AI104522 Marker Search Result - Rat Genome Database

Send us a Message
Submit Data |  Help |  Video Tutorials |  News |  Publications |  Download |  REST API |  Citing RGD |  Contact   
Search RGD Grant Resources Citing RGD About Us Contact Us
Genes Variants Community Projects QTLs Strains Markers Genome Information Ontologies Cell Lines References Download Submit Data
OntoMate (Literature Search) JBrowse (Genome Browser) Synteny Browser (VCMap) Variant Visualizer Multi-Ontology Enrichment (MOET) Gene-Ortholog Location Finder (GOLF) InterViewer (Protein-Protein Interactions) PhenoMiner (Quatitative Phenotypes) Gene Annotator OLGA (Gene List Generator) AllianceMine GViewer (Genome Viewer)
Aging & Age-Related Disease Cancer & Neoplastic Disease Cardiovascular Disease Coronavirus Disease Developmental Disease Diabetes Hematologic Disease Immune & Inflammatory Disease Infectious Disease Liver Disease Neurological Disease Obesity & Metabolic Syndrome Renal Disease Respiratory Disease Sensory Organ Disease
Find Models Genetic Models Autism Models Rat PhenoMiner (Quantitative Phenotypes) Chinchilla PhenoMiner Expected Ranges (Quantitative Phenotype) PhenoMiner Term Comparison Hybrid Rat Diversity Panel Phenotypes Phenotypes in Other Animal Models Animal Husbandry Strain Medical Records Phylogenetics Strain Availability Calendar Rats 101 Submissions Photo Archive
Pathways
Rat Community Forum Directory of Rat Laboratories Video Tutorials News RGD Publications RGD Presentations Archive Nomenclature Guidelines Resource Links Laboratory Resources Employment Resources
Advanced Search (OLGA)

Marker: AI104522

Symbol: AI104522
Previously known as:
RGD ID: 5084994
Expected Size: 231 (bp)
Position
Rat AssemblyChrPosition (strand)SourceJBrowse
mRatBN7.24181,956,766 - 181,956,997 (+)MAPPERmRatBN7.2
Rnor_6.04183,470,161 - 183,470,391NCBIRnor6.0
Rnor_5.04247,598,660 - 247,598,890UniSTSRnor5.0
Celera4170,424,513 - 170,424,743UniSTS
RH 3.4 Map41125.62UniSTS
Is Marker For: Genes:   Dennd5b  


Annotation


References - curated
# Reference Title Reference Citation
1. UniSTS Pipeline RGD automated pipelines

Strains and Sequence

Sequence
 
Forward Primer AAACCCATGTCAGTTTGTCTGG
Reverse Primer CTCATGCTACACTTGAGCCACA
 

Region



QTLs in Region (mRatBN7.2)
The following QTLs overlap with this region.    Full Report CSV TAB Printer Gviewer
RGD IDSymbolNameLODP ValueTraitSub TraitChrStartStopSpecies
6478754Anxrr43Anxiety related response QTL 430.14035locomotor behavior trait (VT:0001392)distance moved per unit of time into, out of or within a discrete space in an experimental apparatus (CMO:0001493)4144639524182687754Rat
6478693Anxrr32Anxiety related response QTL 320.00092locomotor behavior trait (VT:0001392)measurement of voluntary locomotion into, out of or within a discrete space in an experimental apparatus (CMO:0000957)4144639524182687754Rat
10401796Kidm48Kidney mass QTL 48kidney mass (VT:0002707)both kidneys wet weight (CMO:0000085)4145568712182687754Rat
6478718Anxrr34Anxiety related response QTL 340.00896locomotor behavior trait (VT:0001392)amount of experiment time spent in a discrete space in an experimental apparatus (CMO:0000958)4144639524182687754Rat
6478748Anxrr42Anxiety related response QTL 420.28008locomotor behavior trait (VT:0001392)amount of experiment time spent in a discrete space in an experimental apparatus (CMO:0000958)4144639524182687754Rat
6478700Anxrr33Anxiety related response QTL 330.00896locomotor behavior trait (VT:0001392)amount of experiment time spent in a discrete space in an experimental apparatus (CMO:0000958)4144639524182687754Rat
1300109Rf13Renal function QTL 133.91renal blood flow trait (VT:2000006)absolute change in renal blood flow rate (CMO:0001168)4157710145182687754Rat
10053718Scort25Serum corticosterone level QTL 252.150.0097blood corticosterone amount (VT:0005345)plasma corticosterone level (CMO:0001173)4155561574182687754Rat


Additional Information

Database Acc Id Source(s)
NCBI Gene 100365679 UniSTS