Symbol:
Mir6341
Name:
microRNA 6341
RGD ID:
9639943
MGI Page
MGI
Description:
microRNAs (miRNAs) are short (20-24 nt) non-coding RNAs that are involved in post-transcriptional regulation of gene expression in multicellular organisms by affecting both the stability and translation of mRNAs. miRNAs are transcribed by RNA polymerase II as part of capped and polyadenylated primary transcripts (pri-miRNAs) that can be either protein-coding or non-coding. The primary transcript is cleaved by the Drosha ribonuclease III enzyme to produce an approximately 70-nt stem-loop precursor miRNA (pre-miRNA), which is further cleaved by the cytoplasmic Dicer ribonuclease to generate the mature miRNA and antisense miRNA star (miRNA*) products. The mature miRNA is incorporated into a RNA-induced silencing complex (RISC), which recognizes target mRNAs through imperfect base pairing with the miRNA and most commonly results in translational inhibition or destabilization of the target mRNA. The RefSeq represents the predicted microRNA stem-loop. [provided by RefSeq, Sep 2009]
Type:
ncrna (Ensembl: miRNA)
RefSeq Status:
PROVISIONAL
Previously known as:
Gm27262; mmu-mir-6341
Latest Assembly:
GRCm39 - Mouse Genome Assembly GRCm39
Position:
Mouse Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl GRCm39 1 12,496,210 - 12,496,330 (+) NCBI GRCm39 GRCm39 mm39 GRCm39 Ensembl 1 12,496,210 - 12,496,330 (+) Ensembl GRCm39 Ensembl GRCm38 1 12,425,986 - 12,426,106 (+) NCBI GRCm38 GRCm38 mm10 GRCm38 GRCm38.p6 Ensembl 1 12,425,986 - 12,426,106 (+) Ensembl GRCm38 mm10 GRCm38 Celera 1 12,381,011 - 12,381,131 (+) NCBI Celera Cytogenetic Map 1 A3 NCBI
JBrowse:
View Region in Genome Browser (JBrowse)
Model
.
Predicted Targets
Count of predictions: 8350 Count of gene targets: 4277 Count of transcripts: 6695 Interacting mature miRNAs: mmu-miR-6341 Prediction methods: Miranda, Pita, Pita,Targetscan, Rnahybrid, Targetscan Result types: miRGate_prediction
11039528 Ccc3_m colitis susceptibility in the Collaborative Cross 3 (mouse) 1 3680142 195051546 Mouse 1301011 Cplaq4_m circadian period of locomotor activity 4 (mouse) Not determined 1 9673442 43673601 Mouse 38501065 Nociq4_m nociceptive sensitivity QTL 4 (mouse) 1 12025069 15142285 Mouse 1301275 Sle10_m systematic lupus erythematosus susceptibility 10 (mouse) Not determined 1 2882194 36882352 Mouse 15092046 Wngrme1_m week nine growth rate, maternal effect 1 (mouse) 1 3280142 37782236 Mouse 1301370 Adip1_m adiposity 1 (mouse) Not determined 1 2882194 36882352 Mouse 13824984 Twq5_m testis weight QTL 5 (mouse) 1 3069992 184732197 Mouse 15092044 Wtgrme1_m week ten growth rate, maternal effect 1 (mouse) 1 3280142 37782236 Mouse 1301471 Obq2_m obesity QTL 2 (mouse) Not determined 1 3941620 37941887 Mouse 14700685 Civq2_m cerebral infarct volume QTL 2 (mouse) 1 11340482 45340482 Mouse 1301891 Alcp25_m alcohol preference locus 25 (mouse) Not determined 1 1 25203185 Mouse 1300834 Cia20_m collagen induced arthritis 20 (mouse) Not determined 1 1 25203185 Mouse 15092055 Lgrme1_m late growth rate, maternal effect 1 (mouse) 1 3280142 37782236 Mouse 15092050 Wsegrme1_m week seven growth rate, maternal effect 1 (mouse) 1 3280142 37782236 Mouse 15092051 Wegrme1_m week eight growth rate, maternal effect 1 (mouse) 1 3280142 37782236 Mouse 15092048 Wsigrme1_m week six growth rate, maternal effect 1 (mouse) 1 3280142 37782236 Mouse 1301482 Morph1_m morphine antinociception 1 (mouse) Not determined 1 1 30367747 Mouse 10043970 Obq23_m obesity QTL 23 (mouse) Not determined 1 5012665 39012665 Mouse 10412226 Alpq4_m alcohol preference QTL 4 (mouse) Not determined 1 1 22976684 Mouse
Click on a value in the shaded box below the category label to view a detailed expression data table for that system.
Ensembl Acc Id:
ENSMUST00000183490
Type:
CODING
Position:
Mouse Assembly Chr Position (strand) Source GRCm39 Ensembl 1 12,496,210 - 12,496,330 (+) Ensembl GRCm38.p6 Ensembl 1 12,425,986 - 12,426,106 (+) Ensembl
RefSeq Acc Id:
NR_105759
RefSeq Status:
PROVISIONAL
Type:
NON-CODING
Position:
Mouse Assembly Chr Position (strand) Source GRCm39 1 12,496,210 - 12,496,330 (+) NCBI GRCm38 1 12,425,986 - 12,426,106 (+) NCBI Celera 1 12,381,011 - 12,381,131 (+) NCBI
Sequence:
TTTTCAACATATCCAAAAATTGAAGGAGCCCAGTGCAATGATATTGTCACTATATGGCTGATAGGCTTCCTCAGGAGATAGTATAACACTGAGGGTCAACTGAATTTTGTGTGTCTGGAGC
hide sequence
