D10Wox11 Marker Search Result - Rat Genome Database

Send us a Message



Submit Data |  Help |  Video Tutorials |  News |  Publications |  Download |  REST API |  Citing RGD |  Contact   

Marker: D10Wox11

Symbol: D10Wox11
Previously known as: oxsts5363; R6; 
RGD ID: 10949
Expected Size: 150 (bp)
Position
Rat AssemblyChrPosition (strand)SourceJBrowse
mRatBN7.21051,786,282 - 51,786,432 (+)MAPPERmRatBN7.2
Rnor_6.01053,637,485 - 53,637,634NCBIRnor6.0
Rnor_5.01053,388,518 - 53,388,667UniSTSRnor5.0
RGSC_v3.41053,792,967 - 53,793,117RGDRGSC3.4
RGSC_v3.41053,792,968 - 53,793,117UniSTSRGSC3.4
RGSC_v3.11053,806,590 - 53,806,740RGD
Celera1050,969,390 - 50,969,539UniSTS
RH 3.4 Map10571.7UniSTS
RH 3.4 Map10571.7RGD
RH 2.0 Map10555.8RGD
Cytogenetic Map10q24UniSTS
Is Marker For: Strains:   SHR.BN-(D10Mit4-D10Wox11)/Cub  
QTLs:   Cm50   Cm51   Stresp6  
Genes:   Myh3  


Annotation


References - curated
# Reference Title Reference Citation
1. Data downloaded from Wellcome Trust, University of Oxford Data downloaded from Wellcome Trust, University of Oxford
2. High-density rat radiation hybrid maps containing over 24,000 SSLPs, genes, and ESTs provide a direct link to the rat genome sequence. Kwitek AE, etal., Genome Res. 2004 Apr;14(4):750-7
3. UniSTS Pipeline RGD automated pipelines
4. RH Map Project RH Map Project, Laboratory of Genetic Research Website, 1-JUL-99, Laboratory of Genetic Research, Medical College of Wisconsin, http://www.lgr.mcw.edu/LGR/
5. A high density integrated genetic linkage and radiation hybrid map of the laboratory rat Steen RG, Kwitek-Black AE, etal., Genome Research, 1999, 6:1-8

Strains and Sequence

Sequence
 
Forward Primer TCATCTGGTGGGGACATAAC
Reverse Primer GATGAACCAGCACATGGAAG
 

Region

Nucleotide Sequences
GenBank Nucleotide X04267 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles


Additional Information

Database Acc Id Source(s)
NCBI Gene 100303153 UniSTS
  24583 UniSTS
  369101 UniSTS
  369104 UniSTS