Send us a Message
Submit Data |  Help |  Video Tutorials |  News |  Publications |  Download |  REST API |  Citing RGD |  Contact   
Search RGD Grant Resources Citing RGD About Us Contact Us
Genes Variants Community Projects QTLs Strains Markers Genome Information Ontologies Cell Lines References Download Submit Data
OntoMate (Literature Search) JBrowse (Genome Browser) Synteny Browser (VCMap) Variant Visualizer Multi-Ontology Enrichment (MOET) Gene-Ortholog Location Finder (GOLF) InterViewer (Protein-Protein Interactions) PhenoMiner (Quatitative Phenotypes) Gene Annotator OLGA (Gene List Generator) AllianceMine GViewer (Genome Viewer)
Aging & Age-Related Disease Behavioral & Substance Use Disorder Cancer & Neoplastic Disease Cardiovascular Disease Coronavirus Disease Developmental Disease Diabetes Hematologic Disease Immune & Inflammatory Disease Infectious Disease Liver Disease Neurological Disease Obesity & Metabolic Syndrome Renal Disease Respiratory Disease Sensory Organ Disease
Find Models Genetic Models Autism Models Rat PhenoMiner (Quantitative Phenotypes) Chinchilla PhenoMiner Expected Ranges (Quantitative Phenotype) PhenoMiner Term Comparison Hybrid Rat Diversity Panel Phenotypes Phenotypes in Other Animal Models Animal Husbandry Strain Medical Records Phylogenetics Strain Availability Calendar Rats 101 Submissions Photo Archive
Pathways
Rat Community Forum Directory of Rat Laboratories Video Tutorials News RGD Publications RGD Presentations Archive Nomenclature Guidelines Resource Links Laboratory Resources Employment Resources
Advanced Search (OLGA)
Strains search result for Rattus norvegicus
(View Results for all Objects and Ontologies)

4 records found for search term Gcg
Refine Term:
Sort By:
           Export CSV TAB Print

RGD IDSymbolNameOriginSourceTypeAnnotationsMatch
155663559SD-Gcgtm1(iCre)LrinaCRISPR/Cas9 technology was used to insert an IRES for iCre expression after the final coding sequence of exon 6 of the rat Gcg gene, before the 3' UTR.Strain has been deposited to RRRC(RRRC:00983, RGD:155663560)mutant1symbol , origin , old_strain_symbol
155663560SD-Gcgtm1(iCre)Lrina/RrrcCRISPR/Cas9 technology was used to insert an IRES for iCre expression after the final coding sequence of exon 6 of the rat Gcg gene, before the 3' UTR.Rat Resource and Research Centermutant1symbol , origin , old_strain_symbol
151347605SD-Ddah1em1YwxuCRISPR-Cas9 technique was used to generate DDAH1-/- rats on Sprague-Dawley background. Genome deletion in exon 1 was confirmed by PCR analysis with the primers:DDAH1-F (5'-GCGCTGCTCTCGGGAAGA-3') and DDAH1-R (5'-GGGTGATGAGGGCGmutant8origin
38596327WI-Tbc1d4em1GdczThe mutant rats were created with CRISPR/Cas9 system. A single guide RNA (sgRNA) and protospacer adjacent motif was designed targeting coding strand: 5' GCGACAAGCGCTTCCGGCTA TGG 3' with a predicted cut site 111 bp downstreammutant4origin