Send us a Message
Submit Data |  Help |  Video Tutorials |  News |  Publications |  Download |  REST API |  Citing RGD |  Contact   
Search RGD Grant Resources Citing RGD About Us Contact Us
Genes Variants Community Projects QTLs Strains Markers Genome Information Ontologies Cell Lines References Download Submit Data
OntoMate (Literature Search) JBrowse (Genome Browser) Synteny Browser (VCMap) Variant Visualizer Multi-Ontology Enrichment (MOET) Gene-Ortholog Location Finder (GOLF) InterViewer (Protein-Protein Interactions) PhenoMiner (Quatitative Phenotypes) Gene Annotator OLGA (Gene List Generator) AllianceMine GViewer (Genome Viewer)
Aging & Age-Related Disease Behavioral & Substance Use Disorder Cancer & Neoplastic Disease Cardiovascular Disease Coronavirus Disease Developmental Disease Diabetes Hematologic Disease Immune & Inflammatory Disease Infectious Disease Liver Disease Neurological Disease Obesity & Metabolic Syndrome Renal Disease Respiratory Disease Sensory Organ Disease
Find Models Genetic Models Autism Models Rat PhenoMiner (Quantitative Phenotypes) Chinchilla PhenoMiner Expected Ranges (Quantitative Phenotype) PhenoMiner Term Comparison Hybrid Rat Diversity Panel Phenotypes Phenotypes in Other Animal Models Animal Husbandry Strain Medical Records Phylogenetics Strain Availability Calendar Rats 101 Submissions Photo Archive
Pathways
Rat Community Forum Directory of Rat Laboratories Video Tutorials News RGD Publications RGD Presentations Archive Nomenclature Guidelines Resource Links Laboratory Resources Employment Resources
Advanced Search (OLGA)
Strains search result for Rattus norvegicus
(View Results for all Objects and Ontologies)

3 records found for search term Pink1
Refine Term:
Sort By:
           Export CSV TAB Print

RGD IDSymbolNameOriginSourceTypeAnnotationsMatch
7241054LE-Pink1em1SageThis strain was produced by injecting ZFNs into Crl:LE rat embryos. The resulting mutation is a 26-bp frameshift deletion in exon 4. Sigma Advanced Genetic Engineering Labsmutant1symbol , old_strain_symbol
401827145LE-Pink1em1DavisThe CRISPR-Cas9 system was used to delete the coding region (exons 1-8) of the Pink1 gene in NTac:SD embryos.The rat is deposited at Rat Resource and Research Center (RRRC). Rat Resource and Research Centermutant1symbol , origin
7241049LE-Pink1em1Sage-/-ZFN mutant founders were backcrossed with Crl:LE to get heterozygous offspring which were intercrossed and offspring maintained as homozygous. This allele was made by ZFN mutagenesis. The resulting mutation is a 26-bp frameshift deletion in exon 4 (ACTACTACCCAGAAGGCCTGGGCCAC). inotivmutant17symbol , old_strain_name , old_strain_symbol