323(2):488-98. Epub 2007 Aug 17.
8.
Autoantibody and biopsy grading are associated with expression of ICAM-1, MMP-3, and TRAIL in salivary gland mononuclear cells of Chinese patients with Sjogren's syndrome.
Chen WS, etal., J Rheumatol. 2009 May;36(5):989-96. doi: 10.3899/jrheum.080733. Epub 2009 Mar 30.
9.
Expression of matrix metalloproteinase-3 in the rat cervix during pregnancy and in response to prostaglandin E2.
Chien EK, etal., Am J Obstet Gynecol. 2005 Jan;192(1):309-17.
10.
Hyaluronan modulates accumulation of hypoxia-inducible factor-1 alpha, inducible nitric oxide synthase, and matrix metalloproteinase-3 in the synovium of rat adjuvant-induced arthritis model.
Chou LW, etal., Arthritis Res Ther. 2011 Jun 16;13(3):R90. doi: 10.1186/ar3365.
11.
Spinal matrix metalloproteinase 3 mediates inflammatory hyperalgesia via a tumor necrosis factor-dependent mechanism.
Christianson CA, etal., Neuroscience. 2012 Jan 3;200:199-210. doi: 10.1016/j.neuroscience.2011.10.019. Epub 2011 Oct 20.
12.
Matrix metalloproteinase-1 and matrix metalloproteinase-3 gene promoter polymorphisms are associated with mortality in haemodialysis patients.
Cozzolino M, etal., Nephrol Dial Transplant. 2009 Jul;24(7):2207-12. doi: 10.1093/ndt/gfp061. Epub 2009 Feb 16.
13.
Cholinoceptor modulation on nitric oxide regulates prostaglandin E(2) and metalloproteinase-3 production in experimentally induced inflammation of rat dental pulp.
De Couto Pita A, etal., J Endod. 2009 Apr;35(4):529-36.
14.
Regulation of matrix metalloproteinase expression by dynamic tensile strain in rat fibrochondrocytes.
Deschner J, etal., Osteoarthritis Cartilage. 2006 Mar;14(3):264-72. Epub 2005 Nov 14.
15.
Modulation of extracellular matrix components by metalloproteinases and their tissue inhibitors during degeneration and regeneration of rat sural nerve.
Gantus MA, etal., Brain Res. 2006 Nov 29;1122(1):36-46. Epub 2006 Oct 6.
16.
Phylogenetic-based propagation of functional annotations within the Gene Ontology consortium.
Gaudet P, etal., Brief Bioinform. 2011 Sep;12(5):449-62. doi: 10.1093/bib/bbr042. Epub 2011 Aug 27.
17.
A multigenic approach to predict breast cancer risk.
Gerger A, etal., Breast Cancer Res Treat. 2007 Aug;104(2):159-64. Epub 2006 Oct 21.
18.
Matrix metalloproteinase-1 and matrix metalloproteinase-3 gene promoter polymorphisms are associated with carotid artery stenosis.
Ghilardi G, etal., Stroke. 2002 Oct;33(10):2408-12.
19.
Prevention of alveolar destruction and airspace enlargement in a mouse model of pulmonary lymphangioleiomyomatosis (LAM).
Goncharova EA, etal., Sci Transl Med. 2012 Oct 3;4(154):154ra134. doi: 10.1126/scitranslmed.3003840.
20.
Gene expression profiling of skin and draining lymph nodes of rats affected with cutaneous contact hypersensitivity.
Hartmann B, etal., Inflamm Res. 2006 Aug;55(8):322-34.
21.
Association of a haplotype of matrix metalloproteinase (MMP)-1 and MMP-3 polymorphisms with renal cell carcinoma.
Hirata H, etal., Carcinogenesis. 2004 Dec;25(12):2379-84. Epub 2004 Aug 19.
22.
Multiple-polymorphism associations of 7 matrix metalloproteinase and tissue inhibitor metalloproteinase genes with myocardial infarction and angiographic coronary artery disease.
Horne BD, etal., Am Heart J. 2007 Oct;154(4):751-8.
23.
Baseline serum MMP-3 levels in patients with Rheumatoid Arthritis are still independently predictive of radiographic progression in a longitudinal observational cohort at 8 years follow up.
Houseman M, etal., Arthritis Res Ther. 2012 Feb 7;14(1):R30. doi: 10.1186/ar3734.
24.
Diagnosis and assessment of Takayasu arteritis by multiple biomarkers.
Ishihara T, etal., Circ J. 2013;77(2):477-83. Epub 2012 Oct 26.
25.
Candesartan reduces the hemorrhage associated with delayed tissue plasminogen activator treatment in rat embolic stroke.
Ishrat T, etal., Neurochem Res. 2013 Dec;38(12):2668-77. doi: 10.1007/s11064-013-1185-y. Epub 2013 Nov 6.
26.
Myelin loss associated with neuroinflammation in hypertensive rats.
Jalal FY, etal., Stroke. 2012 Apr;43(4):1115-22. doi: 10.1161/STROKEAHA.111.643080. Epub 2012 Feb 23.
27.
Kinetics of MMP-1 and MMP-3 produced by mast cells and macrophages in liver fibrogenesis of rat.
Jeong WI, etal., Anticancer Res. 2006 Sep-Oct;26(5A):3517-26.
28.
Genetic kininogen deficiency contributes to aortic aneurysm formation but not to atherosclerosis.
Kaschina E, etal., Physiol Genomics 2004 Sep 16;19(1):41-9. Epub 2004 Jul 06.
29.
Production and degradation of extracellular matrix in reversible glomerular lesions in rat model of habu snake venom-induced glomerulonephritis.
Kawazu T, etal., Med Mol Morphol. 2012 Dec;45(4):190-8. doi: 10.1007/s00795-011-0559-y. Epub 2012 Dec 7.
30.
Matrix metalloproteinases and mesangial remodeling in light chain-related glomerular damage.
Keeling J and Herrera GA, Kidney Int. 2005 Oct;68(4):1590-603.
31.
Honokiol inhibits the progression of collagen-induced arthritis by reducing levels of pro-inflammatory cytokines and matrix metalloproteinases and blocking oxidative tissue damage.
Kim KR, etal., J Pharmacol Sci. 2010;114(1):69-78. Epub 2010 Aug 10.
32.
Endothelins stimulate the production of stromelysin-1 in cultured rat astrocytes.
Koyama Y and Tanaka K, Biochem Biophys Res Commun. 2008 Jul 11;371(4):659-63. Epub 2008 Apr 23.
33.
Pleural fluid analysis of lung cancer vs benign inflammatory disease patients.
Kremer R, etal., Br J Cancer. 2010 Mar 30;102(7):1180-4. Epub 2010 Mar 9.
34.
The 5A/6A polymorphism of the matrix metalloproteinase 3 gene promoter and breast cancer.
Krippl P, etal., Clin Cancer Res. 2004 May 15;10(10):3518-20.
35.
Matrix metalloproteinase-3 in articular cartilage is upregulated by joint immobilization and suppressed by passive joint motion.
Leong DJ, etal., Matrix Biol. 2010 Feb 12.
36.
Proinflammatory cytokines regulate tissue inhibitors of metalloproteinases and disintegrin metalloproteinase in cardiac cells.
Li YY, etal., Cardiovasc Res. 1999 Apr;42(1):162-72.
37.
Herb formula "Fufangqishe-Pill" prevents upright posture-induced intervertebral disc degeneration at the lumbar in rats.
Liang QQ, etal., J Pharmacol Sci. 2010;113(1):23-31.
38.
Prolonged upright posture induces degenerative changes in intervertebral discs of rat cervical spine.
Liang QQ, etal., Spine (Phila Pa 1976). 2011 Jan 1;36(1):E14-9. doi: 10.1097/BRS.0b013e3181d2dec2.
39.
Genetic polymorphisms of MMP1, MMP3 and MMP7 gene promoter and risk of colorectal adenoma.
Lievre A, etal., BMC Cancer. 2006 Nov 24;6:270.
40.
Functional polymorphisms in matrix metalloproteinases-1, -3, -9 are associated with arteriovenous fistula patency in hemodialysis patients.
Lin CC, etal., Clin J Am Soc Nephrol. 2010 Oct;5(10):1805-14. doi: 10.2215/CJN.01500210. Epub 2010 Jul 8.
41.
MMP-1 and MMP-3 polymorphism and arrhythmia recurrence after electrical cardioversion in patients with persistent atrial fibrillation.
Lombardi F, etal., J Cardiovasc Med (Hagerstown). 2011 Jan;12(1):37-42. doi: 10.2459/JCM.0b013e3283403366.
42.
The effects of short-term load duration on anabolic and catabolic gene expression in the rat tail intervertebral disc.
MacLean JJ, etal., J Orthop Res. 2005 Sep;23(5):1120-7. Epub 2005 Apr 9.
43.
Levels of circulating collagenase, stromelysin-1, and tissue inhibitor of matrix metalloproteinases 1 in patients with rheumatoid arthritis. Relationship to serum levels of antigenic keratan sulfate and systemic parameters of inflammation.
Manicourt DH, etal., Arthritis Rheum. 1995 Aug;38(8):1031-9.
44.
Comparative effect of nimesulide and ibuprofen on the urinary levels of collagen type II C-telopeptide degradation products and on the serum levels of hyaluronan and matrix metalloproteinases-3 and -13 in patients with flare-up of osteoarthritis.
Manicourt DH, etal., Drugs R D. 2005;6(5):261-71.
45.
Epidermal growth factor and oncogenes induce transcription of the same cellular mRNA in rat fibroblasts.
Matrisian LM, etal., EMBO J 1985 Jun;4(6):1435-40.
46.
Expression of MMP2, MMP9 and MMP3 in breast cancer brain metastasis in a rat model.
Mendes O, etal., Clin Exp Metastasis. 2005;22(3):237-46.
47.
Identification of a calcium-dependent matrix metalloproteinase complex in rat chorioallantoid membranes during labour.
Meraz-Cruz N, etal., Mol Hum Reprod. 2006 Oct;12(10):633-41. Epub 2006 Aug 25.
48.
Rat ISS GO annotations from MGI mouse gene data--August 2006
MGD data from the GO Consortium
49.
Renal expression of the Ets-1 proto-oncogene during progression of rat crescentic glomerulonephritis.
Naito T, etal., J Am Soc Nephrol. 2000 Dec;11(12):2243-55.
50.
Expression of matrix metalloproteinase-9 associated with ets-1 proto-oncogene in rat tubulointerstitial cells.
Naito T, etal., Nephrol Dial Transplant. 2005 Nov;20(11):2333-48. Epub 2005 Jul 26.
51.
Electronic Transfer of LocusLink and RefSeq Data
NCBI rat LocusLink and RefSeq merged data July 26, 2002
52.
Matrix metalloproteinase-3 inhibitor retards treadmill running-induced cartilage degradation in rats.
Ni GX, etal., Arthritis Res Ther. 2011;13(6):R192. doi: 10.1186/ar3521. Epub 2011 Nov 24.
53.
Autoantibody against matrix metalloproteinase-3 in patients with systemic sclerosis.
Nishijima C, etal., Clin Exp Immunol. 2004 Nov;138(2):357-63.
54.
OMIM Disease Annotation Pipeline
OMIM Disease Annotation Pipeline
55.
Polymorphism of matrix metalloproteinase-3 promoter gene as a risk factor for coronary artery lesions in Kawasaki disease.
Park JA, etal., J Korean Med Sci. 2005 Aug;20(4):607-11.
56.
Activity-dependent shedding of the NMDA receptor glycine binding site by matrix metalloproteinase 3: a PUTATIVE mechanism of postsynaptic plasticity.
Pauly T, etal., PLoS One. 2008 Jul 16;3(7):e2681.
57.
KEGG Annotation Import Pipeline
Pipeline to import KEGG annotations from KEGG into RGD
58.
Matrix metalloproteinase3 and 9 gene promoter polymorphisms: joint action of two loci as a risk factor for coronary artery complicated plaques.
Pollanen PJ, etal., Atherosclerosis. 2005 May;180(1):73-8. Epub 2004 Dec 18.
59.
Macrophage-mediated phagocytosis of apoptotic cholangiocytes contributes to reversal of experimental biliary fibrosis.
Popov Y, etal., Am J Physiol Gastrointest Liver Physiol. 2010 Mar;298(3):G323-34. doi: 10.1152/ajpgi.00394.2009. Epub 2010 Jan 7.
60.
Temperospatial expression of matrix metalloproteinases 1, 2, 3, and 9 during early tooth development.
Randall LE and Hall RC, Connect Tissue Res 2002;43(2-3):205-11.
61.
GOA pipeline
RGD automated data pipeline
62.
ClinVar Automated Import and Annotation Pipeline
RGD automated import pipeline for ClinVar variants, variant-to-disease annotations and gene-to-disease annotations
63.
Data Import for Chemical-Gene Interactions
RGD automated import pipeline for gene-chemical interactions
64.
Increased matrix metalloproteinase-3 serum levels in rheumatic diseases: relationship with synovitis and steroid treatment.
Ribbens C, etal., Ann Rheum Dis. 2002 Feb;61(2):161-6.
65.
Analysis of germline variants in CDH1, IGFBP3, MMP1, MMP3, STK15 and VEGF in familial and sporadic renal cell carcinoma.
Ricketts C, etal., PLoS One. 2009 Jun 24;4(6):e6037. doi: 10.1371/journal.pone.0006037.
66.
Regulated expression of matrix metalloproteinases, inflammatory mediators, and endometrial matrix remodeling by 17beta-estradiol in the immature rat uterus.
Russo LA, etal., Reprod Biol Endocrinol. 2009 Nov 4;7:124.
67.
Full and partial peroxisome proliferation-activated receptor-gamma agonists, but not delta agonist, rescue of dopaminergic neurons in the 6-OHDA parkinsonian model is associated with inhibition of microglial activation and MMP expression.
Sadeghian M, etal., J Neuroimmunol. 2012 May 15;246(1-2):69-77. doi: 10.1016/j.jneuroim.2012.03.010. Epub 2012 Apr 11.
68.
Overexpression of matrix metalloproteinase-10 and matrix metalloproteinase-3 in human diabetic corneas: a possible mechanism of basement membrane and integrin alterations.
Saghizadeh M, etal., Am J Pathol. 2001 Feb;158(2):723-34.
69.
Renal expression of matrix metalloproteinases in human ANCA-associated glomerulonephritis.
Sanders JS, etal., Nephrol Dial Transplant. 2004 Jun;19(6):1412-9. Epub 2004 Mar 19.
70.
Tissue remodeling in the acute otitis media mouse model.
Sautter NB, etal., Int J Pediatr Otorhinolaryngol. 2011 Nov;75(11):1368-71. doi: 10.1016/j.ijporl.2011.07.026. Epub 2011 Sep 1.
71.
Zucker diabetic fatty rat: a new model of impaired cutaneous wound repair with type II diabetes mellitus and obesity.
Slavkovsky R, etal., Wound Repair Regen. 2011 Jul-Aug;19(4):515-25. doi: 10.1111/j.1524-475X.2011.00703.x. Epub 2011 Jun 7.
72.
Activation of matrix metalloproteinase-3 and agrin cleavage in cerebral ischemia/reperfusion.
Sole S, etal., J Neuropathol Exp Neurol. 2004 Apr;63(4):338-49.
73.
The stromal proteinase MMP3/stromelysin-1 promotes mammary carcinogenesis.
Sternlicht MD, etal., Cell. 1999 Jul 23;98(2):137-46.
74.
In situ hybridization studies of matrix metalloproteinase-3, tissue inhibitor of metalloproteinase-1 and type IV collagen in diabetic nephropathy.
Suzuki D, etal., Kidney Int. 1997 Jul;52(1):111-9.
75.
Modulation of matrix metalloproteinase-9 in hepatic stellate cells by three-dimensional type I collagen: its activation and signaling pathway.
Takahara T, etal., Hepatol Res. 2003 Aug;26(4):318-326.
76.
[Effects of matrix metalloproteinase-3, osteopontin, and tissue inhibitor of metalloproteinase-1 in the formation of cataract].
Tan Q, etal., Zhong Nan Da Xue Xue Bao Yi Xue Ban. 2006 Oct;31(5):737-41.
77.
Serum matrix metalloproteinase-3 and tissue inhibitor of metalloproteinase-1 in patients with malignant melanoma.
Tas F, etal., Med Oncol. 2005;22(1):39-44.
78.
MMP profile in paired serum and synovial fluid samples of patients with rheumatoid arthritis.
Tchetverikov I, etal., Ann Rheum Dis. 2004 Jul;63(7):881-3.
79.
The association of serum matrix metalloproteinases and their tissue inhibitor levels with scleroderma disease severity.
Toubi E, etal., Clin Exp Rheumatol. 2002 Mar-Apr;20(2):221-4.
80.
Decrease in serum matrix metalloproteinase-9 and matrix metalloproteinase-3 levels in Zucker fa/fa obese rats after treatment with swertiamarin.
Vaidya H, etal., Exp Clin Cardiol. 2012 Spring;17(1):12-6.
81.
[Effects of glutamine on matrix metalloproteinase-3 and tissue inhibitor of metalloproteinase-3 expressions in myocardium of rats with sepsis]
Wang H, etal., Zhonghua Er Ke Za Zhi. 2006 Aug;44(8):587-91.
82.
Matrix metalloproteinase deficiencies affect contact hypersensitivity: stromelysin-1 deficiency prevents the response and gelatinase B deficiency prolongs the response.
Wang M, etal., Proc Natl Acad Sci U S A. 1999 Jun 8;96(12):6885-9.
83.
Therapeutic effects of p75 tumor necrosis factor receptor monoclonal antibody on a rat model of traumatic arthritis.
Wang YX, etal., J Surg Res. 2014 Jan;186(1):234-9. doi: 10.1016/j.jss.2013.07.047. Epub 2013 Aug 20.
84.
The role of oxidative stress and inflammation in conjunctivochalasis.
Ward SK, etal., Invest Ophthalmol Vis Sci. 2010 Apr;51(4):1994-2002. doi: 10.1167/iovs.09-4130. Epub 2009 Dec 17.
85.
Expression of matrix metalloproteinases and their inhibitor TIMP-1 in the rat carotid artery after balloon injury.
Webb KE, etal., Arterioscler Thromb Vasc Biol. 1997 Sep;17(9):1837-44.
86.
[Effect of progesterone on MMP-3 expression in neonatal rat brain after hypoxic-ischemia].
Xu CY, etal., Zhongguo Ying Yong Sheng Li Xue Za Zhi. 2010 Aug;26(3):370-3.
87.
Matrix metalloproteinase 3 is a mediator of pulmonary fibrosis.
Yamashita CM, etal., Am J Pathol. 2011 Oct;179(4):1733-45. doi: 10.1016/j.ajpath.2011.06.041. Epub 2011 Aug 24.
88.
Imbalance of matrix metalloproteinases/tissue inhibitor of metalloproteinase-1 and loss of fibronectin expression in patients with congestive heart failure.
Yang DC, etal., Cardiology. 2010;116(2):133-41. doi: 10.1159/000317245. Epub 2010 Jul 1.
89.
Stage-specific action of matrix metalloproteinases influences progressive hereditary kidney disease.
Zeisberg M, etal., PLoS Med. 2006 Apr;3(4):e100. Epub 2006 Mar 7.
90.
NK cells promote Th-17 mediated corneal barrier disruption in dry eye.
Zhang X, etal., PLoS One. 2012;7(5):e36822. doi: 10.1371/journal.pone.0036822. Epub 2012 May 8.
91.
Expression changes and roles of matrix metalloproteinases in a rat model of traumatic deep vein thrombosis.
Zhang YB, etal., Chin J Traumatol. 2010 Jun 1;13(3):188-92.
92.
Matrix metalloproteinase-3 accelerates wound healing following dental pulp injury.
Zheng L, etal., Am J Pathol. 2009 Nov;175(5):1905-14. Epub 2009 Oct 15.
93.
MiR-15b and miR-152 reduce glioma cell invasion and angiogenesis via NRP-2 and MMP-3.
Zheng X, etal., Cancer Lett. 2013 Feb 28;329(2):146-54. doi: 10.1016/j.canlet.2012.10.026. Epub 2012 Nov 7.
94.
Zhonghua kou qiang yi xue za zhi = Zhonghua kouqiang yixue zazhi = Chinese journal of stomatology
Zhong LJ, etal., Zhonghua Kou Qiang Yi Xue Za Zhi. 2009 Aug;44(8):464-8.
95.
Haplotype analysis of the matrix metalloproteinase 3 gene and myocardial infarction in a Chinese Han population. The Beijing atherosclerosis study.
Zhou X, etal., Thromb Haemost. 2004 Oct;92(4):867-73.
Mmp3 Rat Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl GRCr8 8 12,925,267 - 12,938,828 (+) NCBI GRCr8 mRatBN7.2 8 4,640,397 - 4,653,963 (+) NCBI mRatBN7.2 mRatBN7.2 mRatBN7.2 Ensembl 8 4,640,416 - 4,653,961 (+) Ensembl mRatBN7.2 Ensembl UTH_Rnor_SHR_Utx 8 8,600,140 - 8,613,640 (+) NCBI Rnor_SHR UTH_Rnor_SHR_Utx UTH_Rnor_SHRSP_BbbUtx_1.0 8 6,897,910 - 6,911,412 (+) NCBI Rnor_SHRSP UTH_Rnor_SHRSP_BbbUtx_1.0 UTH_Rnor_WKY_Bbb_1.0 8 4,900,079 - 4,913,622 (+) NCBI Rnor_WKY UTH_Rnor_WKY_Bbb_1.0 Rnor_6.0 8 5,676,608 - 5,698,579 (+) NCBI Rnor6.0 Rnor_6.0 rn6 Rnor6.0 Rnor_6.0 Ensembl 8 5,676,665 - 5,698,579 (+) Ensembl Rnor6.0 rn6 Rnor6.0 Rnor_5.0 8 5,680,382 - 5,701,427 (+) NCBI Rnor5.0 Rnor_5.0 rn5 Rnor5.0 RGSC_v3.4 8 4,315,601 - 4,329,146 (+) NCBI RGSC3.4 RGSC_v3.4 rn4 RGSC3.4 RGSC_v3.1 8 4,315,600 - 4,329,146 (+) NCBI Celera 8 6,200,234 - 6,213,783 (+) NCBI Celera Cytogenetic Map 8 q11 NCBI
MMP3 Human Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl GRCh38 11 102,835,801 - 102,843,609 (-) NCBI GRCh38 GRCh38 hg38 GRCh38 GRCh38.p14 Ensembl 11 102,835,801 - 102,843,609 (-) Ensembl GRCh38 hg38 GRCh38 GRCh37 11 102,706,532 - 102,714,340 (-) NCBI GRCh37 GRCh37 hg19 GRCh37 Build 36 11 102,211,738 - 102,219,552 (-) NCBI NCBI36 Build 36 hg18 NCBI36 Build 34 11 102,211,742 - 102,219,550 NCBI Celera 11 99,868,135 - 99,875,949 (-) NCBI Celera Cytogenetic Map 11 q22.2 NCBI HuRef 11 98,634,450 - 98,642,264 (-) NCBI HuRef CHM1_1 11 102,589,497 - 102,597,317 (-) NCBI CHM1_1 T2T-CHM13v2.0 11 102,839,570 - 102,847,378 (-) NCBI T2T-CHM13v2.0
Mmp3 Mouse Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl GRCm39 9 7,445,845 - 7,455,975 (+) NCBI GRCm39 GRCm39 mm39 GRCm39 Ensembl 9 7,445,822 - 7,455,975 (+) Ensembl GRCm39 Ensembl GRCm38 9 7,445,822 - 7,455,975 (+) NCBI GRCm38 GRCm38 mm10 GRCm38 GRCm38.p6 Ensembl 9 7,445,822 - 7,455,975 (+) Ensembl GRCm38 mm10 GRCm38 MGSCv37 9 7,445,822 - 7,455,975 (+) NCBI GRCm37 MGSCv37 mm9 NCBIm37 MGSCv36 9 7,445,822 - 7,455,975 (+) NCBI MGSCv36 mm8 Celera 9 4,846,374 - 4,856,527 (+) NCBI Celera Cytogenetic Map 9 A1 NCBI cM Map 9 2.46 NCBI
MMP3 Bonobo Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl NHGRI_mPanPan1-v2 9 103,629,536 - 103,637,408 (-) NCBI NHGRI_mPanPan1-v2 NHGRI_mPanPan1 11 104,717,742 - 104,725,633 (-) NCBI NHGRI_mPanPan1 Mhudiblu_PPA_v0 11 97,776,729 - 97,784,549 (-) NCBI Mhudiblu_PPA_v0 Mhudiblu_PPA_v0 panPan3 PanPan1.1 11 101,267,561 - 101,275,432 (-) NCBI panpan1.1 PanPan1.1 panPan2 PanPan1.1 Ensembl 11 101,267,566 - 101,275,354 (-) Ensembl panpan1.1 panPan2
MMP3 Dog Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl CanFam3.1 5 28,949,631 - 28,957,915 (+) NCBI CanFam3.1 CanFam3.1 canFam3 CanFam3.1 CanFam3.1 Ensembl 5 28,949,631 - 28,958,222 (+) Ensembl CanFam3.1 canFam3 CanFam3.1 Dog10K_Boxer_Tasha 5 28,898,123 - 28,906,399 (+) NCBI Dog10K_Boxer_Tasha ROS_Cfam_1.0 5 29,000,797 - 29,009,079 (+) NCBI ROS_Cfam_1.0 ROS_Cfam_1.0 Ensembl 5 29,000,797 - 29,009,386 (+) Ensembl ROS_Cfam_1.0 Ensembl UMICH_Zoey_3.1 5 29,035,847 - 29,044,131 (+) NCBI UMICH_Zoey_3.1 UNSW_CanFamBas_1.0 5 28,915,267 - 28,923,546 (+) NCBI UNSW_CanFamBas_1.0 UU_Cfam_GSD_1.0 5 29,090,249 - 29,098,533 (+) NCBI UU_Cfam_GSD_1.0
MMP3 Green Monkey Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl ChlSab1.1 1 94,216,156 - 94,224,437 (-) NCBI ChlSab1.1 ChlSab1.1 chlSab2 ChlSab1.1 Ensembl 1 94,216,173 - 94,224,264 (-) Ensembl ChlSab1.1 ChlSab1.1 Ensembl chlSab2 Vero_WHO_p1.0 NW_023666043 31,654,560 - 31,662,871 (+) NCBI Vero_WHO_p1.0 Vero_WHO_p1.0
Mmp3
.
Predicted Target Of
Count of predictions: 26 Count of miRNA genes: 26 Interacting mature miRNAs: 26 Transcripts: ENSRNOT00000012310 Prediction methods: Miranda, Rnahybrid Result types: miRGate_prediction
12880023 Bw184 Body weight QTL 184 0.001 body mass (VT:0001259) body weight (CMO:0000012) 8 2097640 47097640 Rat 9590084 Insglur5 Insulin/glucose ratio QTL 5 18.54 0.001 blood insulin amount (VT:0001560) calculated plasma insulin level (CMO:0002170) 8 1 24597739 Rat 12880028 Cm103 Cardiac mass QTL 103 0.02 heart left ventricle mass (VT:0007031) heart left ventricle weight to body weight ratio (CMO:0000530) 8 2097640 47097640 Rat 12880044 Am9 Aortic mass QTL 9 0.007 aorta mass (VT:0002845) aorta weight to aorta length to body weight ratio (CMO:0002722) 8 2097640 47097640 Rat 2317882 Alcrsp24 Alcohol response QTL 24 3.2 0.05 response to alcohol trait (VT:0010489) duration of loss of righting reflex (CMO:0002289) 8 1 25902202 Rat 12880025 Cm102 Cardiac mass QTL 102 0.044 heart mass (VT:0007028) heart wet weight to body weight ratio (CMO:0002408) 8 2097640 47097640 Rat
Click on a value in the shaded box below the category label to view a detailed expression data table for that system.
alimentary part of gastrointestinal system
9
8
4
61
47
43
21
14
21
6
101
39
41
26
44
22
Too many to show, limit is 500. Download them if you would like to view them all.
Ensembl Acc Id:
ENSRNOT00000012310 ⟹ ENSRNOP00000012310
Type:
CODING
Position:
Rat Assembly Chr Position (strand) Source Rnor_6.0 Ensembl 8 5,676,665 - 5,698,237 (+) Ensembl
Ensembl Acc Id:
ENSRNOT00000091704 ⟹ ENSRNOP00000075241
Type:
CODING
Position:
Rat Assembly Chr Position (strand) Source mRatBN7.2 Ensembl 8 4,640,416 - 4,653,961 (+) Ensembl Rnor_6.0 Ensembl 8 5,686,298 - 5,698,579 (+) Ensembl
RefSeq Acc Id:
NM_133523 ⟹ NP_598207
RefSeq Status:
VALIDATED
Type:
CODING
Position:
Rat Assembly Chr Position (strand) Source GRCr8 8 12,925,281 - 12,938,826 (+) NCBI mRatBN7.2 8 4,640,416 - 4,653,961 (+) NCBI Rnor_6.0 8 5,676,608 - 5,698,579 (+) NCBI Rnor_5.0 8 5,680,382 - 5,701,427 (+) NCBI RGSC_v3.4 8 4,315,601 - 4,329,146 (+) RGD Celera 8 6,200,234 - 6,213,783 (+) RGD
Sequence:
AAGGAGGCAGCAAAGAACCCGCTGAGAGCAGTGCAGAACTGTGGGAAGCCAGTGGAAATGAAAGGGCTCCCAGTCCTGCTGTGGCTGTGTACGGCTGTGTGCTCATCCTACCCATTGCATGGCAGTGA
hide sequence
RefSeq Acc Id:
XM_039080743 ⟹ XP_038936671
Type:
CODING
Position:
Rat Assembly Chr Position (strand) Source GRCr8 8 12,925,267 - 12,938,828 (+) NCBI mRatBN7.2 8 4,640,397 - 4,653,963 (+) NCBI
RefSeq Acc Id:
NP_598207 ⟸ NM_133523
- Peptide Label:
preproprotein
- UniProtKB:
A6JN31 (UniProtKB/TrEMBL), A0A0G2KA34 (UniProtKB/TrEMBL)
- Sequence:
MKGLPVLLWLCTAVCSSYPLHGSEEDAGMEVLQKYLENYYGLEKDVKQFTKKKDSSPVVKKIQEMQKFLGLKMTGKLDSNTMELMHKPRCGVPDVGGFSTFPGSPKWRKNHISYRIVNYTLDLPRESV
hide sequence
Ensembl Acc Id:
ENSRNOP00000012310 ⟸ ENSRNOT00000012310
Ensembl Acc Id:
ENSRNOP00000075241 ⟸ ENSRNOT00000091704
RefSeq Acc Id:
XP_038936671 ⟸ XM_039080743
- Peptide Label:
isoform X1
- UniProtKB:
A6JN31 (UniProtKB/TrEMBL), A0A0G2KA34 (UniProtKB/TrEMBL)
RGD ID: 13695737 Promoter ID: EPDNEW_R6257 Type: single initiation site Name: Mmp3_1 Description: matrix metallopeptidase 3 SO ACC ID: SO:0000170 Source: EPDNEW (Eukaryotic Promoter Database, http://epd.vital-it.ch/ ) Experiment Methods: Single-end sequencing. Position: Rat Assembly Chr Position (strand) Source Rnor_6.0 8 5,676,607 - 5,676,667 EPDNEW
BioCyc Gene G2FUF-31789 BioCyc
Ensembl Genes ENSRNOG00000032626 Ensembl, UniProtKB/TrEMBL
Ensembl Transcript ENSRNOT00000091704.2 UniProtKB/TrEMBL
Gene3D-CATH 2.110.10.10 UniProtKB/Swiss-Prot, UniProtKB/TrEMBL
3.40.390.10 UniProtKB/Swiss-Prot, UniProtKB/TrEMBL
InterPro Hemopexin-like_dom UniProtKB/Swiss-Prot, UniProtKB/TrEMBL
Hemopexin-like_dom_sf UniProtKB/Swiss-Prot, UniProtKB/TrEMBL
Hemopexin-like_repeat UniProtKB/Swiss-Prot, UniProtKB/TrEMBL
Hemopexin_CS UniProtKB/Swiss-Prot, UniProtKB/TrEMBL
M10A_MMP UniProtKB/Swiss-Prot, UniProtKB/TrEMBL
MetalloPept_cat_dom_sf UniProtKB/Swiss-Prot, UniProtKB/TrEMBL
Pept_M10_metallopeptidase UniProtKB/Swiss-Prot, UniProtKB/TrEMBL
Pept_M10A UniProtKB/Swiss-Prot, UniProtKB/TrEMBL
Pept_M10A_Zn_BS UniProtKB/Swiss-Prot, UniProtKB/TrEMBL
Peptidase_Metallo UniProtKB/Swiss-Prot, UniProtKB/TrEMBL
Peptidoglycan-bd-like UniProtKB/Swiss-Prot, UniProtKB/TrEMBL
PGBD-like_sf UniProtKB/Swiss-Prot, UniProtKB/TrEMBL
KEGG Report rno:171045 UniProtKB/TrEMBL
NCBI Gene 171045 ENTREZGENE
PANTHER MATRIX METALLOPROTEINASE UniProtKB/Swiss-Prot, UniProtKB/TrEMBL
STROMELYSIN-1 UniProtKB/Swiss-Prot, UniProtKB/TrEMBL
Pfam Hemopexin UniProtKB/Swiss-Prot, UniProtKB/TrEMBL
Peptidase_M10 UniProtKB/Swiss-Prot, UniProtKB/TrEMBL
PG_binding_1 UniProtKB/Swiss-Prot, UniProtKB/TrEMBL
PharmGKB MMP3 RGD
PhenoGen Mmp3 PhenoGen
PIRSF Peptidase_M10A_matrix UniProtKB/Swiss-Prot, UniProtKB/TrEMBL
PRINTS MATRIXIN UniProtKB/Swiss-Prot, UniProtKB/TrEMBL
PROSITE CYSTEINE_SWITCH UniProtKB/Swiss-Prot, UniProtKB/TrEMBL
HEMOPEXIN UniProtKB/Swiss-Prot, UniProtKB/TrEMBL
HEMOPEXIN_2 UniProtKB/Swiss-Prot, UniProtKB/TrEMBL
ZINC_PROTEASE UniProtKB/Swiss-Prot
RatGTEx ENSRNOG00000032626 RatGTEx
SMART SM00120 UniProtKB/Swiss-Prot, UniProtKB/TrEMBL
ZnMc UniProtKB/Swiss-Prot, UniProtKB/TrEMBL
Superfamily-SCOP Metalloproteases ('zincins'), catalytic domain UniProtKB/Swiss-Prot, UniProtKB/TrEMBL
SSF47090 UniProtKB/Swiss-Prot, UniProtKB/TrEMBL
SSF50923 UniProtKB/Swiss-Prot, UniProtKB/TrEMBL
UniProt A0A0G2KA34 ENTREZGENE, UniProtKB/TrEMBL
A6JN31 ENTREZGENE, UniProtKB/TrEMBL
MMP3_RAT UniProtKB/Swiss-Prot, ENTREZGENE
Date
Current Symbol
Current Name
Previous Symbol
Previous Name
Description
Reference
Status
2005-01-20
Mmp3
matrix metallopeptidase 3
matrix metalloproteinase 3
Symbol and Name status set to approved
1299863 APPROVED
2002-08-07
Mmp3
matrix metalloproteinase 3
Symbol and Name status set to provisional
70820 PROVISIONAL
Note Type
Note
Reference
gene_process
may have an important role during early tooth development
729121
