D9Got86 Marker Search Result - Rat Genome Database

Send us a Message



Submit Data |  Help |  Video Tutorials |  News |  Publications |  Download |  REST API |  Citing RGD |  Contact   

Marker: D9Got86

Symbol: D9Got86
Previously known as: oxsts651; D9Got85; OT11.09; 
RGD ID: 44636
Expected Size: 229 (bp)
Position
Rat AssemblyChrPosition (strand)SourceJBrowse
mRatBN7.2975,635,142 - 75,635,371 (+)MAPPERmRatBN7.2
Rnor_6.0981,333,033 - 81,333,268NCBIRnor6.0
Rnor_5.0981,098,731 - 81,098,966UniSTSRnor5.0
RGSC_v3.4973,376,109 - 73,376,338RGDRGSC3.4
RGSC_v3.4973,376,110 - 73,376,338UniSTSRGSC3.4
RGSC_v3.1973,523,092 - 73,523,320RGD
Celera973,212,433 - 73,212,661UniSTS
RH 3.4 Map9696.1UniSTS
RH 3.4 Map9696.1RGD
RH 2.0 Map9769.7RGD
Cytogenetic Map9q33UniSTS
Is Marker For: Genes:   Tns1  


Annotation


References - curated
# Reference Title Reference Citation
1. Data downloaded from Wellcome Trust, University of Oxford Data downloaded from Wellcome Trust, University of Oxford
2. High-density rat radiation hybrid maps containing over 24,000 SSLPs, genes, and ESTs provide a direct link to the rat genome sequence. Kwitek AE, etal., Genome Res. 2004 Apr;14(4):750-7
3. UniSTS Pipeline RGD automated pipelines
4. RH Map Project RH Map Project, Laboratory of Genetic Research Website, 1-JUL-99, Laboratory of Genetic Research, Medical College of Wisconsin, http://www.lgr.mcw.edu/LGR/
5. A high density integrated genetic linkage and radiation hybrid map of the laboratory rat Steen RG, Kwitek-Black AE, etal., Genome Research, 1999, 6:1-8

Strains and Sequence

Sequence
 
Forward Primer ACACAGAGAGACACATGTGGG
Reverse Primer GTGTGTTTGCCATGCTCCTT
 

Region

Nucleotide Sequences
GenBank Nucleotide AU029030 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles


Additional Information

Database Acc Id Source(s)
NCBI Gene 301509 UniSTS