D19S224 Marker Search Result - Rat Genome Database

Send us a Message



Submit Data |  Help |  Video Tutorials |  News |  Publications |  Download |  REST API |  Citing RGD |  Contact   

Marker: D19S224

Symbol: D19S224
Previously known as: 240VC1; stSG778; AFM240vc1; SHGC-984; HS240VC1; GDB:188492; 
RGD ID: 1336138
Expected Size: 262 (bp)
Position
Human AssemblyChrPosition (strand)SourceJBrowse
GRCh371936,528,072 - 36,528,329UniSTSGRCh37
GRCh371936,528,073 - 36,528,348UniSTSGRCh37
Build 361941,219,912 - 41,220,169RGDNCBI36
Celera1933,242,251 - 33,242,526UniSTS
Celera1933,242,250 - 33,242,507RGD
Cytogenetic Map19q13.12UniSTS
HuRef1933,033,621 - 33,033,860UniSTS
HuRef1933,033,622 - 33,033,879UniSTS
Marshfield Genetic Map1961.49UniSTS
Marshfield Genetic Map1961.49RGD
Genethon Genetic Map1960.9UniSTS
TNG Radiation Hybrid Map1913073.0UniSTS
GeneMap99-GB4 RH Map19216.14UniSTS
Whitehead-RH Map19267.0UniSTS
NCBI RH Map19362.9UniSTS
Is Marker For: Genes:   THAP8  


Annotation


References - curated
# Reference Title Reference Citation
1. Comprehensive human genetic maps: individual and sex-specific variation in recombination. Broman KW, etal., Am J Hum Genet 1998 Sep;63(3):861-9.
2. UniSTS Pipeline RGD automated pipelines

Strains and Sequence

Sequence
 
Forward Primer AACACCATTCCTCATCTTCC
Reverse Primer CCCAGGCCCTATCTGA
 

Region



Additional Information

Database Acc Id Source(s)
NCBI Gene 199745 UniSTS
UniSTS D19S224 UniSTS SSLP Pipeline