D3S3473 Marker Search Result - Rat Genome Database

Send us a Message



Submit Data |  Help |  Video Tutorials |  News |  Publications |  Download |  REST API |  Citing RGD |  Contact   

Marker: D3S3473

Symbol: D3S3473
Previously known as: AFMa176ye9; A176YE9; GDB:594438; W5576; HSA176YE9; SHGC-21594; 
RGD ID: 1339445
Expected Size: 219 (bp)
Position
Human AssemblyChrPosition (strand)SourceJBrowse
GRCh37316,522,348 - 16,522,566UniSTSGRCh37
Build 36316,497,352 - 16,497,570RGDNCBI36
Celera316,461,411 - 16,461,629RGD
Cytogenetic Map3p24.3UniSTS
HuRef316,456,119 - 16,456,337UniSTS
Marshfield Genetic Map342.1RGD
Marshfield Genetic Map342.1UniSTS
Genethon Genetic Map335.8UniSTS
deCODE Assembly Map336.69UniSTS
Stanford-G3 RH Map3794.0UniSTS
Whitehead-YAC Contig Map3 UniSTS
NCBI RH Map3185.3UniSTS
GeneMap99-G3 RH Map3794.0UniSTS
Is Marker For: Genes:   RFTN1  




#
Reference Title
Reference Citation
1. Comprehensive human genetic maps: individual and sex-specific variation in recombination. Broman KW, etal., Am J Hum Genet 1998 Sep;63(3):861-9.
2. UniSTS Pipeline RGD automated pipelines


 
Forward Primer TCAAGGCTGCTTTTATGAATCC
Reverse Primer TACTCAGTCTTGTATGAAAATGGGC
 


1 to 16 of 16 rows
GenBank Nucleotide AC010727 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  CH003450 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  CH003498 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  CH471055 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  CM000254 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  CM000464 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  CM000493 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  CM000665 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  CM001611.1 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  DS486017 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  DS990655 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  GL000033 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  GL297045.1 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  GL583181 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  JH976316.1 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  Z52368 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
1 to 16 of 16 rows



Database
Acc Id
Source(s)
NCBI Gene 23180 UniSTS