D15S652 Marker Search Result - Rat Genome Database

Send us a Message



Submit Data |  Help |  Video Tutorials |  News |  Publications |  Download |  REST API |  Citing RGD |  Contact   

Marker: D15S652

Symbol: D15S652
Previously known as: ATA24A08; CHLC.ATA24A08.P17235; GDB:683910; G00-364-996; ATA-D15S652; CHLC.ATA24A08; 
RGD ID: 1340735
Expected Size: 285 (bp)
Position
Human AssemblyChrPosition (strand)SourceJBrowse
GRCh371592,517,367 - 92,517,651UniSTSGRCh37
Build 361590,318,371 - 90,318,655RGDNCBI36
Celera1568,929,313 - 68,929,597RGD
Cytogenetic Map15qUniSTS
Cytogenetic Map15q26UniSTS
Cytogenetic Map15q25-q26UniSTS
Cytogenetic Map15q25.3-q26.2UniSTS
HuRef1568,656,170 - 68,656,454UniSTS
Marshfield Genetic Map1590.02RGD
Marshfield Genetic Map1590.02UniSTS
deCODE Assembly Map1599.92UniSTS
Is Marker For: QTLs:   SPSL1_H   SCL21_H   PRSTS235_H   PRSTS234_H   INSUL27_H  
Genes:   SLCO3A1   LCS1   OTSC1  


Annotation


References - curated
# Reference Title Reference Citation
1. Comprehensive human genetic maps: individual and sex-specific variation in recombination. Broman KW, etal., Am J Hum Genet 1998 Sep;63(3):861-9.
2. UniSTS Pipeline RGD automated pipelines

Strains and Sequence

Sequence
 
Forward Primer GCAGCACTTGGCAAATACTC
Reverse Primer CATCACTCAAGGCTCAAGGT
 

Region

Nucleotide Sequences
GenBank Nucleotide AC104236 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AC113190 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  CH003462 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  CH003510 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  CH471101 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  CM000266 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  CM000476 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  CM000505 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  CM000677 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  CM001623.1 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  DS486092 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  DS990730 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  FJ515841 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  G07893 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  GL000123 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  GL294062.1 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  GL583023 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  JH976389.1 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles


Additional Information

Database Acc Id Source(s)
NCBI Gene 28232 UniSTS
  431709 UniSTS
  5012 UniSTS
  84565 UniSTS
UniSTS D15S652 UniSTS SSLP Pipeline