Strain Report - Rat Genome Database

Send us a Message



Submit Data |  Help |  Video Tutorials |  News |  Publications |  Download |  REST API |  Citing RGD |  Contact   

Strain: SS-Agtrapem8Mcwi

Symbol: SS-Agtrapem8Mcwi
Strain: SS-Agtrapem8
Substrain: Mcwi
RGD ID: 5143996
Citation ID: RRID:RGD_5143996
Ontology ID: RS:0002634
Alleles: Agtrapem8Mcwi
Also Known As: SS-Agtrapem8Mcwi; SS-Agtrap^[em8Mcwi]
Type: mutant
Available Source: Not Available
Origination: PhysGen Knockouts
Description: This strain was produced by injecting ZFNs targeting the sequence ATCCTGGCCCTGGGTgtgtggGCTGTGGCCCAGCGG into SS/JrHsdMcwi rat embryos. The resulting mutation is a 100-bp mutation deleting part of exon 3 and the splice acceptor.
Last Known Status: Cryopreserved Sperm (as of 2017-01-26)
Position
Rat AssemblyChrPosition (strand)SourceJBrowse
GRCr85163,790,565 - 163,802,174RGD_MAPPER_PIPELINE
mRatBN7.25158,507,427 - 158,519,036RGD_MAPPER_PIPELINEmRatBN7.2
Rnor_6.05164,891,578 - 164,891,677RGD_MAPPER_PIPELINERnor6.0
Rnor_5.05168,546,202 - 168,556,520RGD_MAPPER_PIPELINERnor5.0
RGSC_v3.45165,154,252 - 165,164,570RGD_MAPPER_PIPELINERGSC3.4






References

References - curated
# Reference Title Reference Citation
1. Identifying multiple causative genes at a single GWAS locus. Flister MJ, etal., Genome Res. 2013 Dec;23(12):1996-2002. doi: 10.1101/gr.160283.113. Epub 2013 Sep 4.
2. Knockout rats via embryo microinjection of zinc-finger nucleases. Geurts AM, etal., Science. 2009 Jul 24;325(5939):433.
3. PhysGen Knockouts PhysGen Knockout strains
4. RGD Strain RSO annotation pipeline RGD Automated Pipelines

Region

Allelic Variants
Name Chromosome Start Pos End Pos Reference Nucleotide Variant Nucleotide Variant Type Assembly
Agtrapem8Mcwi-var1 chr5 164891578 164891677 GGCAGATGAGGGGCCCACGGATGGAGCCACCTCCCCACCGCCAACTCACCATGCCAATGGCATCAACAGAGTCCCGCTGGGCCACAGCCCACACACCCAG - deletion Rnor_6.0

Additional Information


Nomenclature History
Date Current Symbol Current Name Previous Symbol Previous Name Description Reference Status
2014-03-26 SS-Agtrapem8Mcwi    SS-Agtrapem8Mcwi    Symbol updated 68687 APPROVED
2014-03-26 SS-Agtrapem8Mcwi    SS-Agtrapem8Mcwi    Symbol updated 68687 APPROVED
2014-03-26 SS-Agtrapem8Mcwi    SS-Agtrapem8Mcwi    Name updated 68913 APPROVED
2014-03-26 SS-Agtrapem8Mcwi    SS-Agtrapem8Mcwi    Name updated 68913 APPROVED
2013-08-14 SS-Agtrapem8Mcwi    SS-Agtrapem8Mcwi    Name updated 68913 APPROVED
2013-08-14 SS-Agtrapem8Mcwi    SS-Agtrapem8Mcwi    Name updated 68913 APPROVED