RH142505 Marker Search Result - Rat Genome Database

Send us a Message



Submit Data |  Help |  Video Tutorials |  News |  Publications |  Download |  REST API |  Citing RGD |  Contact   

Marker: RH142505

Symbol: RH142505
Previously known as: AI058910; 
RGD ID: 5053189
Expected Size: 122 (bp)
Position
Rat AssemblyChrPosition (strand)SourceJBrowse
mRatBN7.2X66,351,680 - 66,351,802 (+)MAPPERmRatBN7.2
Rnor_6.0X71,122,072 - 71,122,193NCBIRnor6.0
Rnor_5.0X71,974,150 - 71,974,271UniSTSRnor5.0
RGSC_v3.4X89,297,680 - 89,297,801UniSTSRGSC3.4
CeleraX66,707,601 - 66,707,722UniSTS
Cytogenetic MapXq31UniSTS
Is Marker For: Genes:   Snx12  


Annotation


References - curated
# Reference Title Reference Citation
1. UniSTS Pipeline RGD automated pipelines

Strains and Sequence

Sequence
 
Forward Primer GCAGCCTCATCTGAAGGAAC
Reverse Primer CAAGCCAGGCACTCAACATA
 

Region

Genes in Region
The following Genes overlap with this region.    Full Report CSV TAB Printer Analysis Tools
RGD IDSymbolNameChrStartStopSpecies
1565585Snx12sorting nexin 12X6622699566356945Rat

Nucleotide Sequences
GenBank Nucleotide CH473966 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  CM000251 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles


QTLs in Region (mRatBN7.2)
The following QTLs overlap with this region.    Full Report CSV TAB Printer Gviewer
RGD IDSymbolNameLODP ValueTraitSub TraitChrStartStopSpecies
61430Cia18Collagen induced arthritis QTL 183.1joint integrity trait (VT:0010548)joint inflammation composite score (CMO:0000919)X14843113120568734Rat
61431Cia19Collagen induced arthritis QTL 194.4joint integrity trait (VT:0010548)joint inflammation composite score (CMO:0000919)X65612192120568734Rat
738035Stresp1Stress response QTL 14.960.000011stress-related behavior trait (VT:0010451)defensive burying - copingX41304447112935181Rat
1598837Memor13Memory QTL 133.2exploratory behavior trait (VT:0010471)difference between time of physical contact/close proximity of test subject and social stimulus during sample phase and test phase (CMO:0002678)X41052407146860749Rat


Additional Information

Database Acc Id Source(s)
NCBI Gene 363478 UniSTS