Symbol: |
Lhx5as1 |
Name: |
LIM homeobox 5, antisense 1 |
RGD ID: |
9642623 |
MGI Page |
MGI |
Description: |
Is expressed in telencephalon. |
Type: |
ncrna (Ensembl: lncRNA)
|
RefSeq Status: |
VALIDATED |
Previously known as: |
Gm27199; Gm31976; predicted gene, 31976 |
Latest Assembly: |
GRCm39 - Mouse Genome Assembly GRCm39 |
Position: |
Mouse Assembly | Chr | Position (strand) | Source | Genome Browsers |
---|
JBrowse | NCBI | UCSC | Ensembl |
---|
GRCm39 | 5 | 120,557,721 - 120,569,832 (-) | NCBI | GRCm39 | GRCm39 | mm39 | | GRCm39 Ensembl | 5 | 120,557,719 - 120,569,865 (-) | Ensembl | | GRCm39 Ensembl | | | GRCm38 | 5 | 120,419,656 - 120,431,767 (-) | NCBI | GRCm38 | GRCm38 | mm10 | GRCm38 | GRCm38.p6 Ensembl | 5 | 120,419,659 - 120,431,767 (-) | Ensembl | GRCm38 | | mm10 | GRCm38 | Celera | 5 | 117,503,664 - 117,515,934 (-) | NCBI | | Celera | | | Cytogenetic Map | 5 | F | NCBI | | | | |
|
JBrowse: |
View Region in Genome Browser (JBrowse)
|
Model |
|
.
Predicted Target Of
Count of predictions: | 115 | Count of miRNA genes: | 113 | Interacting mature miRNAs: | 114 | Transcripts: | ENSMUST00000185026 | Prediction methods: | Miranda, Rnahybrid | Result types: | miRGate_prediction |
10412191 | Bbaa24_m | B.burgdorferi-associated arthritis 24 (mouse) | | | Not determined | | 5 | 119945037 | 141700466 | Mouse | 1301399 | Cpfd3_m | cerebellum pattern fissures (mouse) | | | Not determined | | 5 | 87386871 | 121387065 | Mouse | 25314315 | Mlh1fc4_m | MLH1 foci count 4 (mouse) | | | | | 5 | 74460661 | 132528839 | Mouse | 14746986 | Manh58_m | mandible shape 58 (mouse) | | | | | 5 | 102446283 | 136446283 | Mouse | 1300993 | Hycdc_m | hypercapnic duty cycle (mouse) | | | Not determined | | 5 | 90561006 | 124561151 | Mouse | 1301126 | Bwem1_m | body weight day 30 males 1 (mouse) | | | Not determined | | 5 | 87386871 | 121387065 | Mouse | 1300659 | Pcd8ts1_m | p-glycoprotein positive CD8 T cell subset 1 (mouse) | | | Not determined | | 5 | 97021753 | 131021986 | Mouse | 1300913 | Bwefm_m | body weight females and males day 10 (mouse) | | | Not determined | | 5 | 109439348 | 143439459 | Mouse | 4141081 | Nidd7k_m | Nidd7 on KK-A (mouse) | | | Not determined | | | 119945037 | 149347326 | Mouse | 10402486 | Dipa1_m | drug induced psychomotor activation 1 (mouse) | | | Not determined | | 5 | 95465549 | 129465722 | Mouse | 10043958 | Chldq12_m | cholesterol and HDL QTL 12 (mouse) | | | Not determined | | 5 | 87386871 | 121387065 | Mouse | 26884395 | Humsd2_m | humerus midshaft diameter 2, 10 week (mouse) | | | | | 5 | 70057343 | 132528839 | Mouse | 10412202 | Bbaa26_m | B.burgdorferi-associated arthritis 26 (mouse) | | | Not determined | | 5 | 104583688 | 138555455 | Mouse | 1301543 | Hypch_m | hypercholesterolemia (mouse) | | | Not determined | | 5 | 109238624 | 139118905 | Mouse | 12904945 | Tammq2_m | tibialis anterior muscle mass QTL 2 (mouse) | | | | | 5 | 100665965 | 134665965 | Mouse | 4142473 | Chlq11_m | circulating hormone level QTL 11 (mouse) | | | Not determined | | 5 | 107906299 | 141906412 | Mouse | 11341716 | Rvfs3_m | Rift Valley fever susceptibility 3 (mouse) | | | | | 5 | 26441234 | 138455402 | Mouse | 12904959 | Smmq1_m | soleus muscle mass QTL 1 (mouse) | | | | | 5 | 100665965 | 134665965 | Mouse | 10412197 | Bbaa25_m | B.burgdorferi-associated arthritis 25 (mouse) | | | Not determined | | 5 | 109167240 | 143167381 | Mouse | 13506928 | Recrq8_m | recombination rate in male meiosis QTL 8 (mouse) | | | | | 5 | 74460661 | 132528839 | Mouse | 27226719 | Tibw6_m | tibia width 6, proximal, 16 week (mouse) | | | | | 5 | 72857343 | 139985755 | Mouse | 1301457 | Cfsw2_m | cystic fibrosis survival to weaning 2 (mouse) | | | Not determined | | 5 | 90561006 | 124561151 | Mouse | 1301974 | Chab7_m | cholesterol absorption 7 (mouse) | | | Not determined | | 5 | 95233214 | 129233330 | Mouse | 1300827 | Cora1_m | correlation in cytokine production 1 (mouse) | | | Not determined | | 5 | 115156883 | 149157015 | Mouse | 11528550 | Sluc33_m | susceptibility to lung cancer 33 (mouse) | | | | | 5 | 104386871 | 120711986 | Mouse | 1357662 | Lprq4_m | lipoprotein QTL 4 (mouse) | | | Not determined | | 5 | 114021753 | 129632606 | Mouse | 4142064 | Tmc1m4_m | Tmc1 modifier 4 (mouse) | | | Not determined | | 5 | 54500177 | 127001072 | Mouse | 10412239 | Alpq7_m | alcohol preference QTL 7 (mouse) | | | Not determined | | 5 | 104705939 | 138705939 | Mouse | 1300801 | Drb2_m | dopamine receptor binding 2 (mouse) | | | Not determined | | 5 | 87386871 | 121387065 | Mouse | 9587780 | Afw16_m | abdominal fat weight QTL 16 (mouse) | | | Not determined | | 5 | 92830166 | 126830285 | Mouse | 1357644 | Egrd1_m | early growth rate, direct effect 1 (mouse) | | | Not determined | | 5 | 95434580 | 129434786 | Mouse | 12859290 | Criq2_m | Citrobacter rodentium infection QTL 2 (mouse) | | | | | 5 | 101332579 | 135332579 | Mouse | 1300940 | Actd3_m | activity-distance traveled 3 (mouse) | | | Not determined | | 5 | 96320385 | 130320533 | Mouse | 1301362 | Prnr1_m | prion resistance 1 (mouse) | | | Not determined | | 5 | 89418876 | 146787935 | Mouse | 1558774 | Lith17_m | lithogenic gene 17 (mouse) | | | Not determined | | 5 | 95465549 | 129465722 | Mouse | 1301624 | Aevm2_m | autoimmune extremity vasculitis in MRL mice 2 (mouse) | | | Not determined | | 5 | 101863832 | 135864028 | Mouse | 10043890 | Trigq4_m | triglyceride QTL 4 (mouse) | | | Not determined | | 5 | 107906299 | 141906412 | Mouse | 4141139 | Hmtb4_m | hemostasis and thrombosis rebleeding time 4 (mouse) | | | Not determined | | | 108762509 | 126882944 | Mouse | 11532736 | Sluc33b_m | susceptibility to lung cancer 33b (mouse) | | | | | 5 | 102945037 | 136945196 | Mouse | 4141519 | Hmtb5_m | hemostasis and thrombosis bleeding time 5 (mouse) | | | Not determined | | | 99949422 | 126882944 | Mouse | 1301858 | Smdq1_m | segregation of mitochondrial DNA QTL 1 (mouse) | | | Not determined | | 5 | 97021753 | 131021986 | Mouse | 11049562 | Lmr24f_m | leishmaniasis resistance 24f (mouse) | | | | | 5 | 90320962 | 124321041 | Mouse | 1301857 | Bglq14_m | body growth late QTL 14 (mouse) | | | Not determined | | 5 | 118948964 | 151758149 | Mouse | 13464251 | Ahl21_m | age related hearing loss, early onset 21 (mouse) | | | | | 5 | 109167240 | 143167381 | Mouse | 13464244 | Ahl19_m | age related hearing loss, early onset 19 (mouse) | | | | | 5 | 95465549 | 129465722 | Mouse | 1301226 | Bbaa2_m | B.burgdorferi-associated arthritis 2 (mouse) | | | Not determined | | 5 | 115156883 | 149157015 | Mouse | 1300968 | Skts4_m | skin tumor susceptibility 4 (mouse) | | | Not determined | | 5 | 89418876 | 124238239 | Mouse | 13464241 | Ahl18_m | age related hearing loss, early onset 18 (mouse) | | | | | 5 | 87386871 | 121387065 | Mouse | 1301102 | Cia14_m | collagen induced arthritis 14 (mouse) | | | Not determined | | 5 | 113320385 | 138555455 | Mouse | 13464243 | Ahl20_m | age related hearing loss, early onset 20 (mouse) | | | | | 5 | 107906299 | 141906412 | Mouse |
Ensembl Acc Id: |
ENSMUST00000185026 |
Type: |
CODING |
Position: |
Mouse Assembly | Chr | Position (strand) | Source |
---|
GRCm39 Ensembl | 5 | 120,557,719 - 120,569,865 (-) | Ensembl | GRCm38.p6 Ensembl | 5 | 120,419,659 - 120,431,767 (-) | Ensembl |
|
Ensembl Acc Id: |
ENSMUST00000240834 |
Type: |
CODING |
Position: |
Mouse Assembly | Chr | Position (strand) | Source |
---|
GRCm39 Ensembl | 5 | 120,566,333 - 120,569,861 (-) | Ensembl |
|
Ensembl Acc Id: |
ENSMUST00000245245 |
Type: |
CODING |
Position: |
Mouse Assembly | Chr | Position (strand) | Source |
---|
GRCm39 Ensembl | 5 | 120,561,849 - 120,569,863 (-) | Ensembl |
|
Ensembl Acc Id: |
ENSMUST00000296158 |
Type: |
CODING |
Position: |
Mouse Assembly | Chr | Position (strand) | Source |
---|
GRCm39 Ensembl | 5 | 120,557,719 - 120,569,859 (-) | Ensembl |
|
Ensembl Acc Id: |
ENSMUST00000296159 |
Type: |
CODING |
Position: |
Mouse Assembly | Chr | Position (strand) | Source |
---|
GRCm39 Ensembl | 5 | 120,557,719 - 120,569,818 (-) | Ensembl |
|
Ensembl Acc Id: |
ENSMUST00000296160 |
Type: |
CODING |
Position: |
Mouse Assembly | Chr | Position (strand) | Source |
---|
GRCm39 Ensembl | 5 | 120,557,721 - 120,569,818 (-) | Ensembl |
|
Ensembl Acc Id: |
ENSMUST00000296161 |
Type: |
CODING |
Position: |
Mouse Assembly | Chr | Position (strand) | Source |
---|
GRCm39 Ensembl | 5 | 120,557,721 - 120,569,817 (-) | Ensembl |
|
Ensembl Acc Id: |
ENSMUST00000296162 |
Type: |
CODING |
Position: |
Mouse Assembly | Chr | Position (strand) | Source |
---|
GRCm39 Ensembl | 5 | 120,557,721 - 120,569,816 (-) | Ensembl |
|
Ensembl Acc Id: |
ENSMUST00000296163 |
Type: |
CODING |
Position: |
Mouse Assembly | Chr | Position (strand) | Source |
---|
GRCm39 Ensembl | 5 | 120,557,719 - 120,569,741 (-) | Ensembl |
|
Ensembl Acc Id: |
ENSMUST00000296164 |
Type: |
CODING |
Position: |
Mouse Assembly | Chr | Position (strand) | Source |
---|
GRCm39 Ensembl | 5 | 120,557,721 - 120,569,523 (-) | Ensembl |
|
Ensembl Acc Id: |
ENSMUST00000296165 |
Type: |
CODING |
Position: |
Mouse Assembly | Chr | Position (strand) | Source |
---|
GRCm39 Ensembl | 5 | 120,557,719 - 120,569,220 (-) | Ensembl |
|
Ensembl Acc Id: |
ENSMUST00000296166 |
Type: |
CODING |
Position: |
Mouse Assembly | Chr | Position (strand) | Source |
---|
GRCm39 Ensembl | 5 | 120,557,721 - 120,569,184 (-) | Ensembl |
|
Ensembl Acc Id: |
ENSMUST00000296167 |
Type: |
CODING |
Position: |
Mouse Assembly | Chr | Position (strand) | Source |
---|
GRCm39 Ensembl | 5 | 120,557,721 - 120,565,732 (-) | Ensembl |
|
Ensembl Acc Id: |
ENSMUST00000296168 |
Type: |
CODING |
Position: |
Mouse Assembly | Chr | Position (strand) | Source |
---|
GRCm39 Ensembl | 5 | 120,561,859 - 120,569,661 (-) | Ensembl |
|
Ensembl Acc Id: |
ENSMUST00000296169 |
Type: |
CODING |
Position: |
Mouse Assembly | Chr | Position (strand) | Source |
---|
GRCm39 Ensembl | 5 | 120,557,723 - 120,565,469 (-) | Ensembl |
|
Ensembl Acc Id: |
ENSMUST00000296170 |
Type: |
CODING |
Position: |
Mouse Assembly | Chr | Position (strand) | Source |
---|
GRCm39 Ensembl | 5 | 120,561,859 - 120,569,222 (-) | Ensembl |
|
Ensembl Acc Id: |
ENSMUST00000296171 |
Type: |
CODING |
Position: |
Mouse Assembly | Chr | Position (strand) | Source |
---|
GRCm39 Ensembl | 5 | 120,561,859 - 120,569,165 (-) | Ensembl |
|
Ensembl Acc Id: |
ENSMUST00000296172 |
Type: |
CODING |
Position: |
Mouse Assembly | Chr | Position (strand) | Source |
---|
GRCm39 Ensembl | 5 | 120,557,721 - 120,564,675 (-) | Ensembl |
|
Ensembl Acc Id: |
ENSMUST00000296173 |
Type: |
CODING |
Position: |
Mouse Assembly | Chr | Position (strand) | Source |
---|
GRCm39 Ensembl | 5 | 120,557,719 - 120,564,086 (-) | Ensembl |
|
Ensembl Acc Id: |
ENSMUST00000296174 |
Type: |
CODING |
Position: |
Mouse Assembly | Chr | Position (strand) | Source |
---|
GRCm39 Ensembl | 5 | 120,557,721 - 120,563,280 (-) | Ensembl |
|
Ensembl Acc Id: |
ENSMUST00000296175 |
Type: |
CODING |
Position: |
Mouse Assembly | Chr | Position (strand) | Source |
---|
GRCm39 Ensembl | 5 | 120,566,586 - 120,569,827 (-) | Ensembl |
|
Ensembl Acc Id: |
ENSMUST00000296176 |
Type: |
CODING |
Position: |
Mouse Assembly | Chr | Position (strand) | Source |
---|
GRCm39 Ensembl | 5 | 120,566,586 - 120,569,827 (-) | Ensembl |
|
Ensembl Acc Id: |
ENSMUST00000296177 |
Type: |
CODING |
Position: |
Mouse Assembly | Chr | Position (strand) | Source |
---|
GRCm39 Ensembl | 5 | 120,566,586 - 120,569,823 (-) | Ensembl |
|
Ensembl Acc Id: |
ENSMUST00000296178 |
Type: |
CODING |
Position: |
Mouse Assembly | Chr | Position (strand) | Source |
---|
GRCm39 Ensembl | 5 | 120,566,586 - 120,569,820 (-) | Ensembl |
|
Ensembl Acc Id: |
ENSMUST00000296179 |
Type: |
CODING |
Position: |
Mouse Assembly | Chr | Position (strand) | Source |
---|
GRCm39 Ensembl | 5 | 120,566,586 - 120,569,818 (-) | Ensembl |
|
Ensembl Acc Id: |
ENSMUST00000296180 |
Type: |
CODING |
Position: |
Mouse Assembly | Chr | Position (strand) | Source |
---|
GRCm39 Ensembl | 5 | 120,566,586 - 120,569,673 (-) | Ensembl |
|
Ensembl Acc Id: |
ENSMUST00000296181 |
Type: |
CODING |
Position: |
Mouse Assembly | Chr | Position (strand) | Source |
---|
GRCm39 Ensembl | 5 | 120,561,859 - 120,564,571 (-) | Ensembl |
|
Ensembl Acc Id: |
ENSMUST00000296182 |
Type: |
CODING |
Position: |
Mouse Assembly | Chr | Position (strand) | Source |
---|
GRCm39 Ensembl | 5 | 120,566,586 - 120,569,067 (-) | Ensembl |
|
Ensembl Acc Id: |
ENSMUST00000296183 |
Type: |
CODING |
Position: |
Mouse Assembly | Chr | Position (strand) | Source |
---|
GRCm39 Ensembl | 5 | 120,561,854 - 120,564,135 (-) | Ensembl |
|
Ensembl Acc Id: |
ENSMUST00000296184 |
Type: |
CODING |
Position: |
Mouse Assembly | Chr | Position (strand) | Source |
---|
GRCm39 Ensembl | 5 | 120,561,868 - 120,564,112 (-) | Ensembl |
|
Ensembl Acc Id: |
ENSMUST00000296185 |
Type: |
CODING |
Position: |
Mouse Assembly | Chr | Position (strand) | Source |
---|
GRCm39 Ensembl | 5 | 120,561,865 - 120,563,930 (-) | Ensembl |
|
Ensembl Acc Id: |
ENSMUST00000296186 |
Type: |
CODING |
Position: |
Mouse Assembly | Chr | Position (strand) | Source |
---|
GRCm39 Ensembl | 5 | 120,561,859 - 120,563,907 (-) | Ensembl |
|
Ensembl Acc Id: |
ENSMUST00000296187 |
Type: |
CODING |
Position: |
Mouse Assembly | Chr | Position (strand) | Source |
---|
GRCm39 Ensembl | 5 | 120,561,857 - 120,563,427 (-) | Ensembl |
|
RefSeq Acc Id: |
NR_166585 |
RefSeq Status: |
VALIDATED |
Type: |
NON-CODING |
Position: |
Mouse Assembly | Chr | Position (strand) | Source |
---|
GRCm39 | 5 | 120,557,721 - 120,569,832 (-) | NCBI | GRCm38 | 5 | 120,419,656 - 120,431,767 (-) | NCBI |
|
Sequence: |
ACAGCGTTGCGGTCAGGGCAGAGCAAAAAAAACAAGACATCAGTATTGCCGAGTATTTGCTAGTACCTGTTCCCAAGCTAAGATCTCTCATTGAAGTTGGAGCTCACTGATTCCACTAGACTGTCTGG TCAGCAAGCAATCACCAGGAATCACCTGTAACCGTATCTGCCTGCCGTGACACTCACTGCCGCCTTGAATTATCTATCTATCTATCTATCTATCTATCTATCTATCTATCTATCTATTTATCTTTTTA TTTTCACACAAGCAGTTGGGAATATAACTCATATCCTCATGCCCACGCATCAAGCATGTTCCTAACTGAGCCATCTCCCCAGCTCTTGGAGTTTCTGGGTTTGTTCGGAAGCCTTCTCCCTCCTCCAG AAAGAGGAGTGGAACAGGCACATGTGAATTCACTCTGTTGAGCCTAGAAGAGGTGAAAGAGAAAGGCTGCCCATTTTCTAGATGTTCCTCATGAGCTATATGCGTGTACCACGAAGGCTTGCTTGGAC CCAGAGCTAGGGCTGACCTAACTGAGATGCTACCCAGGGGTTTCTGGCTCACTGTGGCCACCATGGCTCCACAAACCACCTACTTATAACAAAATAAAAAATTTTCTACAAGGA
hide sequence
|
RGD ID: | 15092955 |
Promoter ID: | EPDNEWNC_M862 |
Type: | multiple initiation site |
Name: | Gm27199_1 |
Description: | predicted gene 27199 [Source:MGI Symbol;Acc:MGI:5521042] |
SO ACC ID: | SO:0000170 |
Source: | EPDNEWNC (Eukaryotic Promoter Database, http://epd.vital-it.ch/) |
Experiment Methods: | Single-end sequencing. |
Position: | Mouse Assembly | Chr | Position (strand) | Source |
---|
GRCm38 | 5 | 120,431,762 - 120,431,822 | EPDNEWNC |
|
Date |
Current Symbol |
Current Name |
Previous Symbol |
Previous Name |
Description |
Reference |
Status |
2023-09-25 |
Lhx5as1 |
LIM homeobox 5, antisense 1 |
Gm27199 |
predicted gene 27199 |
Symbol and/or name updated |
27372883 |
PROVISIONAL |
2023-09-14 |
Gm27199 |
predicted gene 27199 |
Gm31976 |
predicted gene, 31976 |
Data merged from RGD:9610706 |
737654 |
PROVISIONAL |
|
|