D4Got242 Marker Search Result - Rat Genome Database

Send us a Message
Submit Data |  Help |  Video Tutorials |  News |  Publications |  Download |  REST API |  Citing RGD |  Contact   
Search RGD Grant Resources Citing RGD About Us Contact Us
Genes Variants Community Projects QTLs Strains Markers Genome Information Ontologies Cell Lines References Download Submit Data
OntoMate (Literature Search) JBrowse (Genome Browser) Synteny Browser (VCMap) Variant Visualizer Multi-Ontology Enrichment (MOET) Gene-Ortholog Location Finder (GOLF) InterViewer (Protein-Protein Interactions) PhenoMiner (Quatitative Phenotypes) Gene Annotator OLGA (Gene List Generator) AllianceMine GViewer (Genome Viewer)
Aging & Age-Related Disease Cancer & Neoplastic Disease Cardiovascular Disease Coronavirus Disease Developmental Disease Diabetes Hematologic Disease Immune & Inflammatory Disease Infectious Disease Liver Disease Neurological Disease Obesity & Metabolic Syndrome Renal Disease Respiratory Disease Sensory Organ Disease
Find Models Genetic Models Autism Models Rat PhenoMiner (Quantitative Phenotypes) Chinchilla PhenoMiner Expected Ranges (Quantitative Phenotype) PhenoMiner Term Comparison Hybrid Rat Diversity Panel Phenotypes Phenotypes in Other Animal Models Animal Husbandry Strain Medical Records Phylogenetics Strain Availability Calendar Rats 101 Submissions Photo Archive
Pathways
Rat Community Forum Directory of Rat Laboratories Video Tutorials News RGD Publications RGD Presentations Archive Nomenclature Guidelines Resource Links Laboratory Resources Employment Resources
Advanced Search (OLGA)

Marker: D4Got242

Symbol: D4Got242
Previously known as: oxsts3634; OT38.16; 
RGD ID: 1634010
Expected Size: 233 (bp)
Position
Rat AssemblyChrPosition (strand)SourceJBrowse
mRatBN7.24178,251,658 - 178,251,891 (+)MAPPERmRatBN7.2
Rnor_6.04179,548,758 - 179,548,990NCBIRnor6.0
Rnor_5.04243,729,546 - 243,729,778UniSTSRnor5.0
RGSC_v3.44182,931,480 - 182,931,712UniSTSRGSC3.4
Celera4166,771,163 - 166,771,395UniSTS
Cytogenetic Map4 RGD




#
Reference Title
Reference Citation
1. Data downloaded from Wellcome Trust, University of Oxford Data downloaded from Wellcome Trust, University of Oxford
2. UniSTS Pipeline RGD automated pipelines


 
Forward Primer CCAGCCAATGTTGCTGAATC
Reverse Primer CTGGTTACACCAACTGTGCTTTAG
 
GenBank Nucleotide AU027564 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  JH614873.1 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles


1 to 10 of 13 rows
The following QTLs overlap with this region.    Full Report CSV TAB Printer Gviewer
RGD ID
Symbol
Name
LOD
P Value
Trait
Sub Trait
Chr
Start
Stop
Species
6478754Anxrr43Anxiety related response QTL 430.14035locomotor behavior trait (VT:0001392)distance moved per unit of time into, out of or within a discrete space in an experimental apparatus (CMO:0001493)4144639524182687754Rat
2303623Vencon2Ventilatory control QTL 23.8respiration trait (VT:0001943)minute ventilation (CMO:0000132)4135204660180204660Rat
6478693Anxrr32Anxiety related response QTL 320.00092locomotor behavior trait (VT:0001392)measurement of voluntary locomotion into, out of or within a discrete space in an experimental apparatus (CMO:0000957)4144639524182687754Rat
1578674Bmd12Bone mineral density QTL 123.8femur mineral mass (VT:0010011)compact volumetric bone mineral density (CMO:0001730)4135699135180699135Rat
1331738Bp209Blood pressure QTL 2092.979arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)4138503169179293946Rat
6478700Anxrr33Anxiety related response QTL 330.00896locomotor behavior trait (VT:0001392)amount of experiment time spent in a discrete space in an experimental apparatus (CMO:0000958)4144639524182687754Rat
10053718Scort25Serum corticosterone level QTL 252.150.0097blood corticosterone amount (VT:0005345)plasma corticosterone level (CMO:0001173)4155561574182687754Rat
2293659Bmd35Bone mineral density QTL 354.50.0001femur strength trait (VT:0010010)femoral neck ultimate force (CMO:0001703)4137755016181392681Rat
10401796Kidm48Kidney mass QTL 48kidney mass (VT:0002707)both kidneys wet weight (CMO:0000085)4145568712182687754Rat
6478718Anxrr34Anxiety related response QTL 340.00896locomotor behavior trait (VT:0001392)amount of experiment time spent in a discrete space in an experimental apparatus (CMO:0000958)4144639524182687754Rat

1 to 10 of 13 rows