PMC140661P1 Marker Search Result - Rat Genome Database

Advanced Search (OLGA)

General

Marker: PMC140661P1

Symbol:

PMC140661P1

Previously known as:

RGD ID:

5066296

Expected Size:

188 (bp)

Position

Rat Assembly	Chr	Position (strand)	Source	JBrowse
mRatBN7.2	15	25,023,727 - 25,023,915 (+)	MAPPER	mRatBN7.2
Rnor_6.0	15	28,730,854 - 28,731,041	NCBI	Rnor6.0
Rnor_5.0	15	32,541,055 - 32,541,242	UniSTS	Rnor5.0
RGSC_v3.4	15	27,764,514 - 27,764,701	UniSTS	RGSC3.4
Celera	15	25,327,874 - 25,328,061	UniSTS
Cytogenetic Map	15	p14	UniSTS

Is Marker For:

Genes: Sall2

#	Reference Title	Reference Citation
1.	UniSTS Pipeline	RGD automated pipelines


Forward Primer	CACATTTCGTGGGTCACAAG
Reverse Primer	CTCAGAGCTGTTTTCCTGGG

The following Genes overlap with this region.

RGD ID	Symbol	Name	Chr	Start	Stop	Species
1309272	Sall2	spalt-like transcription factor 2	15	25021345	25038918	Rat


RefSeq Transcripts	NM_001107262	(Get FASTA)	NCBI Sequence Viewer	Search GEO for Microarray Profiles

The following QTLs overlap with this region.

RGD ID	Symbol	Name	LOD	P Value	Trait	Sub Trait	Chr	Start	Stop	Species
1331729	Rf42	Renal function QTL 42	3.071		kidney blood vessel physiology trait (VT:0100012)	absolute change in renal blood flow rate (CMO:0001168)	15	17362897	73690657	Rat
1641887	Alcrsp14	Alcohol response QTL 14			response to alcohol trait (VT:0010489)	brain neurotensin receptor 1 density (CMO:0002068)	15	1	42356671	Rat
10755503	Bp391	Blood pressure QTL 391	2.37		arterial blood pressure trait (VT:2000000)	systolic blood pressure (CMO:0000004)	15	20248600	37896129	Rat
1578646	Bmd18	Bone mineral density QTL 18	5.2		femur mineral mass (VT:0010011)	trabecular volumetric bone mineral density (CMO:0001729)	15	22806240	98288169	Rat
9589149	Insul29	Insulin level QTL 29	9.06	0.001	blood insulin amount (VT:0001560)	plasma insulin level (CMO:0000342)	15	1	34723002	Rat
1578647	Bmd17	Bone mineral density QTL 17	4		femur mineral mass (VT:0010011)	total volumetric bone mineral density (CMO:0001728)	15	22806240	98288169	Rat
10401805	Kidm51	Kidney mass QTL 51			kidney mass (VT:0002707)	both kidneys wet weight (CMO:0000085)	15	306329	45306329	Rat
2317750	Glom26	Glomerulus QTL 26	4.3		urine protein amount (VT:0005160)	urine protein level (CMO:0000591)	15	12496141	65205939	Rat
2298549	Neuinf12	Neuroinflammation QTL 12	3.5		nervous system integrity trait (VT:0010566)	spinal cord beta-2 microglobulin mRNA level (CMO:0002125)	15	1	55302115	Rat
8552920	Pigfal8	Plasma insulin-like growth factor 1 level QTL 8	3		blood insulin-like growth factor amount (VT:0010479)	plasma insulin-like growth factor 1 level (CMO:0001299)	15	1	34723002	Rat
2293688	Bss29	Bone structure and strength QTL 29	5.31	0.0001	femur morphology trait (VT:0000559)	femur midshaft cortical cross-sectional area (CMO:0001663)	15	11111142	56111142	Rat
5685002	Bss103	Bone structure and strength QTL 103	2.8		tibia strength trait (VT:1000284)	tibia total energy absorbed before break (CMO:0001736)	15	14481165	28469888	Rat
8694361	Abfw6	Abdominal fat weight QTL 6	10.2	0.001	visceral adipose mass (VT:0010063)	abdominal fat pad weight to body weight ratio (CMO:0000095)	15	1	34723002	Rat
631273	Lecl2	Lens clarity QTL 2		0.001	lens clarity trait (VT:0001304)	age of onset/diagnosis of cataract (CMO:0001584)	15	10596089	55596089	Rat
2300167	Bmd63	Bone mineral density QTL 63	5.9	0.0001	femur mineral mass (VT:0010011)	volumetric bone mineral density (CMO:0001553)	15	11111142	56111142	Rat
731170	Pur3	Proteinuria QTL 3	2.3	0.0005	urine protein amount (VT:0005160)	urine protein excretion rate (CMO:0000759)	15	1	41686771	Rat
738017	Hcas7	Hepatocarcinoma susceptibility QTL 7	2.91		liver integrity trait (VT:0010547)	liver nonremodeling tumorous lesion volume to total liver volume ratio (CMO:0001464)	15	2266368	46921453	Rat
10054130	Srcrt8	Stress Responsive Cort QTL 8	2.18	0.0085	blood corticosterone amount (VT:0005345)	plasma corticosterone level (CMO:0001173)	15	22117933	67117933	Rat
2300173	Bmd62	Bone mineral density QTL 62	12.8	0.0001	lumbar vertebra mineral mass (VT:0010511)	volumetric bone mineral density (CMO:0001553)	15	11111142	56111142	Rat
2324620	Coatc3	Coat color QTL 3			coat/hair pigmentation trait (VT:0010463)	pigmented coat/hair area to total coat/hair area ratio (CMO:0001810)	15	19856566	46187442	Rat
61424	Scl1	Serum cholesterol level QTL 1	7.7	0.001	blood cholesterol amount (VT:0000180)	serum total cholesterol level (CMO:0000363)	15	16725528	80672115	Rat
1582251	Gluco24	Glucose level QTL 24	3.2	0.0008	blood glucose amount (VT:0000188)	blood glucose level (CMO:0000046)	15	5530756	50530756	Rat
1354657	Despr13	Despair related QTL 13		0.0022	locomotor behavior trait (VT:0001392)	amount of experiment time spent in a discrete space in an experimental apparatus (CMO:0000958)	15	1	29912054	Rat
631550	Bw7	Body weight QTL 7	3.6		body mass (VT:0001259)	body weight (CMO:0000012)	15	19856566	34924750	Rat
1578660	Bss19	Bone structure and strength QTL 19	4.3		femur morphology trait (VT:0000559)	bone trabecular cross-sectional area (CMO:0002311)	15	22806240	98288169	Rat

Database	Acc Id	Source(s)
NCBI Gene	305854	UniSTS

Gene Annotator (Functional Annotation) unavailable	Gene Annotator (Annotation Distribution) unavailable	Variant Visualizer (Genomic Variants) unavailable


InterViewer (Protein-Protein Interactions) unavailable	Gviewer (Genome Viewer) unavailable	Variant Visualizer (Damaging Variants) unavailable


Gene Annotator (Annotation Comparison) unavailable	OLGA (Gene List Generator) unavailable
		Excel (Download)

MOET (Multi-Ontology Enrichement) unavailable	GOLF (Gene-Ortholog Location Finder) unavailable

Create Name:

Description:

Send us a Message

Marker: PMC140661P1