Hoxd9 Marker Search Result - Rat Genome Database

Send us a Message



Submit Data |  Help |  Video Tutorials |  News |  Publications |  Download |  REST API |  Citing RGD |  Contact   

Marker: Hoxd9

Symbol: Hoxd9
Also known as:
RGD ID: 5087945
Expected Size: 214 (bp)
Position
Rat AssemblyChrPosition (strand)SourceJBrowse
mRatBN7.2359,596,750 - 59,596,964 (+)MAPPER
Rnor_6.0361,616,368 - 61,616,581NCBIRnor6.0
Rnor_5.0368,082,704 - 68,082,917UniSTSRnor5.0
RGSC_v3.4357,308,299 - 57,308,512UniSTSRGSC3.4
Celera359,118,565 - 59,118,778UniSTS
Cytogenetic Map3q23UniSTS
Is Marker For: Genes:   Hoxd10  


Annotation


References - curated
1. RGD automated pipelines

Strains and Sequence

Sequence
 
Forward Primer CAATTGGCTCACTGCAAAGA
Reverse Primer TCGATTCTCTCGGCTCATCT
 

Region

Nucleotide Sequences
RefSeq Transcripts NM_001107094 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles


Additional Information

Database Acc Id Source(s)
NCBI Gene 303991 UniSTS
UniSTS 143400 UniSTS