Symbol:
Mir7070
Name:
microRNA 7070
RGD ID:
9617115
MGI Page
MGI
Description:
microRNAs (miRNAs) are short (20-24 nt) non-coding RNAs that are involved in post-transcriptional regulation of gene expression in multicellular organisms by affecting both the stability and translation of mRNAs. miRNAs are transcribed by RNA polymerase II as part of capped and polyadenylated primary transcripts (pri-miRNAs) that can be either protein-coding or non-coding. The primary transcript is cleaved by the Drosha ribonuclease III enzyme to produce an approximately 70-nt stem-loop precursor miRNA (pre-miRNA), which is further cleaved by the cytoplasmic Dicer ribonuclease to generate the mature miRNA and antisense miRNA star (miRNA*) products. The mature miRNA is incorporated into a RNA-induced silencing complex (RISC), which recognizes target mRNAs through imperfect base pairing with the miRNA and most commonly results in translational inhibition or destabilization of the target mRNA. The RefSeq represents the predicted microRNA stem-loop. [provided by RefSeq, Sep 2009]
Type:
ncrna (Ensembl: miRNA)
RefSeq Status:
PROVISIONAL
Previously known as:
Gm27565; mmu-mir-7070
Latest Assembly:
GRCm39 - Mouse Genome Assembly GRCm39
Position:
Mouse Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl GRCm39 8 85,788,715 - 85,788,800 (+) NCBI GRCm39 GRCm39 mm39 GRCm39 Ensembl 8 85,788,715 - 85,788,800 (+) Ensembl GRCm39 Ensembl GRCm38 8 85,062,086 - 85,062,171 (+) NCBI GRCm38 GRCm38 mm10 GRCm38 GRCm38.p6 Ensembl 8 85,062,086 - 85,062,171 (+) Ensembl GRCm38 mm10 GRCm38 Celera 8 89,356,836 - 89,356,920 (+) NCBI Celera Cytogenetic Map 8 C3 NCBI
JBrowse:
View Region in Genome Browser (JBrowse)
Model
.
Predicted Targets
Count of predictions: 36856 Count of gene targets: 13999 Count of transcripts: 25393 Interacting mature miRNAs: mmu-miR-7070-3p, mmu-miR-7070-5p Prediction methods: Miranda, Rnahybrid, Targetscan Result types: miRGate_prediction
10043992 Hbnr11_m Heligmosomoides bakeri nematode resistance 11 (mouse) Not determined 8 66326836 100326976 Mouse 1301013 Capsq4_m capsaicin sensitivity related QTL 4 (mouse) Not determined 8 36630154 93455280 Mouse 12904012 Cfq10_m conditioned fear QTL 10 (mouse) 8 80793404 89740987 Mouse 11353828 Gf7_m gonadal fat pad weight 7 (mouse) 8 58928107 92928107 Mouse 1357470 Obq16_m obesity QTL 16 (mouse) Not determined 8 76411976 110412125 Mouse 1558875 Eae31_m experimental allergic encephalomyelitis susceptibility 31 (mouse) Not determined 8 35109930 115563747 Mouse 1357787 Vtbt5_m vertebral trabecular bone trait 5 (mouse) Not determined 8 66084397 100084549 Mouse 1301506 Aevm1_m autoimmune extremity vasculitis in MRL mice 1 (mouse) Not determined 8 54740461 88740637 Mouse 1301952 Im3_m immunoregulatory 3 (mouse) Not determined 8 55159258 89159407 Mouse 1301767 Fcsa2_m femoral cross-sectional area 2 (mouse) Not determined 8 71032003 105032123 Mouse 10412234 Nhdlq14_m non-HDL QTL 14 (mouse) Not determined 8 76411976 110412125 Mouse 1301766 Desp1_m despair 1 (mouse) Not determined 8 85486208 119486373 Mouse 4140967 Bmd39_m bone mineral density 39 (mouse) Not determined 8 32506572 117965439 Mouse 1357708 Orq1_m ovulation rate QTL 1 (mouse) Not determined 8 71740461 124622354 Mouse 4141285 Tgq18_m triglyceride QTL 18 (mouse) Not determined 64186736 98186736 Mouse 4141797 Skmw16_m skeletal muscle weight 16 (mouse) Not determined 8 64666176 98666325 Mouse 10755519 Wbc1_m white blood cell count 1 (mouse) 8 82345783 116345783 Mouse 27226754 Femd6_m femur midshaft diameter 6, 10 week (mouse) 8 37867154 110326632 Mouse 10043975 Obq31_m obesity QTL 31 (mouse) Not determined 8 59136404 93136404 Mouse 1301581 Char2_m P. chabaudi malaria resistance QTL 2 (mouse) Not determined 8 79808806 113809031 Mouse 10412287 Carg3_m Candida albicans resistance gene 3 (mouse) Not determined 8 56298872 90298872 Mouse 1301874 Hdlq16_m HDL QTL 16 (mouse) Not determined 8 76411976 110412125 Mouse 1301872 Cd4ts3_m CD4 T cell subset 3 (mouse) Not determined 8 72122809 106123021 Mouse 1301688 Orch6_m autoimmune orchitis resistance 6 (mouse) Not determined 8 61513479 95513605 Mouse 1558780 Idd22_m insulin dependent diabetes susceptibility 22 (mouse) Not determined 8 71829531 105829637 Mouse 1300920 Pitm3_m prion incubation time 3 (mouse) Not determined 8 73929123 107929226 Mouse 12904744 Carcdq1_m cardiac collagen deposition QTL 1 (mouse) 8 40162297 95416226 Mouse 4141395 Char2a_m P. chabaudi malaria resistance QTL 2a (mouse) Not determined 71589427 90929226 Mouse 14700686 Civq3_m cerebral infarct volume QTL 3 (mouse) 8 52334843 86334843 Mouse 10755530 Wbc2_m white blood cell count 2 (mouse) 8 81819296 115819296 Mouse 4142283 Imraq2_m immune response to AAV2 QTL 2 (mouse) Not determined 8 71032003 105032123 Mouse 27095912 Pglq14_m pelvic girdle length QTL 14, 16 week (mouse) 8 74126628 126826739 Mouse 4142023 W3q5_m weight 3 weeks QTL 5 (mouse) Not determined 71740461 124622354 Mouse 1301099 Cbm2_m cerebellum weight 2 (mouse) Not determined 8 79245241 113245331 Mouse 1558890 Lith18_m lithogenic gene 18 (mouse) Not determined 8 76402145 110402251 Mouse
Click on a value in the shaded box below the category label to view a detailed expression data table for that system.
Ensembl Acc Id:
ENSMUST00000183657
Type:
CODING
Position:
Mouse Assembly Chr Position (strand) Source GRCm39 Ensembl 8 85,788,715 - 85,788,800 (+) Ensembl GRCm38.p6 Ensembl 8 85,062,086 - 85,062,171 (+) Ensembl
RefSeq Acc Id:
NR_106038
RefSeq Status:
PROVISIONAL
Type:
NON-CODING
Position:
Mouse Assembly Chr Position (strand) Source GRCm39 8 85,788,715 - 85,788,800 (+) NCBI GRCm38 8 85,062,086 - 85,062,171 (+) NCBI Celera 8 89,356,836 - 89,356,920 (+) NCBI
Sequence:
GTGAGGGGAGCTGAGGCAGGAGGCCAAGCAGGCTAGGAGGTGAGGAACCTCAAGGATAACTAACTCCAGGCTCTCCTTCCCTCCAG
hide sequence
