Marker: D16Got75 |
| Symbol: |
D16Got75 |
| Previously known as: |
oxsts353; OT39.27;
|
| RGD ID: |
45385 |
| Expected Size: |
197 (bp) |
| Position |
| Rat Assembly | Chr | Position (strand) | Source | JBrowse |
|---|
| GRCr8 | 16 | 77,011,260 - 77,011,457 (+) | Marker Load Pipeline | | | mRatBN7.2 | 16 | 70,308,796 - 70,308,993 (+) | MAPPER | mRatBN7.2 | | Rnor_6.0 | 16 | 75,304,320 - 75,304,516 | NCBI | Rnor6.0 | | Rnor_5.0 | 16 | 74,918,836 - 74,919,032 | UniSTS | Rnor5.0 | | RGSC_v3.4 | 16 | 74,990,004 - 74,990,201 | RGD | RGSC3.4 | | RGSC_v3.4 | 16 | 74,990,005 - 74,990,201 | UniSTS | RGSC3.4 | | RGSC_v3.1 | 16 | 74,990,270 - 74,990,466 | RGD | | | Celera | 16 | 68,181,437 - 68,181,635 | UniSTS | | | RH 3.4 Map | 16 | 691.5 | RGD | | | RH 3.4 Map | 16 | 691.5 | UniSTS | | | RH 2.0 Map | 16 | 793.2 | RGD | | | Cytogenetic Map | 16 | p | UniSTS | |
|
| Is Marker For: |
Genes:
Defb1
|
Annotation
| 1. |
Data downloaded from Wellcome Trust, University of Oxford |
Data downloaded from Wellcome Trust, University of Oxford
|
| 2. |
High-density rat radiation hybrid maps containing over 24,000 SSLPs, genes, and ESTs provide a direct link to the rat genome sequence. |
Kwitek AE, etal., Genome Res. 2004 Apr;14(4):750-7
|
| 3. |
UniSTS Pipeline |
RGD automated pipelines
|
| 4. |
RH Map Project |
RH Map Project, Laboratory of Genetic Research Website, 1-JUL-99, Laboratory of Genetic Research, Medical College of Wisconsin, http://www.lgr.mcw.edu/LGR/
|
| 5. |
A high density integrated genetic linkage and radiation hybrid map of the laboratory rat |
Steen RG, Kwitek-Black AE, etal., Genome Research, 1999, 6:1-8
|
Strains and Sequence
| |
| Forward Primer |
CCCTAGAGTCCCACCCACA |
| Reverse Primer |
ATTTCCTAAGTATCCTTTTGGCAAC |
| |
| 619943 | Defb1 | defensin beta 1 | 16 | 70298862 | 70313604 | Rat |
| 2300163 | Bmd64 | Bone mineral density QTL 64 | 5.3 | 0.0001 | lumbar vertebra mineral mass (VT:0010511) | volumetric bone mineral density (CMO:0001553) | 16 | 37752156 | 82752156 | Rat | | 7411648 | Foco22 | Food consumption QTL 22 | 15 | 0.001 | eating behavior trait (VT:0001431) | feed conversion ratio (CMO:0001312) | 16 | 52726464 | 84729064 | Rat | | 1600378 | Arunc4 | Aerobic running capacity QTL 4 | | 0.03 | exercise endurance trait (VT:0002332) | maximum distance run on treadmill (CMO:0001406) | 16 | 380245 | 80345693 | Rat | | 70215 | Niddm29 | Non-insulin dependent diabetes mellitus QTL 29 | 3.54 | | blood glucose amount (VT:0000188) | blood glucose level area under curve (AUC) (CMO:0000350) | 16 | 19004435 | 75226532 | Rat | | 1578768 | Stresp22 | Stress response QTL 22 | 2.8 | | thymus mass (VT:0004954) | thymus wet weight (CMO:0000855) | 16 | 35288870 | 80288870 | Rat | | 2293690 | Bss45 | Bone structure and strength QTL 45 | 5.13 | 0.0001 | lumbar vertebra morphology trait (VT:0010494) | lumbar vertebra cortical cross-sectional area (CMO:0001690) | 16 | 37752156 | 82752156 | Rat | | 8694364 | Abfw7 | Abdominal fat weight QTL 7 | 12.22 | 0.001 | visceral adipose mass (VT:0010063) | abdominal fat pad weight to body weight ratio (CMO:0000095) | 16 | 52726464 | 84729064 | Rat | | 8694429 | Bw164 | Body weight QTL 164 | 5 | 0.001 | body lean mass (VT:0010483) | lean tissue morphological measurement (CMO:0002184) | 16 | 52726464 | 84729064 | Rat | | 7205510 | Activ5 | Activity QTL 5 | 3.78 | 0.00028 | locomotor behavior trait (VT:0001392) | number of entries into a discrete space in an experimental apparatus (CMO:0000960) | 16 | 42396345 | 84729064 | Rat | | 70205 | Gcr3 | Gastric cancer resistance QTL 3 | 2.3 | | stomach morphology trait (VT:0000470) | stomach tumor diameter (CMO:0001889) | 16 | 17696791 | 82635055 | Rat | | 631525 | Pia14 | Pristane induced arthritis QTL 14 | 4.4 | | joint integrity trait (VT:0010548) | joint inflammation composite score (CMO:0000919) | 16 | 55711087 | 83402471 | Rat | | 1298527 | Arunc2 | Aerobic running capacity QTL 2 | 2.9 | | exercise endurance trait (VT:0002332) | maximum distance run on treadmill (CMO:0001406) | 16 | 68532716 | 75029966 | Rat |
|
|
