Sync Strain Search Result - Rat Genome Database

Submit Data | Help | Video Tutorials | News | Publications | Download | REST API | Citing RGD | Contact

Advanced Search (OLGA)

Strains search result for Rattus norvegicus
(View Results for all Objects and Ontologies)

2 records found for search term Sync

Refine Term:

Sort By:

Rat

Export

RGD ID	Symbol	Name	Origin	Source	Type	Annotations	Match
1554304	GAERS/Mave	Genetic Absence Epilepsy Rats from Strasbourg	30% of the Wistar rats from the initial breeding colony in Strasbourg had spontaneous spike and wave discharges (SWDs) which were bilateral and synchronous over the cerebral cortex. Breeders with SWDs were selected and used for breeding.	National BioResource Project for the Rat in Japan	inbred	2	origin
14985210	LE-Cyfip1^em1Sage+/-		The bioinformatics software (Horizon Discovery, St. Louis, USA) was used to design a short guide RNA (sgRNA) targeting a Protospacer Adjacent Motif (PAM) sequence within exon 7 of the rat Cyfip1gene (GGCAGATCCACAATCCATCCagg) on chromosome 1 (first 21 of 32 exons, Refseq: NC_005100.4, NM_001107517.1) ... (more) .sgRNA-Cas9 was performed by nucleofecting the sgRNA-Cas9 into rat C6 glial cells. Genomic DNA (gDNA) PCR products were subsequently generated from nucleofected C6 cells using primers flanking the sgRNA site (FOR: GCCAAAGCTTCCCCTAAAGT; REV: TGGGCGTCAAGTACATTCTG; 497bp amplicon). Embryos were collected from donor female Long Evans rats and injected with the validated sgRNA-Cas9. Then implanted into synchronized pseudopregnant Long Evans recipient female This mutant carries 4bp out of frame heterozygous deletion in exon 7 of the Cyfip1, resulting bioinformatics prediction of an early stop codon in exon 8.		mutant	4	origin