Symbol: |
LOC115489760 (Ensembl: Gm25404) |
Name: |
U6 spliceosomal RNA (Ensembl:predicted gene, 25404) |
RGD ID: |
9620908 |
Description: |
|
Type: |
snrna
|
RefSeq Status: |
MODEL |
Previously known as: |
Gm25404; predicted gene, 25404 |
RGD Orthologs |
|
Alliance Orthologs |
|
More Info |
more info ...
|
More Info |
|
Latest Assembly: |
GRCm39 - Mouse Genome Assembly GRCm39 |
Position: |
Mouse Assembly | Chr | Position (strand) | Source | Genome Browsers |
---|
JBrowse | NCBI | UCSC | Ensembl |
---|
GRCm39 | 3 | 55,455,867 - 55,455,973 (+) | NCBI | GRCm39 | GRCm39 | mm39 | | GRCm39 Ensembl | 3 | 55,455,867 - 55,455,973 (+) | Ensembl | | GRCm39 Ensembl | | | GRCm38 | 3 | 55,548,446 - 55,548,552 (+) | NCBI | GRCm38 | GRCm38 | mm10 | GRCm38 | GRCm38.p6 Ensembl | 3 | 55,548,446 - 55,548,552 (+) | Ensembl | GRCm38 | | mm10 | GRCm38 | Celera | 3 | 55,262,006 - 55,266,961 (+) | NCBI | | Celera | | | Cytogenetic Map | 3 | C | NCBI | | | | |
|
JBrowse: |
View Region in Genome Browser (JBrowse)
|
Model |
|
LOC115489760 (Mus musculus - house mouse) |
Mouse Assembly | Chr | Position (strand) | Source | Genome Browsers |
---|
JBrowse | NCBI | UCSC | Ensembl |
---|
GRCm39 | 3 | 55,455,867 - 55,455,973 (+) | NCBI | GRCm39 | GRCm39 | mm39 | | GRCm39 Ensembl | 3 | 55,455,867 - 55,455,973 (+) | Ensembl | | GRCm39 Ensembl | | | GRCm38 | 3 | 55,548,446 - 55,548,552 (+) | NCBI | GRCm38 | GRCm38 | mm10 | GRCm38 | GRCm38.p6 Ensembl | 3 | 55,548,446 - 55,548,552 (+) | Ensembl | GRCm38 | | mm10 | GRCm38 | Celera | 3 | 55,262,006 - 55,266,961 (+) | NCBI | | Celera | | | Cytogenetic Map | 3 | C | NCBI | | | | |
|
RNU6-949P (Homo sapiens - human) |
Human Assembly | Chr | Position (strand) | Source | Genome Browsers |
---|
JBrowse | NCBI | UCSC | Ensembl |
---|
GRCh38 | 1 | 27,675,603 - 27,675,709 (-) | NCBI | GRCh38 | GRCh38 | hg38 | GRCh38 | GRCh38.p14 Ensembl | 1 | 27,675,603 - 27,675,709 (-) | Ensembl | GRCh38 | | hg38 | GRCh38 | GRCh37 | 1 | 28,002,114 - 28,002,220 (-) | NCBI | GRCh37 | GRCh37 | hg19 | GRCh37 | Cytogenetic Map | 1 | p35.3 | NCBI | | | | | T2T-CHM13v2.0 | 1 | 27,516,888 - 27,516,994 (-) | NCBI | | T2T-CHM13v2.0 | | |
|
LOC120100143 (Rattus norvegicus - Norway rat) |
Rat Assembly | Chr | Position (strand) | Source | Genome Browsers |
---|
JBrowse | NCBI | UCSC | Ensembl |
---|
GRCr8 | 1 | 20,147,539 - 20,147,645 (-) | NCBI | | GRCr8 | | | mRatBN7.2 | 1 | 18,328,125 - 18,328,231 (-) | NCBI | mRatBN7.2 | mRatBN7.2 | | | mRatBN7.2 Ensembl | 1 | 18,328,125 - 18,328,231 (-) | Ensembl | | mRatBN7.2 Ensembl | | | Cytogenetic Map | 1 | p12 | NCBI | | | | |
|
.
Predicted Target Of
Count of predictions: | 116 | Count of miRNA genes: | 115 | Interacting mature miRNAs: | 115 | Transcripts: | ENSMUST00000082970 | Prediction methods: | Miranda, Rnahybrid | Result types: | miRGate_prediction |
4142399 | Aec1_m | autoimmune exocrinopathy 1 (mouse) | | | Not determined | | | 7586174 | 102690034 | Mouse | 14746977 | Manh53_m | mandible shape 53 (mouse) | | | | | 3 | 35925280 | 69925280 | Mouse | 26884378 | Skwq6_m | skull length QTL 6, 10 week (mouse) | | | | | 3 | 51907421 | 102307316 | Mouse | 15039332 | Nmrs6_m | NAFLD-associated magnetic resonance shift 6 (mouse) | | | | | 3 | 34170741 | 68170741 | Mouse | 1301585 | Cd4ts1_m | CD4 T cell subset 1 (mouse) | | | Not determined | | 3 | 39704102 | 73704231 | Mouse | 4141116 | Lgaq4_m | late growth adjusted QTL 4 (mouse) | | | Not determined | | | 10249221 | 83184946 | Mouse | 4141563 | Lgq3_m | late growth QTL 3 (mouse) | | | Not determined | | | 10249221 | 83184946 | Mouse | 1357584 | Splq6_m | spleen weight QTL 6 (mouse) | | | Not determined | | 3 | 10249221 | 83184946 | Mouse | 26884382 | Bzwq1_m | bi-zygomatic width QTL 1, 5 week (mouse) | | | | | 3 | 52207421 | 137205761 | Mouse | 11041901 | Lmr11b_m | leishmaniasis resistance 11b (mouse) | | | | | 3 | 39704102 | 73704231 | Mouse | 1357585 | Manln3_m | mandible length 3 (mouse) | | | Not determined | | 3 | 52625509 | 86625745 | Mouse | 26884380 | Skwq1_m | skull length QTL 1, 5 week (mouse) | | | | | 3 | 43954435 | 101607316 | Mouse | 13464139 | Nhdlq17_m | non-HDL QTL 17 (mouse) | | | | | 3 | 52923183 | 86923183 | Mouse | 1300895 | Hdl5_m | HDL level 5 (mouse) | | | Not determined | | 3 | 49495005 | 83495118 | Mouse | 15039336 | Nmrs2_m | NAFLD-associated magnetic resonance shift 2 (mouse) | | | | | 3 | 34576103 | 68576103 | Mouse | 26884436 | Zlq3_m | zygomatic length QTL 3, 10 week (mouse) | | | | | 3 | 3265060 | 142405761 | Mouse | 1301917 | Tshp4_m | tooth shape 4 (mouse) | | | Not determined | | 3 | 52625509 | 86625745 | Mouse | 26884427 | Cvht4_m | cranial vault height 4, 10 week (mouse) | | | | | 3 | 16054164 | 109707316 | Mouse | 1301824 | Susp_m | suppressor of superoxide production (mouse) | | | Not determined | | 3 | 49495005 | 83495118 | Mouse | 1357440 | Hrtpq1_m | heart weight percentage QTL 1 (mouse) | | | Not determined | | 3 | 10249221 | 83184946 | Mouse | 10755516 | Amzn1_m | anatomical modifier of Zfp423 1 (mouse) | | | | | 3 | 39704102 | 73704231 | Mouse | 1558925 | Hivan1_m | HIV-associated nephropathy 1 (mouse) | | | Not determined | | 3 | 7586174 | 68716946 | Mouse | 9587784 | Afw13_m | abdominal fat weight QTL 13 (mouse) | | | Not determined | | 3 | 33752045 | 67752228 | Mouse | 1301705 | Sles3_m | systemic lupus erythmatosus suppressor 3 (mouse) | | | Not determined | | 3 | 37174862 | 143353183 | Mouse | 39128206 | Lwq18_m | liver weight QTL 18 (mouse) | | | | | 3 | 10249221 | 83184946 | Mouse | 13207570 | Tcq12_m | total cholesterol QTL 12 (mouse) | | | | | 3 | 16504164 | 130163649 | Mouse | 26884422 | Cvht7_m | cranial vault height 7, 16 week (mouse) | | | | | 3 | 28954149 | 118893649 | Mouse | 1300593 | Skull4_m | skull morphology 4 (mouse) | | | Not determined | | 3 | 52625509 | 86625745 | Mouse | 4141079 | Ath23_m | atherosclerosis 23 (mouse) | | | Not determined | | | 49357581 | 83357581 | Mouse | 18337272 | Bmd46_m | bone mineral density 46, males (mouse) | | | | | 3 | 35407421 | 69407421 | Mouse | 11039513 | Ltpr3a_m | Leishmania tropica response 3a (mouse) | | | | | 3 | 39704102 | 73704231 | Mouse | 1300961 | Bh4p_m | bar holding four paws (mouse) | | | Not determined | | 3 | 31837854 | 65837997 | Mouse | 10043882 | Bwtq13_m | body weight QTL 13 (mouse) | | | Not determined | | 3 | 33752045 | 67752228 | Mouse | 10412073 | Ssen2_m | suseptibility to Sendai virus 2 (mouse) | | | Not determined | | 3 | 33535465 | 67535615 | Mouse | 4141255 | W10q3_m | weight 10 weeks QTL 3 (mouse) | | | Not determined | | | 10249221 | 83184946 | Mouse | 12910781 | Pwgrq12_m | post-weaning growth rate QTL 12 (mouse) | | | | | 3 | 32635760 | 58017363 | Mouse | 1300587 | Aod2_m | autoimmune ovarian dysgenesis 2 (mouse) | | | Not determined | | 3 | 37179742 | 68716946 | Mouse | 1302056 | Orgwq4_m | organ weight QTL 4 (mouse) | | | Not determined | | 3 | 30067588 | 147304689 | Mouse | 12910778 | Pwgrq13_m | post-weaning growth rate QTL 13 (mouse) | | | | | 3 | 32635760 | 58017363 | Mouse | 13208566 | Bmiq5_m | body mass index QTL 5 (mouse) | | | | | 3 | 40954435 | 115793649 | Mouse | 26884389 | Skwq10_m | skull length QTL 10, 16 week (mouse) | | | | | 3 | 43954435 | 65307421 | Mouse |
Ensembl Acc Id: |
ENSMUST00000082970 |
Type: |
CODING |
Position: |
Mouse Assembly | Chr | Position (strand) | Source |
---|
GRCm39 Ensembl | 3 | 55,455,867 - 55,455,973 (+) | Ensembl | GRCm38.p6 Ensembl | 3 | 55,548,446 - 55,548,552 (+) | Ensembl |
|
RefSeq Acc Id: |
XR_004941644 |
Type: |
NON-CODING |
Position: |
Mouse Assembly | Chr | Position (strand) | Source |
---|
GRCm39 | 3 | 55,455,867 - 55,455,973 (+) | NCBI |
|
Sequence: |
GTGCTCGCTTCGGCAGCACATATACTAAAATTGGAAAGATACAGAGAAGATTAACATGGCCCCTGTGCAAGGATGACATGCAAGTTCGTGAAGCATTCCATATTTTT
hide sequence
|
Date |
Current Symbol |
Current Name |
Previous Symbol |
Previous Name |
Description |
Reference |
Status |
2020-06-19 |
LOC115489760 |
U6 spliceosomal RNA |
Gm25404 |
predicted gene, 25404 |
Symbol and/or name change |
5135510 |
APPROVED |
|
|