Symbol:
Mir6355
Name:
microRNA 6355
RGD ID:
9639431
MGI Page
MGI
Description:
microRNAs (miRNAs) are short (20-24 nt) non-coding RNAs that are involved in post-transcriptional regulation of gene expression in multicellular organisms by affecting both the stability and translation of mRNAs. miRNAs are transcribed by RNA polymerase II as part of capped and polyadenylated primary transcripts (pri-miRNAs) that can be either protein-coding or non-coding. The primary transcript is cleaved by the Drosha ribonuclease III enzyme to produce an approximately 70-nt stem-loop precursor miRNA (pre-miRNA), which is further cleaved by the cytoplasmic Dicer ribonuclease to generate the mature miRNA and antisense miRNA star (miRNA*) products. The mature miRNA is incorporated into a RNA-induced silencing complex (RISC), which recognizes target mRNAs through imperfect base pairing with the miRNA and most commonly results in translational inhibition or destabilization of the target mRNA. The RefSeq represents the predicted microRNA stem-loop. [provided by RefSeq, Sep 2009]
Type:
ncrna (Ensembl: miRNA)
RefSeq Status:
PROVISIONAL
Previously known as:
Gm27473; mmu-mir-6355
Latest Assembly:
GRCm39 - Mouse Genome Assembly GRCm39
Position:
Mouse Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl GRCm39 18 59,712,702 - 59,712,807 (+) NCBI GRCm39 GRCm39 mm39 GRCm39 Ensembl 18 59,712,702 - 59,712,807 (+) Ensembl GRCm39 Ensembl GRCm38 18 59,579,630 - 59,579,735 (+) NCBI GRCm38 GRCm38 mm10 GRCm38 GRCm38.p6 Ensembl 18 59,579,630 - 59,579,735 (+) Ensembl GRCm38 mm10 GRCm38 Celera 18 60,880,799 - 60,880,904 (+) NCBI Celera Cytogenetic Map 18 D3 NCBI
JBrowse:
View Region in Genome Browser (JBrowse)
Model
.
Predicted Targets
Count of predictions: 5175 Count of gene targets: 2937 Count of transcripts: 4395 Interacting mature miRNAs: mmu-miR-6355 Prediction methods: Miranda, Pita, Rnahybrid, Targetscan Result types: miRGate_prediction
1302163 Bmd16_m bone mineral density 16 (mouse) Not determined 18 29667914 63668060 Mouse 1302099 Hdlq30_m HDL QTL 30 (mouse) Not determined 18 51668300 85668468 Mouse 11252137 Modvl5_m modifier of vacuolated lens 5 (mouse) 18 51052156 85052311 Mouse 12910791 Pwgrq8_m pre-weaning growth rate QTL 8 (mouse) 18 58021399 69349142 Mouse 4141431 Msmr2_m MSM lymphoma resistance 2 (mouse) Not determined 54975873 61238870 Mouse 10412183 Sstapa2_m Suseptibility to Staphylococus aureus infection 2 (mouse) Not determined 18 56794630 66952485 Mouse 10412244 Par5_m pulmonary adenoma resistance 5 (mouse) Not determined 18 51668300 85668468 Mouse 1301400 Lmr13_m leishmaniasis resistance 13 (mouse) Not determined 18 28109380 62109518 Mouse 1301215 Thcr_m T helper cell response (mouse) Not determined 18 45130604 68778777 Mouse 1301853 Heal9_m wound healing/regeneration 9 (mouse) Not determined 18 52805276 86805416 Mouse 25823173 Hrsq12_m host response to SARS QTL 12, hemorrhage (mouse) 18 24895881 78339555 Mouse 1357639 Obsty4_m obesity 4 (mouse) Not determined 18 39619914 84638778 Mouse 4142443 Pgis1_m proteoglycan induced spondylitis 1 (mouse) Not determined 18 53291022 76914293 Mouse 4140971 Mbmq1_m male body mass QTL 1 (mouse) Not determined 57990281 90720763 Mouse 1558849 W3q15_m weight 3 weeks QTL 15 (mouse) Not determined 18 5041119 61272643 Mouse 12880412 V125Dq12_m vitamin D active form serum level QTL 12 (mouse) 18 30233067 64233067 Mouse 1301771 Pcyts6_m plasmacytoma susceptibility 6 (mouse) Not determined 18 35658632 69658851 Mouse 1301902 Hrtfm4_m heart failure modifier 4 (mouse) Not determined 18 43311120 77311343 Mouse 4141857 Mhysq5_m male hybrid sterility QTL 5 (mouse) Not determined 28130604 62130739 Mouse 1300685 Scc5_m colon tumor susceptibility 5 (mouse) Not determined 18 31988480 65988629 Mouse 12880410 V125Dq13_m vitamin D active form serum level QTL 13 (mouse) 18 56433071 90433071 Mouse 4142366 Chlq10_m circulating hormone level QTL 10 (mouse) Not determined 18 36291022 70291180 Mouse 12050070 Nabq2_m nasal bone morphology QTL 2 (mouse) 18 39103677 73103793 Mouse 12880428 V125Dq14_m vitamin D active form serum level QTL 14 (mouse) 18 57433071 90720763 Mouse 1357630 Tgq1_m triglyceride QTL 1 (mouse) Not determined 18 51052156 85052311 Mouse 12880430 Fgf23lq4_m FGF23 serum level QTL 4 (mouse) 18 56433071 90433071 Mouse 11039492 Ltpr8a_m Leishmania tropica response 8a (mouse) 18 59180092 90720763 Mouse 12904745 Carcdq2_m cardiac collagen deposition QTL 2 (mouse) 18 46423287 80423287 Mouse 11039493 Ltpr8d_m Leishmania tropica response 8d (mouse) 18 46874903 80875042 Mouse 1357690 Vtbt19_m vertebral trabecular bone trait 19 (mouse) Not determined 18 33091043 67091221 Mouse 11039494 Ltpr8b_m Leishmania tropica response 8b (mouse) 18 46874903 80875042 Mouse 1301500 Szs4_m seizure susceptibility 4 (mouse) Not determined 18 54975873 85514143 Mouse 11039495 Ltpr8c_m Leishmania tropica response 8c (mouse) 18 59180092 90720763 Mouse 15039381 Ltgq8_m liver triglyceride QTL 8 (mouse) 18 38206569 72206569 Mouse 1302050 Radpf4_m radiation pulmonary fibrosis 4 (mouse) Not determined 18 52966156 68778777 Mouse 12904950 Smmq3_m soleus muscle mass QTL 3 (mouse) 18 26056875 60056875 Mouse 15039383 Mvlq5_m microvesicular liver lesion QTL 5 (mouse) 18 38206569 72206569 Mouse 4141132 Eae18_m experimental allergic encephalomyelitis susceptibility 18 (mouse) Not determined 57590559 82604728 Mouse 11049564 Lmr29_m leishmaniasis resistance 29 (mouse) 18 59180092 90720763 Mouse 1357603 Mom3_m modifier of Min 3 (mouse) Not determined 18 14030023 67098962 Mouse 1301353 Lbw6_m lupus NZB x NZW 6 (mouse) Not determined 18 57562338 90720763 Mouse 27226723 Tibw9_m tibia width 9, proximal, 16 week (mouse) 18 3200000 60933072 Mouse 15039384 Liviq1_m liver inflammation QTL 1 (mouse) 18 38206569 72206569 Mouse 15039386 Mvlq4_m macrovesicular liver lesion QTL 4 (mouse) 18 38206569 72206569 Mouse 27226720 Tibw5_m tibia width 5, proximal, 10 week (mouse) 18 50433067 62633071 Mouse
Click on a value in the shaded box below the category label to view a detailed expression data table for that system.
Ensembl Acc Id:
ENSMUST00000183687
Type:
CODING
Position:
Mouse Assembly Chr Position (strand) Source GRCm39 Ensembl 18 59,712,702 - 59,712,807 (+) Ensembl GRCm38.p6 Ensembl 18 59,579,630 - 59,579,735 (+) Ensembl
RefSeq Acc Id:
NR_105773
RefSeq Status:
PROVISIONAL
Type:
NON-CODING
Position:
Mouse Assembly Chr Position (strand) Source GRCm39 18 59,712,702 - 59,712,807 (+) NCBI GRCm38 18 59,579,630 - 59,579,735 (+) NCBI Celera 18 60,880,799 - 60,880,904 (+) NCBI
Sequence:
AGCTATGCTGTGACATCACAATGCTCCAATGTGATATCACAACTCCATATTGTGCCAACACAGTGCTGTACTGTTTTATTATGATGCTGATTGTGCCAGCATAGTG
hide sequence