AW546539 Marker Search Result - Rat Genome Database
Submit Data |  Help |  Video Tutorials |  News |  Publications |  Download |  REST API |  Citing RGD |  Contact   

Marker: AW546539

Symbol: AW546539
Also known as: 963126; 
RGD ID: 4903903
Expected Size: 149 (bp)
Position
Mouse AssemblyChrPosition (strand)SourceJBrowse
GRCm38697,184,410 - 97,184,558UniSTSGRCm38
GRCm38X20,529,785 - 20,529,927UniSTSGRCm38
MGSCv37697,134,404 - 97,134,552UniSTSGRCm37
MGSCv37X20,106,911 - 20,107,053UniSTSGRCm37
Celera699,043,459 - 99,043,607UniSTS
CeleraX18,661,102 - 18,661,244UniSTS
Cytogenetic Map6D3UniSTS
Whitehead/MRC_RH6987.45UniSTS
Is Marker For: Genes:   Uba3   Gm14538  


Annotation


References - curated
1. RGD automated pipelines

Strains and Sequence

Sequence
 
Forward Primer TGCTCTTTGACCACAACAAAC
Reverse Primer AGACTGAACTTTGGGGTTGG
 

Region

Genes in Region
The following Genes overlap with this region.    Full Report CSV TAB Printer Analysis Tools
RGD IDSymbolNameChrStartStopSpecies
734283Uba3ubiquitin-like modifier activating enzyme 369718363297205647Mouse



QTLs in Region (GRCm38)
The following QTLs overlap with this region.    Full Report CSV TAB Printer Gviewer
RGD IDSymbolNameLODP ValueTraitSub TraitChrStartStopSpecies
25440480Moaq2_mmodifier of alien QTL 2 (mouse)61117500000Mouse
26884414Bzwq12_mbi-zygomatic width QTL 12, 16 week (mouse)63400000139100000Mouse
10412157Fl1n_mfatty liver 1 in NSY (mouse)Not determined645314059128835032Mouse
4142259Tabw2_mtally ho associated body weight 2 (mouse)Not determined46935985136423692Mouse
25314319Histh6_mhistamine hypersensitivity 6 (mouse)648720000125360000Mouse
25314320Histh5_mhistamine hypersensitivity 5 (mouse)648720000148450000Mouse
1301962Eila2_methanol induced locomotor activity 2 (mouse)Not determined648726556125356785Mouse
1357683Igf1sl1_mIGF-1 serum levels 1 (mouse)Not determined652161713116155267Mouse
1301369Im4_mimmunoregulatory 4 (mouse)Not determined66348473897484905Mouse
1300650Bw18_mbody weight QTL 18 (mouse)Not determined666713869100714031Mouse
1301876Bits2_mbitterness sensitivity 2 (mouse)Not determined670425898104426034Mouse
1301813Skl3_mskeletal size (tail length) 3 (mouse)Not determined670425898104426034Mouse
1301034Egrm2_mearly growth rate (mouse)Not determined670425898104426034Mouse
1300869Stheal5_msoft tissue heal 5 (mouse)Not determined671575060105575178Mouse
1300954Fcsa1_mfemoral cross-sectional area 1 (mouse)Not determined671981024105981170Mouse
1301521Pas1c_mpulmonary adenoma susceptibility 1c (mouse)Not determined671981024105981170Mouse
13506930Recrq9_mrecombination rate in male meiosis QTL 9 (mouse)673500000134700000Mouse
1301320Ots1_movarian teratoma susceptibility 1 (mouse)Not determined675447583104503555Mouse
10043901Pfat5_mpredicted fat percentage 5 (mouse)Not determined675607306109607450Mouse
10412208Cypr4_mcytokine production 4 (mouse)Not determined675716503109716697Mouse
1357875Pfat2_mpredicted fat percentage 2 (mouse)Not determined676463949110464093Mouse
4141376Dbm1_mdiabetes modifier 1 (mouse)Not determined678629504121115387Mouse
14696731Pairq1_mP. aeruginosa infection resistance QTL 1 (mouse)681500000102200000Mouse
10043864T2dm4sa_mtype 2 diabetes mellitus 4 in SMXA RI mice (mouse)Not determined683713869147052561Mouse
11251720Ewc4_methanol withdrawal and consumption 4 (mouse)684122513118122513Mouse
1301687Mnic2_mmacronutrient intake (mouse)Not determined686806805113544602Mouse
1301744Hdlq11_mHDL QTL 11 (mouse)Not determined687503360121503555Mouse
1301262Gasa3_mgastritis type A susceptibility locus 3 (mouse)Not determined689005405123005603Mouse
1301244Ichs_mimmediate cutaneous hypersensitivity QTL (mouse)Not determined690795610124795846Mouse
11532719Sluc45_msusceptibility to lung cancer 45 (mouse)69260730698258933Mouse
4141578Obrq1_mobesity resistance QTL 1 (mouse)Not determined92607306112004738Mouse
11353842Bmiq4_mbody mass index QTL 4 (mouse)692607306146429238Mouse
1301292Cfbw2_mcystic fibrosis body weight 2 (mouse)Not determined695004651129004738Mouse
1300704Cia3_mcollagen induced arthritis QTL 3 (mouse)Not determined696347325130347522Mouse
11040599Lmr4b_mleishmaniasis resistance 4b (mouse)696347325130347522Mouse
4141940W6q5_mweight 6 weeks QTL 5 (mouse)Not determined96655951146633626Mouse
4142416Egq11_mearly growth QTL 11 (mouse)Not determined96655951146633626Mouse
1357555Tesq2_mtestis weight QTL 2 (mouse)Not determined696655951146633626Mouse
1301551Spha1_msperm head anomaly 1 (mouse)Not determinedX1039998640832775Mouse
1302195Pbwg10_mpostnatal body weight growth 10 (mouse)Not determinedX126335934Mouse
1357433Dbts2_mdiabetes 2 (mouse)Not determinedX7360056151324042Mouse
13208553Wght11_mweight 11 (mouse)X1200000060000000Mouse
13208557Lgth13_mbody length 13 (mouse)X1200000060000000Mouse


Additional Information

Database Acc Id Source(s)
NCBI Gene 100417915 UniSTS
  22200 UniSTS
UniSTS 179424 UniSTS