Symbol:
Mir6340
Name:
microRNA 6340
RGD ID:
9610385
MGI Page
MGI
Description:
microRNAs (miRNAs) are short (20-24 nt) non-coding RNAs that are involved in post-transcriptional regulation of gene expression in multicellular organisms by affecting both the stability and translation of mRNAs. miRNAs are transcribed by RNA polymerase II as part of capped and polyadenylated primary transcripts (pri-miRNAs) that can be either protein-coding or non-coding. The primary transcript is cleaved by the Drosha ribonuclease III enzyme to produce an approximately 70-nt stem-loop precursor miRNA (pre-miRNA), which is further cleaved by the cytoplasmic Dicer ribonuclease to generate the mature miRNA and antisense miRNA star (miRNA*) products. The mature miRNA is incorporated into a RNA-induced silencing complex (RISC), which recognizes target mRNAs through imperfect base pairing with the miRNA and most commonly results in translational inhibition or destabilization of the target mRNA. The RefSeq represents the predicted microRNA stem-loop. [provided by RefSeq, Sep 2009]
Type:
ncrna (Ensembl: miRNA)
RefSeq Status:
PROVISIONAL
Previously known as:
Gm27909; mmu-mir-6340
Latest Assembly:
GRCm39 - Mouse Genome Assembly GRCm39
Position:
Mouse Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl GRCm39 2 173,542,823 - 173,542,941 (-) NCBI GRCm39 GRCm39 mm39 GRCm39 Ensembl 2 173,542,823 - 173,542,941 (-) Ensembl GRCm39 Ensembl GRCm38 2 173,701,030 - 173,701,148 (-) NCBI GRCm38 GRCm38 mm10 GRCm38 GRCm38.p6 Ensembl 2 173,701,030 - 173,701,148 (-) Ensembl GRCm38 mm10 GRCm38 Celera 2 179,668,879 - 179,668,997 (-) NCBI Celera Cytogenetic Map 2 H4 NCBI
JBrowse:
View Region in Genome Browser (JBrowse)
Model
.
Predicted Targets
Count of predictions: 16546 Count of gene targets: 7565 Count of transcripts: 12378 Interacting mature miRNAs: mmu-miR-6340 Prediction methods: Miranda, Pita, Pita,Targetscan, Rnahybrid, Targetscan Result types: miRGate_prediction
1300688 Nidd2k_m Nidd2 on KK-A (mouse) Not determined 2 158078337 178442452 Mouse 1301783 Bhr1_m bronchial hyperresponsiveness 1 (mouse) Not determined 2 142593476 178442452 Mouse 12790983 Bwq12_m body weight QTL 12 (mouse) 2 148238204 181755017 Mouse 11038701 Ltpr2e_m Leishmania tropica response 2e (mouse) 2 150212221 181755017 Mouse 1301019 Bmd6_m bone mineral density 6 (mouse) Not determined 2 151778297 181755017 Mouse 4142450 Lmr16_m leishmaniasis resistance 16 (mouse) Not determined 2 150212221 181755017 Mouse 1301085 Lrnx10_m learning-contextual 10 (mouse) Not determined 2 150212221 181755017 Mouse 11353826 Bdln10_m body length 10 (mouse) 2 140441482 174441482 Mouse 1300867 Lore2_m loss of righting induced by ethanol 2 (mouse) Not determined 2 144515861 180896594 Mouse 1558917 Gct8_m granulosa cell tumorigenesis 8 (mouse) Not determined 2 149236907 181755017 Mouse 1300806 Aod4_m autoimmune ovarian dysgenesis 4 (mouse) Not determined 2 145228719 179228841 Mouse 1300676 Prdt2_m prion disease incubation time 2 (mouse) Not determined 2 164515154 181755017 Mouse 1558991 Tailq4_m tail length QTL 4 (mouse) Not determined 2 162736926 178442452 Mouse 14747002 Mancz3_m mandible centroid size 3 (mouse) 2 152329820 181755017 Mouse 1300751 Bdt1_m bone density traits 1 (mouse) Not determined 2 149988902 181755017 Mouse 1300622 Cfld1_m cystic fibrosis lung disease 1 (mouse) Not determined 2 155823920 181755017 Mouse 12910811 Pwbwq3_m pre-weaning body weight QTL 3 (mouse) 2 169794802 178920791 Mouse 1302003 Sluc17_m susceptibility to lung cancer 17 (mouse) Not determined 2 162433493 181755017 Mouse 1301618 Bglu1_m blood glucose level 1 (mouse) Not determined 2 117942930 174324863 Mouse 12738409 Lfibq1_m liver fibrosis QTL 1 (mouse) 2 167716420 179207088 Mouse 1302013 Tbbmd3_m total body bone mineral density 3 (mouse) Not determined 2 145196949 179197085 Mouse 5491196 Mobq6_m multigenic obesity QTL 6 (mouse) Not determined 2 85724269 180896594 Mouse 1357435 Epfq2_m epididymal fat pad weight QTL 2 (mouse) Not determined 2 162736926 178442452 Mouse 12801456 Intmrm1_m intima/media ratio modifier 1 (mouse) 2 142428347 176428450 Mouse 1357537 Lith12_m lithogenic gene 12 (mouse) Not determined 2 156196464 181755017 Mouse 12801461 Intim1_m intima modifier 1 (mouse) 2 142428347 176428450 Mouse 1301348 Alcp5_m alcohol preference locus 5 (mouse) Not determined 2 163486407 181755017 Mouse 1301865 Hdlq19_m HDL QTL 19 (mouse) Not determined 2 145518775 179518926 Mouse 4142211 Nilac3_m nicotine induced locomotor activity 3 (mouse) Not determined 2 148664893 181755017 Mouse 12910520 Scgq3_m spontaneous crescentic glomerulonephritis QTL 3 (mouse) 2 151709273 174389124 Mouse 1301677 Alcp6_m alcohol preference locus 6 (mouse) Not determined 2 163486407 181755017 Mouse
Click on a value in the shaded box below the category label to view a detailed expression data table for that system.
Ensembl Acc Id:
ENSMUST00000183857
Type:
CODING
Position:
Mouse Assembly Chr Position (strand) Source GRCm39 Ensembl 2 173,542,823 - 173,542,941 (-) Ensembl GRCm38.p6 Ensembl 2 173,701,030 - 173,701,148 (-) Ensembl
RefSeq Acc Id:
NR_105758
RefSeq Status:
PROVISIONAL
Type:
NON-CODING
Position:
Mouse Assembly Chr Position (strand) Source GRCm39 2 173,542,823 - 173,542,941 (-) NCBI GRCm38 2 173,701,030 - 173,701,148 (-) NCBI Celera 2 179,668,879 - 179,668,997 (-) NCBI
Sequence:
CTTCTTCCTCAAGGTCAGGCCCTGGGTCGTCAGCAGCAGCTTCGCTTTGGCTCCGATGGCTGTCTTCGGAGTTTGAAGCCCTTGCCGCCAGACGCTGGGTTGGCATCAGTGGATGGAAT
hide sequence
