RH128057 Marker Search Result - Rat Genome Database

Send us a Message



Submit Data |  Help |  Video Tutorials |  News |  Publications |  Download |  REST API |  Citing RGD |  Contact   

Marker: RH128057

Symbol: RH128057
Also known as:
RGD ID: 5040044
Expected Size: 196 (bp)
Position
Rat AssemblyChrPosition (strand)SourceJBrowse
mRatBN7.2467,328,991 - 67,329,187 (+)MAPPER
mRatBN7.247,315,900 - 7,316,096 (+)MAPPER
mRatBN7.247,315,900 - 7,316,096 (-)MAPPER
mRatBN7.2467,328,991 - 67,329,187 (-)MAPPER
Rnor_6.0466,334,547 - 66,334,742NCBIRnor6.0
Rnor_6.04350,130 - 350,325NCBIRnor6.0
Rnor_5.04345,217 - 345,412UniSTSRnor5.0
Rnor_5.0466,146,027 - 66,146,222UniSTSRnor5.0
RGSC_v3.4466,162,400 - 66,162,595UniSTSRGSC3.4
RGSC_v3.442,577,658 - 2,577,853UniSTSRGSC3.4
Celera42,964,607 - 2,964,802UniSTS
Celera462,346,611 - 62,346,806UniSTS
Cytogenetic Map4q11UniSTS
Cytogenetic Map4q22UniSTS
Is Marker For: Genes:   Insig1   Luc7l2   LOC100909424  


Annotation


References - curated
1. RGD automated pipelines

Strains and Sequence

Sequence
 
Forward Primer CCATTCCAAAGTCTAGAACAACCC
Reverse Primer CTGACTTGGTGAGGCAGTCATT
 

Region

Genes in Region
The following Genes overlap with this region.    Full Report CSV TAB Printer Analysis Tools
RGD IDSymbolNameChrStartStopSpecies
2481Cyp51cytochrome P450, family 5142717556427194018Rat
2506Dlx5distal-less homeobox 543238774132392085Rat
2512Dync1i1dynein cytoplasmic 1 intermediate chain 143080775531121097Rat
3082MetMET proto-oncogene, receptor tyrosine kinase44474746744854628Rat
68402Dpp6dipeptidyl peptidase like 6440210214943675Rat
3553Relnreelin493475339774257Rat
2744Grm3glutamate metabotropic receptor 342131676121567561Rat
3846Tfectranscription factor EC44406353344136815Rat
3726Smosmoothened, frizzled class receptor45701994157041779Rat
69061Pdk4pyruvate dehydrogenase kinase 443054677230556774Rat
2256Cald1caldesmon 146210394862291375Rat
70966Dmtf1cyclin D binding myb-like transcription factor 142186229721902798Rat
3444Ptnpleiotrophin46423915664330996Rat
3318Abcb1bATP-binding cassette, subfamily B (MDR/TAP), member 1B42222512322307577Rat
2794Hgfhepatocyte growth factor41543546015505377Rat
70908Crotcarnitine O-octanoyltransferase42207983722116265Rat
620062Pon1paraoxonase 143024974930276297Rat
3455Ptprz1protein tyrosine phosphatase, receptor type Z144994104650140764Rat
620023Chrm2cholinergic receptor, muscarinic 246408902864091090Rat
70514Cdk5cyclin-dependent kinase 5472829457287427Rat
3711Slc4a2solute carrier family 4 member 2472646777282355Rat
68393Kcnd2potassium voltage-gated channel subfamily D member 244830928348816804Rat
3218Nxph1neurexophilin 143495972135281017Rat
69406Pclopiccolo (presynaptic cytomatrix protein)41645490417058921Rat
3600Rps4x-ps9ribosomal protein S4, X-linked, pseudogene 943572961935730535Rat
3807Tac1tachykinin, precursor 143363885333646819Rat
621878Podxlpodocalyxin-like45882904958893353Rat
621346Wnt2Wnt family member 244528684545332899Rat
727939Sema3dsemaphorin 3D41922437819413519Rat
621351Col1a2collagen type I alpha 2 chain43153422531569152Rat
621278Arf5ADP-ribosylation factor 545571574455718670Rat
621297Pmpcbpeptidase, mitochondrial processing subunit beta499088389921615Rat
621414Kcnh2potassium voltage-gated channel subfamily H member 2473550667387282Rat
621318Mterf1mitochondrial transcription termination factor 142736531027372374Rat
620383Calucalumenin45662561156653112Rat
620076Mkln1muskelin 145869338458817924Rat
727782Prkag2protein kinase AMP-activated non-catalytic subunit gamma 2465591536799888Rat
620408N5DNA binding protein N545758872457590923Rat
620248Abcb4ATP binding cassette subfamily B member 442213398422192687Rat
3000Lepleptin45633769556351818Rat
628691Cttnbp2cortactin binding protein 244293289743096454Rat
628724LipogeninLipogenin45603344856034703Rat
620257Akr1b7aldo-keto reductase family 1, member B746185025661879733Rat
61916Fzd1frizzled class receptor 142647086426475262Rat
61919Slc13a1solute carrier family 13 member 145112178451199477Rat
620547Spam1sperm adhesion molecule 145219420152204369Rat
628694Zc3hav1zinc finger CCCH-type containing, antiviral 146601211166062160Rat
735018Bpgmbisphosphoglycerate mutase46191221061940697Rat
620735Tas2r118taste receptor, type 2, member 11845100221851003117Rat
3428Psmc2proteasome 26S subunit, ATPase 2498671329881383Rat
3155Ndufa5NADH:ubiquinone oxidoreductase subunit A545159041351598771Rat
621001Calcrcalcitonin receptor42862743928702559Rat
620433Pax4paired box 445573564055753461Rat
619806Mtpnmyotrophin46301200963039422Rat
2203Bet1Bet1 golgi vesicular membrane trafficking protein42908236829092638Rat
708578Asic3acid sensing ion channel subunit 3472878687293295Rat
621465Ica1islet cell autoantigen 143463550934780187Rat
620524Dnajc2DnaJ heat shock protein family (Hsp40) member C2498815059908693Rat
619848Gpr37G protein-coupled receptor 3745182216351844228Rat
619858Grm8glutamate metabotropic receptor 845447434455409526Rat
1303148ST7suppression of tumorigenicity 744500022345247793Rat
1307050Steap2STEAP2 metalloreductase42550660425527088Rat
1307054Pus7pseudouridine synthase 7478897277931357Rat
619951Abcb1aATP binding cassette subfamily B member 1A42233982922517642Rat
620348Cav2caveolin 244457326444580640Rat
620170Fgl2fibrinogen-like 241032359810329241Rat
2332CftrCF transmembrane conductance regulator44269326342860679Rat
1303037Tmem106btransmembrane protein 106B43951767939534491Rat
628629Tfpi2tissue factor pathway inhibitor 242894795128953261Rat
727817Gnat3G protein subunit alpha transducin 341382776413878126Rat
2280Cav1caveolin 144459712344630206Rat
2901Il6interleukin 6430432313047807Rat
2247Cacna2d1calcium voltage-gated channel auxiliary subunit alpha2delta 141570697416130848Rat
1303047Fscn3fascin actin-bundling protein 345571997655729442Rat
1304942Abcf2ATP binding cassette subfamily F member 2471228507135607Rat
1302965Pon3paraoxonase 343031198130338679Rat
708475Akr1b8aldo-keto reductase family 1, member B846177206461784637Rat
620894Ptpn12protein tyrosine phosphatase, non-receptor type 1241063112910702390Rat
3673Shhsonic hedgehog signaling molecule4718538727691Rat
621105C1galt1core 1 synthase, glycoprotein-N-acetylgalactosamine 3-beta-galactosyltransferase, 143389035333943219Rat
2162Asnsasparagine synthetase (glutamine-hydrolyzing)43374287633761106Rat
620752Akr1d1aldo-keto reductase family 1, member D146511070665143930Rat
621515Gng11G protein subunit gamma 1142898917028994610Rat
620833Akap9A-kinase anchoring protein 942719534627331582Rat
621033Opn1swopsin 1, short wave sensitive45665384056656980Rat
1304603Nrf1nuclear respiratory factor 145733573257445317Rat
735193Fam3cFAM3 metabolism regulating signaling molecule C44938896249439892Rat
621791Exoc4exocyst complex component 446054912861358305Rat
2301Cd36CD36 molecule41415030914191498Rat
1306810Rpa3replication protein A343427932034282351Rat
71011Gpr85G protein-coupled receptor 8544037770540387147Rat
621121Cdk6cyclin-dependent kinase 642778172827969653Rat
3657Sema3asemaphorin 3A41817037518545190Rat
1306271RGD1306271similar to KIAA1549 protein46583493365962722Rat
1305854Dbf4DBF4 zinc finger42289852722914091Rat
1306012Klf14Kruppel-like factor 1445824787658250798Rat
1305915Armc10armadillo repeat containing 1041000484610020017Rat
69334Slc26a5solute carrier family 26 member 5497958119860904Rat
632280Ppp1r9aprotein phosphatase 1, regulatory subunit 9A42997648530247371Rat
2388Cpa1carboxypeptidase A145795298257959109Rat
1305697Hepacam2HEPACAM family member 242840286228437722Rat
1308547Crygncrystallin, gamma N469008116909167Rat
735197NapepldN-acyl phosphatidylethanolamine phospholipase D4996532310004650Rat
1306040Creb3l2cAMP responsive element binding protein 3-like 246486928564981519Rat
1305563Cpa2carboxypeptidase A245785541657879239Rat
1305564Klhl7kelch-like family member 7475328817582032Rat
1305107Srpk2SRSF protein kinase 2479940258187455Rat
1303098Cpa5carboxypeptidase A545792533457945069Rat
621840RhebRas homolog, mTORC1 binding468274296873384Rat
1306404Chpf2chondroitin polymerizing factor 2471084617113940Rat
1305143Sdhaf3succinate dehydrogenase complex assembly factor 343254170632558798Rat
1305055Atp6v0a4ATPase H+ transporting V0 subunit a446573658565821916Rat
727860Asb15ankyrin repeat and SOCS box containing 1545159881551642276Rat
1304751Vps50VPS50 subunit of EARP/GARPII complex42844125528551784Rat
708457Insig1insulin induced gene 14342302350515Rat
735144WaslWASP like actin nucleation promoting factor45167772251726212Rat
1307778Tmem168transmembrane protein 16844000636240041129Rat
1333563Olr987olfactory receptor 98741356487913565838Rat
1305929Krit1KRIT1, ankyrin repeat containing42743860927473150Rat
735049Dgkidiacylglycerol kinase, iota46436511564831473Rat
1306697Wdr91WD repeat domain 9146239807362438958Rat
1305544Cdk14cyclin-dependent kinase 1442582556726419443Rat
1308774Slc25a40solute carrier family 25, member 4042261970022661685Rat
2713Gnai1G protein subunit alpha i141340513613486866Rat
1305878Gtpbp10GTP binding protein 1042563576525653283Rat
3186Nos3nitric oxide synthase 3473219087342404Rat
1306302Fam133bfamily with sequence similarity 133, member B42772888327755182Rat
1333908Olr1244olfactory receptor 1244415770251585015Rat
1310447Irf5interferon regulatory factor 545680447756816271Rat
1333936Olr1250olfactory receptor 1250416582781659210Rat
1311102Tspan12tetraspanin 1244885282348953240Rat
1311108Impdh1inosine monophosphate dehydrogenase 145647838356493987Rat
1303201Sgcesarcoglycan, epsilon42972614029769902Rat
1333213Olr1251olfactory receptor 1251416712691672198Rat
1308938Tnpo3transportin 345682002356897310Rat
1308939Tmem60transmembrane protein 6041081802410822879Rat
1308442Lsm8LSM8 homolog, U6 small nuclear RNA associated44555507745560943Rat
1332666Olr1232olfactory receptor 1232414362541437186Rat
1332667Olr1757-psolfactory receptor pseudogene 175743314004833140509Rat
1333512Olr1230olfactory receptor 1230414037331418528Rat
1333520Olr1231olfactory receptor 1231414309481431898Rat
1308013Fam180afamily with sequence similarity 180, member A46284505462860361Rat
1311869Smarcd3SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily d, member 3470767107108334Rat
1310751Agap3ArfGAP with GTPase domain, ankyrin repeat and PH domain 3472023307253386Rat
1333768Olr1233olfactory receptor 1233414478121448753Rat
1311543Steap1STEAP family member 142543588525446393Rat
1333764Olr1243olfactory receptor 1243415664481567380Rat
1311336Rbm28RNA binding motif protein 2845639876956438442Rat
1310722Ubn2ubinuclein 246616463966254297Rat
1333476Olr1248olfactory receptor 1248416257541626686Rat
1310325Chchd3coiled-coil-helix-coiled-coil-helix domain containing 346008053660358592Rat
1559727Lhfpl3LHFPL tetraspan subfamily member 3485375908994097Rat
1303194Hyal4hyaluronidase 445214764152166276Rat
621864Gbx1gastrulation brain homeobox 1471739617200752Rat
735120Tmub1transmembrane and ubiquitin-like domain containing 1472577527260318Rat
1310811Aassaminoadipate-semialdehyde synthase45015200550208935Rat
1332752Olr1786-psolfactory receptor pseudogene 178643312405633124695Rat
1333392Olr1249olfactory receptor 1249416403181641250Rat
1308651Luc7l2LUC7-like 2 pre-mRNA splicing factor46629031966357970Rat
1310973Sema3esemaphorin 3E41731474517594659Rat
1308432Miosmeiosis regulator for oocyte development43423837034264015Rat
1309413Nup205nucleoporin 20546270377962773931Rat
1308985Slc35b4solute carrier family 35 member B446155099561573003Rat
1309792Klhdc10kelch domain containing 1045771598257773800Rat
1308277Akr1b10aldo-keto reductase family 1 member B1046181326561830371Rat
1307547Paxip1PAX interacting protein 1439569314008326Rat
1308207Dnajb6DnaJ heat shock protein family (Hsp40) member B6427113292774969Rat
735097Galnt11polypeptide N-acetylgalactosaminyltransferase 11462972556330765Rat
1308748Rsbn1lround spermatid basic protein 1-like41074874510809142Rat
1308074Plxna4plexin A445943948959883637Rat
1309682Tmem209transmembrane protein 20945779633757823283Rat
1309343Sema3csemaphorin 3C41431827614490438Rat
1310318Cnot4CCR4-NOT transcription complex, subunit 446256144362663225Rat
1306626Tmbim7transmembrane BAX inhibitor motif containing 742760604927639025Rat
2092Akr1b1aldo-keto reductase family 1 member B46170686661720959Rat
1309641Kmt2elysine methyltransferase 2E481877518255578Rat
1309236Zc3hav1lzinc finger CCCH-type containing, antiviral 1 like46598882066003450Rat
1308287Rnf32ring finger protein 32420532832113917Rat
1310651Rbm33RNA binding motif protein 334592616700903Rat
1307655Abcb8ATP binding cassette subfamily B member 8472965387311856Rat
1311601FastkFas-activated serine/threonine kinase472605217264590Rat
1308226Lrgukleucine-rich repeats and guanylate kinase domain containing46141998761544748Rat
1308807Flncfilamin C45671093456738779Rat
1309954Pon2paraoxonase 243034470530380119Rat
1310593Phtf2putative homeodomain transcription factor 241082319110938273Rat
1309532MdficMyoD family inhibitor domain containing44220254642282499Rat
1310556Ing3inhibitor of growth family, member 344901723549044450Rat
1563910Lmbr1limb development membrane protein 1421160942274111Rat
1564789Iqca1lIQ motif containing with AAA domain 1 like471446747157106Rat
1564680Col28a1collagen type XXVIII alpha 1 chain43404807434198558Rat
1562034Cep41centrosomal protein 4145796678358006931Rat
1560480Fezf1Fez family zinc finger 145030928150312608Rat
1563091Samd9sterile alpha motif domain containing 942830496728324637Rat
1359715Slc13a4solute carrier family 13 member 446279673262841053Rat
1562178RGD1562178similar to Adenylate kinase 244391532743916115Rat
1560448LOC500028hypothetical protein LOC50002843588955035890224Rat
1333059Olr1242olfactory receptor 1242415575991558534Rat
1564798RGD1564798similar to RIKEN cDNA 1300007B1242079976020858787Rat
1561995Agbl3AGBL carboxypeptidase 346229315862377740Rat
1561814Fam71f2family with sequence similarity 71, member F245655654556567350Rat
1334345Olr988-psolfactory receptor pseudogene 98841358489813585844Rat
1563349Elapor2endosome-lysosome associated apoptosis and autophagy regulator family member 242156384821757668Rat
1561312Ppp1r3aprotein phosphatase 1, regulatory subunit 3A44117148641212116Rat
1561363Ttc26tetratricopeptide repeat domain 2646609017866147998Rat
1560915Tspan33tetraspanin 3345698128357005866Rat
1334358Olr906olfactory receptor 90641361012513611059Rat
1562351Tmem243transmembrane protein 24342190280321920651Rat
1565889Slc25a13solute carrier family 25 member 1343113416531757006Rat
1565400RGD1565400similar to actin 3 - fruit fly (Drosophila melanogaster) (fragments)43559326335594530Rat
1564345Tex47testis expressed 4742371467423719731Rat
1566237RGD1566237similar to 60S ribosomal protein L3543226266132263020Rat
1560026Lrrc4leucine rich repeat containing 445611065856114254Rat
1561836Scand3-ps2SCAN domain containing 3, pseudogene 242947734029477882Rat
1561223Vwdevon Willebrand factor D and EGF domains43963255539711430Rat
1565759Actr3bactin related protein 3B456442875672708Rat
1562992RGD1562992similar to heterogeneous nuclear ribonucleoprotein A2/B142807482628076014Rat
1563238Cyrencell cycle regulator of NHEJ46239177062397162Rat
1566227RGD1566227similar to RIKEN cDNA 2610101N1044313763843141049Rat
1563764Phf14PHD finger protein 1443824118938420199Rat
1560872RGD1560872similar to interferon induced transmembrane protein 2 (1-8D)42810153528101968Rat
1564459Ccdc136coiled-coil domain containing 13645667473756704501Rat
1561053Cldn12claudin 1242568156125692547Rat
1359489Nub1negative regulator of ubiquitin-like proteins 1469508706981400Rat
1559912RGD1559912similar to cytoskeleton associated protein 242991295729914969Rat
1564219Hyal6hyaluronoglucosaminidase 645212957652142241Rat
1564147Fam71f1family with sequence similarity 71, member F145659171956615157Rat
1559885Prrt4proline-rich transmembrane protein 445644259956453610Rat
1562696Pot1protection of telomeres 145188863251946764Rat
1560887Atg9bautophagy related 9B473143697322095Rat
1559986Ube3cubiquitin protein ligase E3C425059122606710Rat
621552Atp6v1fATPase H+ transporting V1 subunit F45674456356747657Rat
1561882LOC287992hypothetical LOC28799242041358920469951Rat
1562004Gatad1GATA zinc finger domain containing 142764700527658533Rat
631340Snd1staphylococcal nuclease and tudor domain containing 145577237756171669Rat
1334039Olr1235olfactory receptor 1235414707161471657Rat
1560934Nupl2nucleoporin like 2475123267529106Rat
1333788Olr1245olfactory receptor 1245415914441592376Rat
1559697Foxp2forkhead box P244136444141944685Rat
1562852Stra8stimulated by retinoic acid 846244772462474802Rat
1334104Olr1234olfactory receptor 1234414593631460304Rat
1561088Orc5origin recognition complex, subunit 5491600509223998Rat
1549770Capza2capping actin protein of muscle Z-line subunit alpha 244493629044972270Rat
1560596Trim24tripartite motif-containing 2446563227865684746Rat
1559535Ccdc146coiled-coil domain containing 14641026979810421724Rat
1310794Rbm48RNA binding motif protein 4842769831927708572Rat
1334055Olr1096olfactory receptor 1096418414471843062Rat
621855Magi2membrane associated guanylate kinase, WW and PDZ domain containing 241099524112472423Rat
1559939Pex1peroxisomal biogenesis factor 142765937627698037Rat
1559476Fmc1formation of mitochondrial complex V assembly factor 146627683566284868Rat
1564823Xrcc2X-ray repair cross complementing 2458420135860516Rat
1563055RGD1563055similar to transcription elongation factor B (SIII), polypeptide 246005412660054622Rat
1333698Olr1236olfactory receptor 1236414824861483421Rat
1562135Fam185afamily with sequence similarity 185, member A41021367910269999Rat
1334213Olr990olfactory receptor 99041364441613645351Rat
1560124RGD1560124similar to ribosomal protein L10a460228286023555Rat
1549759Tmem140transmembrane protein 14046238091462391913Rat
1562253Wnt16Wnt family member 1644936924649388156Rat
1560157Zfp800zinc finger protein 80045550264455527039Rat
1560165Lrrc17leucine rich repeat containing 1741010818410138652Rat
1563271Gsapgamma-secretase activating protein41042309010517887Rat
1559440Cadps2calcium dependent secretion activator 245032644750861161Rat
1560331Steap4STEAP4 metalloreductase42311268223135354Rat
1565355RGD1565355similar to fatty acid translocase/CD3641407170514112330Rat
1561842En2engrailed homeobox 24438668444508Rat
1565448LOC498971hypothetical protein LOC49897144793729847953573Rat
1586093LOC366309similar to suppressor of initiator codon mutations, related sequence 145920318659203589Rat
1566201Thsd7athrombospondin type 1 domain containing 7A43865851239103411Rat
1587329LOC362306hypothetical LOC362306499367289939856Rat
1583001LOC688906similar to splicing factor, arginine/serine-rich 2, interacting protein41791624817921313Rat
1584485Srisorcin42300465723029233Rat
1584092LOC688874similar to NEDD4-binding protein 1 (N4BP1)41782050117821594Rat
1583296Cnpy1canopy FGF signaling regulator 14474424496826Rat
1584730LOC681013similar to Stathmin (Phosphoprotein p19) (pp19) (Oncoprotein 18) (Op18) (Leukemia-associated phosphoprotein p18) (pp17) (Prosolin) (Metablastin) (Protein Pr22)43794564237946090Rat
1585861LOC680928similar to TGF beta-inducible nuclear protein 143553312635533912Rat
1584118Tsga13testis specific, 1345819542458216712Rat
1563546RGD1563546similar to dihydrofolate reductase430871413091473Rat
1584719Ndufa4NDUFA4, mitochondrial complex associated43823368038240848Rat
1585845Rbmxl1bRNA binding motif protein, X-linked-like 1B44218661242188294Rat
621579Asz1ankyrin repeat, SAM and basic leucine zipper domain containing 144535857445414177Rat
1587590Rundc3bRUN domain containing 3B42244372722589526Rat
1563537RGD1563537similar to ribosomal protein S941456703114567598Rat
1585825LOC680964similar to high mobility group nucleosomal binding domain 143675532336755912Rat
1563612Glcci1glucocorticoid induced 143428262534612709Rat
1561754RGD1561754similar to high mobility group protein homolog HMG442501133225011811Rat
1583498LOC681193similar to DNA-directed RNA polymerase II 7.6 kDa polypeptide (RPB10) (RPB7.6) (RPABC5)425120182514962Rat
1566215Copg2COPI coat complex subunit gamma 245806439458195242Rat
1563619Cpa4carboxypeptidase A445788384957907826Rat
1562906Fam126afamily with sequence similarity 126, member A476617107770179Rat
1563114Asb4ankyrin repeat and SOCS box-containing 443046167330501340Rat
1561099Zc3hc1zinc finger, C3HC-type containing 145768467857706613Rat
1560433Rint1RAD50 interactor 1478516027885446Rat
1561636RGD1561636similar to 60S ribosomal protein L3845901415259014462Rat
1564627RGD1564627similar to ribosomal protein L3846277571862776080Rat
1566346Testestin LIM domain protein44432188344360407Rat
1566053SvoplSVOP like46566716465733222Rat
1562636RGD1562636similar to protein phosphatase 1, regulatory (inhibitor) subunit 3B42072919720730050Rat
1564521Tas2r7ltaste receptor type 2 member 7-like43974744739748358Rat
1565361RGD1565361similar to male-enhanced antigen-242822035328225084Rat
1565588RGD1565588similar to calcium binding protein P22464774616479158Rat
1563491Cped1cadherin-like and PC-esterase domain containing 144905598849333729Rat
1566275Hyal5hyaluronoglucosaminidase 545223256552319777Rat
1562387RGD1562387similar to GTP-binding protein NGB43756394637597350Rat
1565435RGD1565435similar to Hmgb1 protein46054738360548089Rat
1562531Samd9lsterile alpha motif domain containing 9-like42834313628351062Rat
1583532LOC681159similar to Glucosamine 6-phosphate N-acetyltransferase (Phosphoglucosamine transacetylase) (Phosphoglucosamine acetylase) (EMeg32 protein)43972735039727953Rat
1565271Galntl5polypeptide N-acetylgalactosaminyltransferase-like 5463330496450137Rat
1564895Ahcyl2adenosylhomocysteinase-like 245705024157199870Rat
1561119Kcpkielin cysteine rich BMP regulator45675078256796878Rat
1561536Cct8l1chaperonin containing TCP1, subunit 8 (theta)-like 1460447446046680Rat
1565367RGD1565367similar to Solute carrier family 23, member 2 (Sodium-dependent vitamin C transporter 2)46248005862526724Rat
1566180Wdr86WD repeat domain 86469424156948912Rat
1564656LOC500035hypothetical protein LOC50003544016128540169564Rat
1564660Ankrd7ankyrin repeat domain 744556454245618932Rat
1561539Dlx6distal-less homeobox 643237309632377388Rat
1590212Tmem229atransmembrane protein 229A45234560552350624Rat
1590599LOC680561hypothetical protein LOC68056143200610632006806Rat
1591393Tomm7translocase of outer mitochondrial membrane 7478359497842790Rat
1593790LOC685467similar to 40S ribosomal protein S345022825350229080Rat
1591364LOC685649similar to inosine monophosphate dehydrogenase 245129654151298077Rat
1589636LOC499999similar to Glyceraldehyde-3-phosphate dehydrogenase (GAPDH) (38 kDa BFA-dependent ADP-ribosylation substrate) (BARS-38)42561270925613717Rat
1589637LOC499997similar to Proteasome activator complex subunit 2 (Proteasome activator 28-beta subunit) (PA28beta) (PA28b) (Activator of multicatalytic protease subunit 2) (11S regulator complex beta subunit) (REG-beta)42484229324843108Rat
1589639LOC499995similar to CD2-associated protein42428776724290252Rat
1589640Zfp804bzinc finger protein 804B42367889924236853Rat
1591728LOC680472similar to Villin-143053023930534871Rat
1592092Lmod2leiomodin 245155343951561135Rat
1585016Adam22ADAM metallopeptidase domain 2242286448523002969Rat
1588434LOC500081hypothetical LOC50008146382510263827023Rat
1588437Strip2striatin interacting protein 245720485057248912Rat
1588440LOC500044similar to 60S ribosomal protein L7a44749661447499507Rat
1588441Bmt2base methyltransferase of 25S rRNA 2 homolog44006413140136074Rat
1588443LOC500021similar to Glyceraldehyde-3-phosphate dehydrogenase (GAPDH)43209976532100420Rat
1588444LOC500013similar to sterile alpha motif domain containing 9-like43123431431235711Rat
1588445LOC500007similar to EF hand calcium binding domain 142770821227728730Rat
1588091Mnx1motor neuron and pancreas homeobox 1423763502381308Rat
1588109Nom1nucleolar protein with MIF4G domain 1423400342356427Rat
1587202LOC502730similar to Pyruvate kinase isozymes M1/M2 (Pyruvate kinase muscle isozyme)43935804039364054Rat
1587205Kmt2clysine methyltransferase 2C460836506294413Rat
1562922Asb10ankyrin repeat and SOCS box-containing 10471582937167505Rat
1559502Ssmem1serine-rich single-pass membrane protein 145782341157833706Rat
1587791LOC685984similar to H3 histone, family 3B45553941755539866Rat
1562785Lrrd1leucine-rich repeats and death domain containing 142740329927432649Rat
1561560RGD1561560similar to Gpd1l protein470517807055113Rat
1588121LOC682046similar to ribosomal protein L24-like423111242311607Rat
1588841LOC688447hypothetical protein LOC68844741333975913340302Rat
1590628Sem1SEM1 26S proteasome subunit43206744432087600Rat
1597981LOC681293similar to heterogeneous nuclear ribonucleoprotein A344067755240678639Rat
1598055LOC681216similar to methionine adenosyltransferase II, alpha431221233123787Rat
1595475Gngt1G protein subunit gamma transducin 142897233928975419Rat
1595574Peg10paternally expressed 1042979552429804517Rat
1597088Ankib1ankyrin repeat and IBR domain containing 142747347727597206Rat
1596938LOC678746hypothetical protein LOC67874642348778123680480Rat
1595417Rnf148ring finger protein 14845068715950693869Rat
1597444LOC689042hypothetical protein LOC68904245936519959371603Rat
1596912Casd1CAS1 domain containing 142963828029693151Rat
1594589Mestmesoderm specific transcript45805278658063227Rat
1588764LOC689724similar to High mobility group protein 1 (HMG-1) (High mobility group protein B1) (Amphoterin) (Heparin-binding protein p30)46544306965443710Rat
1588991LOC685895similar to Thymidine kinase, cytosolic45341511153423760Rat
1589400LOC680676hypothetical protein LOC68067643266628732666721Rat
1594818LOC689234similar to catechol-O-methyltransferase domain containing 146140391361405345Rat
1588740Tmem213transmembrane protein 21346580041065823205Rat
1591053Stmp1short transmembrane mitochondrial protein 146278059662790428Rat
1594775LOC689277hypothetical protein LOC68927746165373561654284Rat
1590185LOC685783similar to suppressor of variegation 3-9 homolog 245268205252682731Rat
1596695Rnf133ring finger protein 13345068184350686216Rat
1596704LOC681386similar to TGF beta-inducible nuclear protein 1 (L-name-related protein 42) (LNR42)418537551854564Rat
1595049LOC685399similar to tumor protein, translationally-controlled 144973809849738888Rat
1597712LOC685171similar to protein disulfide isomerase-associated 644585440345855621Rat
1642425Fbxl13F-box and leucine-rich repeat protein 1341002034910170012Rat
2314878Mir592microRNA 59245518237055182465Rat
2314881Mir653microRNA 65342865888228658978Rat
2314886Mir489microRNA 48942865952328659628Rat
2319823LOC100365047scavenger receptor class B, member 2-like41682545916836024Rat
2319288Ube2hubiquitin-conjugating enzyme E2H45751141857625147Rat
2319900Hilpdahypoxia inducible lipid droplet-associated45654760056550584Rat
2318720LOC100362163transmembrane emp24-like trafficking protein 10 (yeast)-like431000573100699Rat
2319954Gcc1GRIP and coiled-coil domain containing 145570804055719884Rat
2320107LOC100361458hypothetical LOC10036145845356293953563719Rat
2318988LOC100365492hypothetical LOC10036549241248647412490180Rat
2319013LOC100365467hypothetical LOC10036546746294867362950357Rat
2319566LOC100361708importin 7-like414876231490117Rat
2318488LOC100362297developmental pluripotency-associated protein 3-like426524002658202Rat
2322154LOC100360402hypothetical LOC10036040243736523037365987Rat
2322811LOC100363537ribosomal protein L10a-like460291906029932Rat
2322826LOC100363521hypothetical LOC10036352144041906940420713Rat
2322347LOC100360305hypothetical LOC10036030543598419735984770Rat
2323113LOC100359932hypothetical LOC10035993242828788628288760Rat
2322535LOC100360215hypothetical LOC10036021541616195316186117Rat
2323280LOC100359863hypothetical LOC10035986344982915049839240Rat
2322730LOC100360119dimethyladenosine transferase 1, mitochondrial-like41493726215066154Rat
2321181LOC100364378hypothetical LOC10036437844815971148160152Rat
2320473LOC100361290zinc finger, CCHC domain containing 10-like483597278360681Rat
2323464LOC100359776hypothetical LOC100359776465213296530112Rat
2323518LOC100359722mitochondrial transcription termination factor-like42706168527063692Rat
4145674IqubIQ motif and ubiquitin domain containing45148216951586881Rat
2323538LOC100359702cytochrome c oxidase, subunit VIc-like44893372548934347Rat
2323571LOC100363024hypothetical LOC100363024449324504933124Rat
2324469LOC100362586ribosomal protein L23-like46626137366261867Rat
2323857LOC100359436rCG25051-like44028446340285383Rat
2325362Mir879microRNA 87942167363521673710Rat
2325393Mir29amicroRNA 29a45834393158344018Rat
2325414Mir490microRNA 49046334294363343026Rat
2323949LOC100362829proteasome subunit alpha type-2-like42495870424959402Rat
2325456Mir129-1microRNA 129-145630172656301797Rat
2325494Mir671microRNA 671471087477108827Rat
2325560Mir183microRNA 18345746356957463678Rat
2325582Mir96microRNA 9645746336657463471Rat
2325591Mir29b1microRNA 29b-145834431058344390Rat
4888604Mir3556amicroRNA 3556a45834391958344036Rat
4888613Mir3553microRNA 355345746357257463677Rat
4888616Mir182microRNA 18245745977357459834Rat
2324581LOC100364673hypercoagulability-related protein-like475578457570579Rat
2324789LOC100359664mitochondrial transcription termination factor-like42704219527053700Rat
4888577Mir3587microRNA 358745834428358344345Rat
6486861LOC100912415olfactory receptor 150-like417516131752554Rat
6488535LOC100912227uncharacterized LOC10091222743233633632372156Rat
6489527LOC100912035tubulin beta chain-like44696383846967234Rat
6492128LOC10091160740S ribosomal protein S6-like42105091221053897Rat
6487344LOC100912371olfactory receptor 8B3-like417301641731126Rat
6490694LOC100911845olfactory receptor 143-like413714011372342Rat
6493676LOC100911252peptidyl-prolyl cis-trans isomerase A-like44000461740005358Rat
6490860LOC100911758olfactory receptor 143-like413556041356761Rat
6494620LOC100911141zinc finger CCCH-type antiviral protein 1-like42822814228230151Rat
6494850LOC100911179L-lactate dehydrogenase A chain-like43939107239392091Rat
6490196LOC100911888olfactory receptor 143-like414002801401242Rat
6490385LOC100911801olfactory receptor 143-like413637301364662Rat
6502346LOC100909675uncharacterized LOC100909675478186437822858Rat
6502443LOC100909693cell division cycle-associated 7-like protein-like426211642622376Rat
6496360Cfap69cilia and flagella associated protein 6942553851325611470Rat
6496913LOC10091070726S protease regulatory subunit 6B-like41366397413676110Rat
6500397LOC100910042HAUS augmin-like complex subunit 8-like431101433123981Rat
6497379LOC100910662myosin light polypeptide 6-like46183651561837745Rat
6497775LOC100910631DNA-(apurinic or apyrimidinic site) lyase-like41304036913041326Rat
6500943LOC100909926ribosome biogenesis protein NSA2 homolog41140099411402485Rat
7526246LOC102550307uncharacterized LOC10255030743399787334017610Rat
7526315LOC102554253uncharacterized LOC102554253466692956674887Rat
7531073LOC102556178uncharacterized LOC10255617844829983148309832Rat
7510286LOC102547203uncharacterized LOC10254720342553593825538443Rat
7532340LOC102555727quinone oxidoreductase-like protein 1-like498095329810736Rat
7512277LOC102550644uncharacterized LOC10255064444441986344572511Rat
7512304LOC102555859uncharacterized LOC10255585945118663051199658Rat
7515769LOC102554124uncharacterized LOC102554124468620396863267Rat
7536117LOC102555663uncharacterized LOC10255566342175771821759611Rat
7499773LOC102547122uncharacterized LOC10254712242304061023077020Rat
7503592LOC102548611uncharacterized LOC10254861145895583758971135Rat
7612072LOC102553883sterile alpha motif domain-containing protein 9-like43122754931229923Rat
7646743LOC102552661uncharacterized LOC10255266141766499317668815Rat
7632355LOC102548336developmental pluripotency-associated protein 4-like45883971658842244Rat
7666239LOC102556034uncharacterized LOC10255603441062357210628517Rat
7621248LOC102553352mortality factor 4-like protein 1-like46233050762335883Rat
7653676LOC102552373uncharacterized LOC10255237343027723630292457Rat
7624497LOC102553320uncharacterized LOC10255332042055909520617024Rat
7624653LOC102550020uncharacterized LOC10255002043358134233614776Rat
7653780LOC102555004uncharacterized LOC102555004477910977798785Rat
7641224LOC102548177uncharacterized LOC10254817743888634238887298Rat
7657264LOC102554854uncharacterized LOC10255485443181019231831238Rat
7643033LOC102550744uncharacterized LOC10255074442789400227900962Rat
7659798LOC102548175uncharacterized LOC102548175456227135631781Rat
7609534LOC102548489uncharacterized LOC10254848943987125939877904Rat
7610019LOC102555824uncharacterized LOC10255582441002760410033704Rat
7643646LOC102549088uncharacterized LOC10254908845933960459370768Rat
7661902LOC102557375uncharacterized LOC10255737542942040629422963Rat
7568823LOC102556089thyroid hormone receptor-associated protein 3-like45117283751174281Rat
7617944LOC102550084uncharacterized LOC10255008443361480033616983Rat
7571041LOC102550082uncharacterized LOC102550082411940251256156Rat
7590867LOC102552990phosphoglycerate kinase 1-like45724971657251699Rat
7572472LOC102552043uncharacterized LOC10255204342962315929624594Rat
7596412LOC102555662uncharacterized LOC102555662493034729312109Rat
7596691LOC102547989uncharacterized LOC10254798943777682637854477Rat
7619927LOC102555606uncharacterized LOC10255560643277043332773151Rat
7573585LOC102549548uncharacterized LOC10254954842622578626259715Rat
7545679LOC102548706LYR motif-containing protein 4-like44005240240055867Rat
7546483LOC102548106uncharacterized LOC102548106456959755717237Rat
7549033LOC102551002uncharacterized LOC10255100241470753314790306Rat
7550011LOC102552749MLV-related proviral Env polyprotein-like41794400417945837Rat
7563828LOC102552812uncharacterized LOC10255281245695226056954976Rat
7603885LOC102555922uncharacterized LOC10255592242204507222069581Rat
7604324LOC102555999uncharacterized LOC10255599944203387942038155Rat
7584396LOC102552448uncharacterized LOC10255244843053519430544218Rat
7585075LOC102546975uncharacterized LOC1025469754727831735900Rat
7585494LOC10254844960S ribosomal protein L10a-like442810204282121Rat
7553262LOC102547048uncharacterized LOC102547048499498109966501Rat
7553420LOC102554667uncharacterized LOC102554667472122347214155Rat
7751725LOC102554398uncharacterized LOC102554398465562256559938Rat
7751938LOC102556240uncharacterized LOC10255624042293425322935023Rat
7695905LOC10255460260S ribosomal protein L31-like43170474731705154Rat
7707294LOC10255627460S ribosomal protein L9-like44009156540092192Rat
7684922LOC102551553igE-binding protein-like41516086415166317Rat
7685089LOC102549835uncharacterized LOC102549835410794061119172Rat
7686019LOC102554908SUMO-conjugating enzyme UBC9-like476931047694283Rat
7688195LOC10255017160S ribosomal protein L7-like42752831327529555Rat
7688736LOC102556213uncharacterized LOC10255621343306197933066290Rat
7689603LOC102553416uncharacterized LOC10255341645791279857925235Rat
7714192LOC10255560340S ribosomal protein S15-like426423312642835Rat
7739309LOC102553126uncharacterized LOC10255312646266333662678025Rat
7714606LOC102556088uncharacterized LOC10255608841097517910985582Rat
7715275LOC102548552uncharacterized LOC10254855243999874339999582Rat
7715339LOC102550643uncharacterized LOC10255064343475545534764576Rat
7733889LOC102548423uncharacterized LOC10254842345894016558947769Rat
7733981LOC102554507uncharacterized LOC10255450746330017163308079Rat
7734714LOC102549955uncharacterized LOC10254995542430047624352511Rat
7696844LOC102551271uncharacterized LOC10255127144490817444936075Rat
7742493LOC102551706uncharacterized LOC10255170642870272028753970Rat
7744496LOC102555858uncharacterized LOC10255585843307140233076938Rat
7699413LOC102547990collagen alpha-1(XII) chain-like45866096058662152Rat
7671121LOC102550745uncharacterized LOC10255074544466835844674283Rat
7720489LOC102547369uncharacterized LOC10254736943474552034752691Rat
7673907LOC102548048uncharacterized LOC102548048457511225765145Rat
7747029LOC102553788uncharacterized LOC10255378843127631131295078Rat
7675565LOC102551067mucin-1-like45552603855527763Rat
7747752LOC102551166cadherin EGF LAG seven-pass G-type receptor 2-like41518865515285642Rat
7703633LOC102556345uncharacterized LOC10255634541338224713387768Rat
7727723LOC102550083dead end protein homolog 1-like42755403227556699Rat
7679531LOC102554730uncharacterized LOC102554730474441087449505Rat
7748643LOC102555760uncharacterized LOC10255576043305334733058890Rat
7680602LOC102554193uncharacterized LOC102554193467094806713676Rat
7681325LOC102547160uncharacterized LOC10254716041247277712500570Rat
7682276LOC10255374760S ribosomal protein L21-like45881262058813536Rat
9087759LOC103692057uncharacterized LOC10369205743388895433889946Rat
9131000LOC103692064uncharacterized LOC10369206444512883045146303Rat
9213002LOC103692041olfactory receptor 8B3-like416973511698307Rat
9213284LOC103692066sterile alpha motif domain-containing protein 9-like43122764231235711Rat
9093584LOC103692072sterile alpha motif domain-containing protein 9-like42834022128343105Rat
9138984LOC103692100uncharacterized LOC10369210046584663265848343Rat
9139502LOC103692069uncharacterized LOC10369206941795646517983642Rat
9175414LOC103692051uncharacterized LOC10369205142964918129654796Rat
9175419LOC103692088uncharacterized LOC10369208845880750958809140Rat
9099302LOC103692095uncharacterized LOC10369209546018791060188370Rat
9102085Prr21proline rich 2146122038661222956Rat
9071813LOC103692080uncharacterized LOC10369208044851095448516723Rat
9081787LOC103692014uncharacterized LOC1036920144667328682943Rat
9148086LOC103692030uncharacterized LOC10369203041242067212461565Rat
9185969LOC103692023uncharacterized LOC103692023469815726985910Rat
9150994LOC103692034uncharacterized LOC10369203441583615615900211Rat
9107635LOC103692046uncharacterized LOC10369204642462352724624259Rat
9189213LOC103692024uncharacterized LOC103692024477373847786903Rat
9155015LOC10369203860S ribosomal protein L29 pseudogene4917067918625Rat
9192921LOC103692061uncharacterized LOC10369206144315470943168961Rat
9159197LOC103692092transcription factor BTF3 pseudogene45922121559222331Rat
9159670LOC103692025uncharacterized LOC103692025483695538994881Rat
9112364LOC103692063uncharacterized LOC10369206344463842144668178Rat
9196134LOC103692090uncharacterized LOC10369209045845425558454948Rat
9197484LOC103692044mitochondrial import inner membrane translocase subunit Tim8 A pseudogene42124711821247692Rat
9118001Pttg1ip2PTTG1IP family member 242571995625759262Rat
9124057LOC103692035DNA-directed RNA polymerase II subunit GRINL1A pseudogene425392712540257Rat
9074090LOC103692079uncharacterized LOC10369207944846447748471419Rat
9074622LOC103692099uncharacterized LOC10369209946249389562500919Rat
9211173LOC103692029uncharacterized LOC103692029499944929995581Rat
9348766LOC10369208460S ribosomal protein L27 pseudogene45028986050290314Rat
9267310LOC103692110interferon-induced transmembrane protein 2 pseudogene45824301758243465Rat
9268500LOC103692060fatty acid-binding protein, heart pseudogene44046324140464430Rat
9307830LOC103692021uncharacterized LOC103692021453062625351768Rat
9309524LOC103692106putative uncharacterized protein DDB_G029169045681305456813319Rat
9271715LOC103692043uncharacterized LOC10369204342121830421230297Rat
9310068RGD9310068platelet glycoprotein 4-like41400168414071162Rat
9354796LOC103692028uncharacterized LOC103692028495375399539320Rat
9229365LOC103692052uncharacterized LOC10369205243183432931844317Rat
9319274LOC103692071disks large homolog 5-like42712876327134741Rat
9320161LOC103692107small nuclear ribonucleoprotein E pseudogene46633250666334771Rat
9321245LOC103692059uncharacterized LOC10369205943835088938353548Rat
9383752LOC10369208160S ribosomal protein L3 pseudogene44852653548533380Rat
9384460LOC103692042olfactory receptor 8B3-like417020911703403Rat
9280938LOC103692018olfactory receptor 8B3-like416859131686845Rat
9322741LOC103692045uncharacterized LOC10369204542220179222220741Rat
9374544LOC103692082protein SDA1 homolog44854011848545154Rat
9324693LOC10369208660S ribosomal protein L35a pseudogene45658171656582018Rat
9325313LOC103692089uncharacterized LOC10369208945846828358469365Rat
9376829LOC103692067protein LLP homolog pseudogene43169430331702271Rat
9243562LOC103692032uncharacterized LOC10369203241408428514100719Rat
9290605LOC103692091uncharacterized LOC10369209145887131058875519Rat
9334471LOC103692036transcription elongation factor B polypeptide 2 pseudogene497252819728865Rat
9295085LOC103692083uncharacterized LOC10369208344939594449401717Rat
9369941LOC103692093plexin-A4-like45978652959883422Rat
9298384Smkr1small lysine-rich protein 145726500857281271Rat
9300873LOC103692112uncharacterized protein-like46002351960031713Rat
9262349LOC103692056uncharacterized LOC10369205643373780333740681Rat
9304216LOC103692094uncharacterized LOC10369209445992530759933874Rat
9304696LOC103692049uncharacterized LOC10369204942654858226564704Rat
9330178LOC10369207460 kDa heat shock protein, mitochondrial pseudogene43892530838938931Rat
9428173LOC103692013protein canopy homolog 1-like4529392544669Rat
9467564LOC103692053uncharacterized LOC10369205343247158732472187Rat
9388809LOC103695208DNA-directed RNA polymerases I and III subunit RPAC2-like43388950933892887Rat
9389926LOC103692085uncharacterized LOC10369208545656266356563102Rat
9430179LOC103692047uncharacterized LOC10369204742555200025553855Rat
9472094Atp6v1fnbATP6V1F neighbor45674832656750536Rat
9472647LOC10369207360S ribosomal protein L31-like43362416233624494Rat
9474169LOC103692108tubulin beta chain-like44872388448727280Rat
9437642LOC103692027uncharacterized LOC103692027491815049186838Rat
9400372LOC103692026macrophage migration inhibitory factor pseudogene485003098506321Rat
9401596LOC103695197uncharacterized LOC103695197472778687281841Rat
9408229LOC103692111uncharacterized LOC10369211145846943258504056Rat
9409368LOC103692022uncharacterized LOC103692022466847526692906Rat
9447788LOC103692055uncharacterized LOC10369205543314203533155471Rat
9410961LOC103695207peptidyl-prolyl cis-trans isomerase D-like45876743658770243Rat
9414363LOC103692033uncharacterized LOC10369203341550520715519537Rat
9417071LOC103692097uncharacterized LOC10369209746196595361970623Rat
9417558LOC103692037lamin-B2-like41218384412207595Rat
9685233AptrAlu-mediated CDKN1A/p21 transcriptional regulator41074798910749291Rat
11369403LOC108350835uncharacterized LOC10835083545869348858696567Rat
11356515LOC108350668uncharacterized LOC10835066842804355028050573Rat
11367374LOC108350667uncharacterized LOC10835066742750451927509129Rat
11367620LOC108350659uncharacterized LOC10835065942191411421919906Rat
11449079LOC108350678uncharacterized LOC10835067845201765452043322Rat
11448653LOC108350693high mobility group protein B1 pseudogene46609091766092259Rat
11462374LOC108350658uncharacterized LOC10835065842172845121744973Rat
11462874LOC108350837uncharacterized LOC10835083746091323060916633Rat
11464143LOC108350677thymosin beta-10 pseudogene45176094451761128Rat
11464217LOC108350643uncharacterized LOC108350643440058844007137Rat
11466909LOC108350655uncharacterized LOC10835065541725138417272168Rat
11467604LOC108350833uncharacterized LOC10835083345835447458373379Rat
11468151LOC108350681uncharacterized LOC10835068145631312856327888Rat
11469036LOC10835068360S ribosomal protein L19 pseudogene45708965257091911Rat
11470826LOC108350647uncharacterized LOC108350647474498897453364Rat
11471040LOC108350689uncharacterized LOC10835068946037774760427520Rat
11471061LOC10835082860S ribosomal protein L10a pseudogene442805184284326Rat
11471735LOC108350657uncharacterized LOC10835065741822520018229385Rat
11473040LOC108350648uncharacterized LOC108350648475782167581880Rat
11474694LOC108350644cyclin-dependent kinase 4 pseudogene451619675163088Rat
11475346LOC10835080260S ribosomal protein L37 pseudogene424120212412339Rat
11457732LOC10835080360S ribosomal protein L7 pseudogene428147202815422Rat
11435887LOC10835085260S ribosomal protein L29 pseudogene43061902030619526Rat
11363596LOC108350856uncharacterized LOC10835085643914134039147577Rat
11364395LOC108350832uncharacterized LOC10835083241119626811202547Rat
11367433LOC108350674reticulon-4-like45031315350320379Rat
11438496LOC10835085460S ribosomal protein L19 pseudogene43286479132865351Rat
11439332LOC108350688uncharacterized LOC10835068845944822259536742Rat
11450777LOC108350691uncharacterized LOC10835069146229037562293099Rat
11429063LOC10835080060S ribosomal protein L23a pseudogene44510272045118196Rat
11451624Trnar-ccu2transfer RNA arginine (anticodon CCU) 246627617966276251Rat
11371332LOC108350650endogenous retrovirus group K member 25 Pol protein-like479671677971939Rat
11371841LOC108350665uncharacterized LOC10835066542715847827175086Rat
11431277LOC10835067160S ribosomal protein L31 pseudogene43170427531705138Rat
11452909LOC108350660uncharacterized LOC10835066042187441821878576Rat
11453204LOC108350673uncharacterized LOC10835067344724485647331220Rat
11453897LOC108350853uncharacterized LOC10835085343269140232698581Rat
11383785LOC108350661uncharacterized protein C11orf98 homolog pseudogene42215725722159279Rat
11394978LOC108350690uncharacterized LOC10835069046170561161707087Rat
11406136LOC108350834uncharacterized LOC10835083445866976158674115Rat
11417794LOC108350805igE-binding protein-like42061772320622308Rat
11418069LOC108350672uncharacterized LOC10835067244299954943000857Rat
11418580LOC10835064660S ribosomal protein L30-like463155156316699Rat
11420335LOC108350830thymosin beta-10 pseudogene41190666711907137Rat
11425743LOC108350645uncharacterized LOC108350645460308736037019Rat
11426159LOC10835065140S ribosomal protein S2 pseudogene495165909517487Rat
11427066LOC108350670uncharacterized LOC10835067042965291429657146Rat
11407309LOC108350669uncharacterized LOC10835066942902549129078698Rat
11385621LOC108350682small nuclear ribonucleoprotein G pseudogene45697989856980145Rat
11375273LOC108350666uncharacterized LOC10835066642733151427332352Rat
11375280LOC108350680uncharacterized LOC10835068045624694856249774Rat
11375714LOC108350836uncharacterized LOC10835083646134873561354819Rat
11389939LOC108350649SUMO-conjugating enzyme UBC9 pseudogene476896127694304Rat
11379972LOC10835085060S ribosomal protein L34 pseudogene429226332923063Rat
11391478LOC108350641uncharacterized LOC108350641419674502053229Rat
11391623LOC108350679uncharacterized LOC10835067945239616152409336Rat
11403251Trnap-agg6transfer RNA proline (anticodon AGG) 645666638956666460Rat
11403791LOC108350652MLV-related proviral Env polyprotein-like41411535714116950Rat
11382704LOC108350851protein transport protein Sec61 subunit gamma pseudogene459895445989888Rat
11519975LOC108350676uncharacterized LOC10835067645160492451667044Rat
11503662LOC108350685uncharacterized LOC10835068545777921657781541Rat
11479578LOC108350804zinc finger protein 709-like41311308913126704Rat
11479852LOC10835084940S ribosomal protein S15-like426415172643031Rat
11480393LOC108350692uncharacterized LOC10835069246308852663106433Rat
11480651LOC108350684uncharacterized LOC10835068445745405357456074Rat
11511427LOC108350831uncharacterized LOC10835083141188076311883346Rat
11494192LOC108350675uncharacterized LOC10835067545085070450858354Rat
11495168LOC108350829nucleoside diphosphate kinase B pseudogene449296084936292Rat
11484905LOC108350664uncharacterized LOC10835066442577112525778335Rat
11485345LOC108350687uncharacterized LOC10835068745941767059422130Rat
11516558LOC10835085540S ribosomal protein S23 pseudogene43625379836254232Rat
11517003LOC108350663uncharacterized LOC10835066342572704525735033Rat
11489261LOC108350653uncharacterized LOC10835065341419497614205102Rat

Nucleotide Sequences
GenBank Nucleotide BC078827 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  JH614436 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles


QTLs in Region (Rnor_6.0)
The following QTLs overlap with this region.    Full Report CSV TAB Printer Gviewer
RGD IDSymbolNameLODP ValueTraitSub TraitChrStartStopSpecies
61408Scl23Serum cholesterol level QTL 230.0005blood HDL phospholipid amount (VT:0010504)serum high density lipoprotein phospholipid level (CMO:0001567)4125545519Rat
724557Plsm1Polydactyly-luxate syndrome (PLS) morphotypes QTL 10.0003forelimb integrity trait (VT:0010562)front foot phalanges count (CMO:0001947)4125545519Rat
61351Bp33Blood pressure QTL 330.0018arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)4125545519Rat
1641905Colcr1Colorectal carcinoma resistance QTL 14.30.0003intestine integrity trait (VT:0010554)benign colorectal tumor surface area measurement (CMO:0001799)4126654881Rat
61333Gluco16Glucose level QTL 164.30.00001adipocyte glucose uptake trait (VT:0004185)absolute change in adipocyte glucose uptake (CMO:0000873)4126803291Rat
9589046Scfw2Subcutaneous fat weight QTL 25.540.001subcutaneous adipose mass (VT:1000472)abdominal subcutaneous fat pad weight (CMO:0002069)4128352196Rat
9589097Slep11Serum leptin concentration QTL 115.090.001blood leptin amount (VT:0005667)plasma leptin level (CMO:0000781)4128352196Rat
9590100Sffal4Serum free fatty acids level QTL 47.360.05blood free fatty acid amount (VT:0001553)plasma free fatty acids level (CMO:0000546)4128352196Rat
8552903Pigfal2Plasma insulin-like growth factor 1 level QTL 27.3blood insulin-like growth factor amount (VT:0010479)plasma insulin-like growth factor 1 level (CMO:0001299)4128352196Rat
1357343Gluco4Glucose level QTL 40.00002adipocyte glucose uptake trait (VT:0004185)adipocyte maximal glucose uptake to basal glucose uptake ratio (CMO:0000874)4129778604Rat
1357341Gluco5Glucose level QTL 56.4adipocyte free fatty acid secretion trait (VT:0010465)absolute change in adipocyte free fatty acid secretion per unit volume (CMO:0001446)4129778604Rat
738021Hcar13Hepatocarcinoma resistance QTL 134.3liver integrity trait (VT:0010547)liver nonremodeling tumorous lesion volume to total liver volume ratio (CMO:0001464)4131554484Rat
634323Hc2Hypercalciuria QTL 22.15urine calcium amount (VT:0002985)urine calcium excretion rate (CMO:0000763)4142118977Rat
619616Bp79Blood pressure QTL 790.0292arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)4304323179575658Rat
2303168Bp330Blood pressure QTL 3304.250.017arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)43043231145254791Rat
2302371Stl22Serum triglyceride level QTL 225.15blood triglyceride amount (VT:0002644)serum triglyceride level (CMO:0000360)4304401755791834Rat
1358203Stl19Serum triglyceride level QTL 192.80.002blood triglyceride amount (VT:0002644)serum triglyceride level (CMO:0000360)4304401764915903Rat
1358201Gluco12Glucose level QTL121.6adipocyte glucose uptake trait (VT:0004185)adipocyte maximal glucose uptake (CMO:0000870)4304411426753655Rat
631642Stl2Serum triglyceride level QTL 23.3blood triglyceride amount (VT:0002644)serum triglyceride level (CMO:0000360)4304780755324857Rat
631209Bw2Body weight QTL24.2retroperitoneal fat pad mass (VT:0010430)retroperitoneal fat pad weight to body weight ratio (CMO:0000635)4646769343414792Rat
1300141Bp178Blood pressure QTL 178arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)4657293937703537Rat
631261Tcas3Tongue tumor susceptibility QTL 36.88tongue integrity trait (VT:0010553)number of squamous cell tumors of the tongue with diameter greater than 3 mm (CMO:0001950)4734240492484039Rat
2316958Gluco58Glucose level QTL 5810blood glucose amount (VT:0000188)blood glucose level (CMO:0000046)47850904182171018Rat
9590304Scort17Serum corticosterone level QTL 174.960.001blood corticosterone amount (VT:0005345)plasma corticosterone level (CMO:0001173)4805218953052189Rat
6478724Anxrr35Anxiety related response QTL 350.00449defecation behavior trait (VT:0010462)defecation measurement (CMO:0000997)4805218953052189Rat
6478766Anxrr47Anxiety related response QTL 470.09637locomotor behavior trait (VT:0001392)number of entries into a discrete space in an experimental apparatus (CMO:0000960)4805218953052189Rat
6478769Anxrr48Anxiety related response QTL 480.02514locomotor behavior trait (VT:0001392)amount of experiment time spent in a discrete space in an experimental apparatus (CMO:0000958)4805218953052189Rat
8552906Pigfal3Plasma insulin-like growth factor 1 level QTL 3blood insulin-like growth factor amount (VT:0010479)plasma insulin-like growth factor 1 level (CMO:0001299)4805218953052189Rat
8694374Bw155Body weight QTL 1553.390.001body lean mass (VT:0010483)lean tissue morphological measurement (CMO:0002184)4805218953052189Rat
2303585Bw86Body weight QTL 864body mass (VT:0001259)body weight (CMO:0000012)41263897457638974Rat
7387227Uae40Urinary albumin excretion QTL 402.90.0052urine albumin amount (VT:0002871)urine albumin excretion rate (CMO:0000757)41614994161149941Rat
70222Eae2Experimental allergic encephalomyelitis QTL 24.3nervous system integrity trait (VT:0010566)experimental autoimmune encephalomyelitis incidence/prevalence measurement (CMO:0001046)41822218737685319Rat
1354665Stl10Serum triglyceride level QTL 103.57blood triglyceride amount (VT:0002644)serum triglyceride level (CMO:0000360)41822218743414792Rat
61412Pia2Pristane induced arthritis QTL 23.9joint integrity trait (VT:0010548)post-insult time to onset of experimental arthritis (CMO:0001450)41822218761039065Rat
8552803Bw144Body weight QTL 14416body mass (VT:0001259)change in body weight to body weight ratio (CMO:0002216)41961886631825560Rat
10755501Bp390Blood pressure QTL 3902.5arterial blood pressure trait (VT:2000000)diastolic blood pressure (CMO:0000005)423850384169318094Rat
6909122Insul22Insulin level QTL 224.63blood insulin amount (VT:0001560)plasma insulin level (CMO:0000342)42399172176238799Rat
6909128Pancm4Pancreatic morphology QTL 411.35pancreas mass (VT:0010144)pancreas wet weight (CMO:0000626)42399172176238799Rat
1578655Bmd11Bone mineral density QTL 1111femur mineral mass (VT:0010011)total volumetric bone mineral density (CMO:0001728)42463187469631874Rat
8655906Rf60Renal function QTL 603.8blood creatinine amount (VT:0005328)creatinine clearance (CMO:0000765)42665474981874227Rat
12798520Anxrr55Anxiety related response QTL 554.450.01locomotor behavior trait (VT:0001392)number of rearing movements with lid-pushing in an experimental apparatus (CMO:0002715)429549895112807890Rat
11530004Niddm71Non-insulin dependent diabetes mellitus QTL 710.001blood glucose amount (VT:0000188)blood glucose level area under curve (AUC) (CMO:0000350)43155448451311866Rat
8655949Rf62Renal function QTL 6222blood urea nitrogen amount (VT:0005265)plasma urea nitrogen level (CMO:0000586)43182520043414792Rat
8552782Vie1Viral induced encephalitis QTL 126.4brain integrity trait (VT:0010579)encephalitis incidence/prevalence measurement (CMO:0002361)43182556083531021Rat
8552801Bw143Body weight QTL 1437.3body mass (VT:0001259)change in body weight to body weight ratio (CMO:0002216)43182556083531021Rat
8552809Vie5Viral induced encephalitis QTL 525.3brain integrity trait (VT:0010579)encephalitis incidence/prevalence measurement (CMO:0002361)43182556083531021Rat
61415Eae11Experimental allergic encephalomyelitis QTL 112.9nervous system integrity trait (VT:0010566)post-insult time to onset of experimental autoimmune encephalomyelitis (CMO:0001422)43363780337685319Rat
2313401Anxrr27Anxiety related response QTL 27aggression-related behavior trait (VT:0015014)tameness/aggressiveness composite score (CMO:0002136)43363780361708341Rat
8655961Kidm43Kidney mass QTL 4318kidney mass (VT:0002707)both kidneys wet weight (CMO:0000085)43427793299067150Rat
4889511Gluco61Glucose level QTL 614.70.001blood glucose amount (VT:0000188)blood glucose level area under curve (AUC) (CMO:0000350)43513886039073276Rat
2290374Gluco32Glucose level QTL 326.27blood glucose amount (VT:0000188)blood glucose level area under curve (AUC) (CMO:0000350)43513886043414792Rat
1300156Bp179Blood pressure QTL 1792.85arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)43661559937703537Rat
1358352Srcrt3Stress Responsive Cort QTL 32.29blood corticosterone amount (VT:0005345)plasma corticosterone level (CMO:0001173)436615599145611886Rat
61475Aia2Adjuvant induced arthritis QTL 25.8joint integrity trait (VT:0010548)joint inflammation composite score (CMO:0000919)43768517573066691Rat
1331807Rf31Renal function QTL 312.988urine potassium amount (VT:0010539)urine potassium level (CMO:0000128)43770327275345433Rat
1300139Hrtrt6Heart rate QTL 62.85heart pumping trait (VT:2000009)heart rate (CMO:0000002)437703272115372927Rat
61445Strs3Sensitivity to stroke QTL 33cerebrum integrity trait (VT:0010549)post-insult time to onset of cerebrovascular lesion (CMO:0002343)43920822284208222Rat
8694439Bw168Body weight QTL 1689.570.001retroperitoneal fat pad mass (VT:0010430)retroperitoneal fat pad weight to body weight ratio (CMO:0000635)43920824784208247Rat
6893678Bw108Body weight QTL 1082.60.006body mass (VT:0001259)body weight (CMO:0000012)44241577787415777Rat
1576305Emca6Estrogen-induced mammary cancer QTL 65.8mammary gland integrity trait (VT:0010552)mammary tumor number (CMO:0000343)443414605155469929Rat
1354660Salc1Saline consumption QTL 111.26drinking behavior trait (VT:0001422)saline drink intake rate (CMO:0001627)443414792146942075Rat
1354612Foco1Food consumption QTL 18.87eating behavior trait (VT:0001431)food intake rate (CMO:0000427)443414792146942075Rat
1298082Stresp4Stress response QTL 4blood corticosterone amount (VT:0005345)plasma corticosterone level (CMO:0001173)446898276145611886Rat
10450821Scl77Serum cholesterol level QTL 774.10.01blood VLDL cholesterol amount (VT:0005144)blood high density lipoprotein cholesterol level (CMO:0000052)44768569455791834Rat
10450825Scl78Serum cholesterol level QTL 783.70.01blood VLDL cholesterol amount (VT:0005144)blood low density lipoprotein cholesterol level (CMO:0000053)44768569455791834Rat
10450818Scl76Serum cholesterol level QTL 763.60.01blood VLDL cholesterol amount (VT:0005144)blood high density lipoprotein cholesterol level (CMO:0000052)44768569455791834Rat
2312567Glom19Glomerulus QTL 191.90.006kidney glomerulus morphology trait (VT:0005325)index of glomerular damage (CMO:0001135)449906054145611886Rat
4889969Bss96Bone structure and strength QTL 964.9tibia size trait (VT:0100001)tibia cortical bone volume (CMO:0001725)45532485779575658Rat
4889972Bss97Bone structure and strength QTL 975.6tibia size trait (VT:0100001)tibia total bone volume (CMO:0001724)45532485779575658Rat
5685009Bmd86Bone mineral density QTL 863.7tibia mineral mass (VT:1000283)bone mineral density (CMO:0001226)45532485779575658Rat
5685012Bmd87Bone mineral density QTL 875.1tibia mineral mass (VT:1000283)bone mineral content (CMO:0001554)45532485779575658Rat
70200Alc18Alcohol consumption QTL 189.2drinking behavior trait (VT:0001422)ethanol intake volume to total fluid intake volume ratio (CMO:0001591)455324953148360954Rat
1641833Alc21Alcohol consumption QTL 218.60.0001drinking behavior trait (VT:0001422)ethanol drink intake rate (CMO:0001407)455375865125671711Rat
634311Sach7Saccharin preference QTL 7taste sensitivity trait (VT:0001986)saccharin intake volume to total fluid intake volume ratio (CMO:0001601)45579156482134846Rat
631546Bp86Blood pressure QTL 863.2arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)45579156492484312Rat
61336Bp21Blood pressure QTL 214.6arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)45579183479557856Rat
1578657Bss12Bone structure and strength QTL 128.9femur morphology trait (VT:0000559)femoral neck cross-sectional area (CMO:0001697)456092756101092756Rat
1578658Bss13Bone structure and strength QTL 138femur strength trait (VT:0010010)femoral neck polar moment of inertia (CMO:0001670)456092756101092756Rat
1558651Swd3Spike wave discharge measurement QTL 34.620.000024brain electrophysiology trait (VT:0010557)brain spike-and-wave discharge frequency (CMO:0001742)45710107792990863Rat
631671Iddm11Insulin dependent diabetes mellitus QTL 113.60.0012blood glucose amount (VT:0000188)plasma glucose level (CMO:0000042)45730707579578854Rat
1358363Sradr3Stress Responsive Adrenal Weight QTL 36.19adrenal gland mass (VT:0010420)both adrenal glands wet weight (CMO:0000164)458166424103166424Rat
738009Sach4Saccharine consumption QTL 44.90.000016consumption behavior trait (VT:0002069)saccharin intake volume to total fluid intake volume ratio (CMO:0001601)458640017154427984Rat
738016Alc16Alcohol consumption QTL 163.60.00015consumption behavior trait (VT:0002069)ethanol drink intake rate to body weight ratio (CMO:0001616)458640017154427984Rat
738031Alc14Alcohol consumption QTL 147.60.00003consumption behavior trait (VT:0002069)ethanol drink intake rate to body weight ratio (CMO:0001616)458640017154427984Rat
1549843Bw53Body weight QTL 530.0001body mass (VT:0001259)body weight gain (CMO:0000420)46043912799066957Rat
1549839Bw52Body weight QTL 520.0001body mass (VT:0001259)body weight gain (CMO:0000420)460439127113416139Rat
61418Pia5Pristane induced arthritis QTL 54.5joint integrity trait (VT:0010548)joint inflammation composite score (CMO:0000919)461038901127777403Rat
7394826Bw126Body weight QTL 1260.002body mass (VT:0001259)body weight gain (CMO:0000420)46170810388565113Rat
8552807Vie4Viral induced encephalitis QTL 47.3brain integrity trait (VT:0010579)encephalitis incidence/prevalence measurement (CMO:0002361)46170834183531021Rat
70192BpQTLcluster5Blood pressure QTL cluster 54.183arterial blood pressure trait (VT:2000000)diastolic blood pressure (CMO:0000005)461708341113100992Rat
70192BpQTLcluster5Blood pressure QTL cluster 54.183arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)461708341113100992Rat
70192BpQTLcluster5Blood pressure QTL cluster 54.183arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)461708341113100992Rat
70192BpQTLcluster5Blood pressure QTL cluster 54.183arterial blood pressure trait (VT:2000000)percent change in mean arterial blood pressure (CMO:0002035)461708341113100992Rat
70192BpQTLcluster5Blood pressure QTL cluster 54.183arterial blood pressure trait (VT:2000000)percent change in systolic blood pressure (CMO:0000747)461708341113100992Rat
70192BpQTLcluster5Blood pressure QTL cluster 54.183arterial blood pressure trait (VT:2000000)absolute change in pulse pressure (CMO:0001882)461708341113100992Rat
70192BpQTLcluster5Blood pressure QTL cluster 54.183arterial blood pressure trait (VT:2000000)absolute change in mean arterial blood pressure (CMO:0000533)461708341113100992Rat
2300179Bmd50Bone mineral density QTL 505.90.0001femur mineral mass (VT:0010011)volumetric bone mineral density (CMO:0001553)461975371106975371Rat
1641919Alc22Alcohol consumption QTL 220.0005drinking behavior trait (VT:0001422)ethanol drink intake rate (CMO:0001407)462947687125671711Rat
631674Iddm14Insulin dependent diabetes mellitus QTL 14blood glucose amount (VT:0000188)plasma glucose level (CMO:0000042)463537179157286626Rat
6478684Anxrr30Anxiety related response QTL 300.00087defecation behavior trait (VT:0010462)defecation rate (CMO:0000998)463812687108812687Rat
6478743Anxrr40Anxiety related response QTL 400.83076defecation behavior trait (VT:0010462)defecation rate (CMO:0000998)463812687108812687Rat
6478772Anxrr49Anxiety related response QTL 490.15488defecation behavior trait (VT:0010462)defecation rate (CMO:0000998)463812687108812687Rat
631651Bp124Blood pressure QTL 1243arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)463938412108938412Rat
2317577Eae24Experimental allergic encephalomyelitis QTL 24nervous system integrity trait (VT:0010566)post-insult time to onset of experimental autoimmune encephalomyelitis (CMO:0001422)46598781473372824Rat
2317577Eae24Experimental allergic encephalomyelitis QTL 24nervous system integrity trait (VT:0010566)percentage of study population developing experimental autoimmune encephalomyelitis during a period of time (CMO:0001047)46598781473372824Rat
2317577Eae24Experimental allergic encephalomyelitis QTL 24nervous system integrity trait (VT:0010566)experimental autoimmune encephalomyelitis severity score (CMO:0001419)46598781473372824Rat
2312569Pur19Proteinuria QTL 193.40.001total urine protein amount (VT:0000032)urine total protein excretion rate (CMO:0000756)46598924397759057Rat


Additional Information

Database Acc Id Source(s)
NCBI Gene 100909424 UniSTS
  312251 UniSTS
  64194 UniSTS
UniSTS 211365 UniSTS