Symbol:
Mir7040
Name:
microRNA 7040
RGD ID:
9599844
MGI Page
MGI
Description:
microRNAs (miRNAs) are short (20-24 nt) non-coding RNAs that are involved in post-transcriptional regulation of gene expression in multicellular organisms by affecting both the stability and translation of mRNAs. miRNAs are transcribed by RNA polymerase II as part of capped and polyadenylated primary transcripts (pri-miRNAs) that can be either protein-coding or non-coding. The primary transcript is cleaved by the Drosha ribonuclease III enzyme to produce an approximately 70-nt stem-loop precursor miRNA (pre-miRNA), which is further cleaved by the cytoplasmic Dicer ribonuclease to generate the mature miRNA and antisense miRNA star (miRNA*) products. The mature miRNA is incorporated into a RNA-induced silencing complex (RISC), which recognizes target mRNAs through imperfect base pairing with the miRNA and most commonly results in translational inhibition or destabilization of the target mRNA. The RefSeq represents the predicted microRNA stem-loop. [provided by RefSeq, Sep 2009]
Type:
ncrna (Ensembl: miRNA)
RefSeq Status:
PROVISIONAL
Previously known as:
Gm27489; mmu-mir-7040
Latest Assembly:
GRCm39 - Mouse Genome Assembly GRCm39
Position:
Mouse Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl GRCm39 6 83,026,692 - 83,026,754 (+) NCBI GRCm39 GRCm39 mm39 GRCm39 Ensembl 6 83,026,692 - 83,026,754 (+) Ensembl GRCm39 Ensembl GRCm38 6 83,049,711 - 83,049,773 (+) NCBI GRCm38 GRCm38 mm10 GRCm38 GRCm38.p6 Ensembl 6 83,049,711 - 83,049,773 (+) Ensembl GRCm38 mm10 GRCm38 Celera 6 85,032,298 - 85,032,360 (+) NCBI Celera Cytogenetic Map 6 C3 NCBI
JBrowse:
View Region in Genome Browser (JBrowse)
Model
.
Predicted Targets
Count of predictions: 17202 Count of gene targets: 7866 Count of transcripts: 12838 Interacting mature miRNAs: mmu-miR-7040-3p, mmu-miR-7040-5p Prediction methods: Miranda, Rnahybrid, Targetscan Result types: miRGate_prediction
4142271 Egq8_m early growth QTL 8 (mouse) Not determined 4503823 96633110 Mouse 1301521 Pas1c_m pulmonary adenoma susceptibility 1c (mouse) Not determined 6 71958006 105958152 Mouse 14697704 Stsl4_m Salmonella typhimurium susceptibility locus 4 (mouse) 6 77076983 89976982 Mouse 10412119 Stv_m striatal volumne (mouse) Not determined 6 60026991 100026967 Mouse 1300954 Fcsa1_m femoral cross-sectional area 1 (mouse) Not determined 6 71958006 105958152 Mouse 13824985 Alh1_m amplitude of lateral head displacement 1 (mouse) 6 77976983 96976961 Mouse 4142259 Tabw2_m tally ho associated body weight 2 (mouse) Not determined 46912919 136400690 Mouse 25314319 Histh6_m histamine hypersensitivity 6 (mouse) 6 48696934 125336963 Mouse 12792979 Fbmd2_m femoral bone mineral density 2, females only (mouse) 6 75026989 115026943 Mouse 1301571 Arrd1_m age-related retinal degeneration 1 (mouse) Not determined 6 75521339 92584431 Mouse 4142126 W3q3_m weight 3 weeks QTL 3 (mouse) Not determined 4503823 96633110 Mouse 1300674 Nidd3n_m non-insulin-dependent diabetes mellitus 3 in NSY (mouse) Not determined 6 75521339 94202936 Mouse 25314320 Histh5_m histamine hypersensitivity 5 (mouse) 6 48696934 148351498 Mouse 1301254 Skts11_m skin tumor susceptibility 11 (mouse) Not determined 6 51156134 85156284 Mouse 1558977 Skmw10_m skeletal muscle weight 10 (mouse) Not determined 6 58424566 92424693 Mouse 1300869 Stheal5_m soft tissue heal 5 (mouse) Not determined 6 71552042 105552160 Mouse 1302020 Bbaa20_m B.burgdorferi-associated arthritis 20 (mouse) Not determined 6 71299605 93441074 Mouse 1300618 Pgia19_m proteoglycan induced arthritis 19 (mouse) Not determined 6 45290993 87403016 Mouse 1301962 Eila2_m ethanol induced locomotor activity 2 (mouse) Not determined 6 48703490 125333748 Mouse 4141990 Etax6_m ethanol induced ataxia 6 (mouse) Not determined 71299605 86252701 Mouse 4141028 Mclr_m methylcholanthrene lymphoma resistance (mouse) Not determined 54350411 88356155 Mouse 1301320 Ots1_m ovarian teratoma susceptibility 1 (mouse) Not determined 6 75424566 104480516 Mouse 10043972 Obq28_m obesity QTL 28 (mouse) Not determined 6 58517416 92517416 Mouse 1300556 Cia6_m collagen induced arthritis QTL 6 (mouse) Not determined 6 4464884 87403016 Mouse 1558984 Cplaq9_m circadian period of locomotor activity 9 (mouse) Not determined 6 38646560 92584431 Mouse 10412157 Fl1n_m fatty liver 1 in NSY (mouse) Not determined 6 45290993 128811995 Mouse 25440480 Moaq2_m modifier of alien QTL 2 (mouse) 6 3050001 117476961 Mouse 26884414 Bzwq12_m bi-zygomatic width QTL 12, 16 week (mouse) 6 3400000 139076998 Mouse 10043901 Pfat5_m predicted fat percentage 5 (mouse) Not determined 6 75584287 109584431 Mouse 4142361 W10q11_m weight 10 weeks QTL 11 (mouse) Not determined 4503823 96633110 Mouse 1301813 Skl3_m skeletal size (tail length) 3 (mouse) Not determined 6 70402880 104403016 Mouse 4142232 W6q4_m weight 6 weeks QTL 4 (mouse) Not determined 4503823 96633110 Mouse 1357683 Igf1sl1_m IGF-1 serum levels 1 (mouse) Not determined 6 52138693 116132228 Mouse 1301876 Bits2_m bitterness sensitivity 2 (mouse) Not determined 6 70402880 104403016 Mouse 1357875 Pfat2_m predicted fat percentage 2 (mouse) Not determined 6 76440930 110441074 Mouse 15039373 Adip28_m adiposity 28 (mouse) 6 56285194 90285194 Mouse 15039375 Bw41_m body weight QTL 41 (mouse) 6 56285194 90285194 Mouse 1301369 Im4_m immunoregulatory 4 (mouse) Not determined 6 63461721 97461888 Mouse 10412208 Cypr4_m cytokine production 4 (mouse) Not determined 6 75693484 109693678 Mouse 1300650 Bw18_m body weight QTL 18 (mouse) Not determined 6 66690851 100691013 Mouse 1301034 Egrm2_m early growth rate (mouse) Not determined 6 70402880 104403016 Mouse 14696731 Pairq1_m P. aeruginosa infection resistance QTL 1 (mouse) 6 81476981 102176961 Mouse 13506930 Recrq9_m recombination rate in male meiosis QTL 9 (mouse) 6 73476983 134676963 Mouse 10412195 Efw_m epididymal fat weight (mouse) Not determined 6 75521339 94202936 Mouse 1301740 Bwq2_m body weight QTL 2 (mouse) Not determined 6 60034663 94034782 Mouse 4141376 Dbm1_m diabetes modifier 1 (mouse) Not determined 6 78606487 121092347 Mouse
Click on a value in the shaded box below the category label to view a detailed expression data table for that system.
Ensembl Acc Id:
ENSMUST00000184661
Type:
CODING
Position:
Mouse Assembly Chr Position (strand) Source GRCm39 Ensembl 6 83,026,692 - 83,026,754 (+) Ensembl GRCm38.p6 Ensembl 6 83,049,711 - 83,049,773 (+) Ensembl
RefSeq Acc Id:
NR_106007
RefSeq Status:
PROVISIONAL
Type:
NON-CODING
Position:
Mouse Assembly Chr Position (strand) Source GRCm39 6 83,026,692 - 83,026,754 (+) NCBI GRCm38 6 83,049,711 - 83,049,773 (+) NCBI Celera 6 85,032,298 - 85,032,360 (+) NCBI
Sequence:
TCTCCCATACGGAGGGAGATGGAGGCGCCCTCAGTGGTAACCGCCACCCTCTCTCTCACGTAG
hide sequence
RGD ID: 6890112
Promoter ID: EPDNEW_M8506
Type: single initiation site
Name: Mir7040_1
Description: Mus musculus microRNA 7040 , microRNA.
SO ACC ID: SO:0000170
Source: EPDNEW (Eukaryotic Promoter Database, http://epd.vital-it.ch/ )
Experiment Methods: Single-end sequencing.
Position: Mouse Assembly Chr Position (strand) Source GRCm38 6 83,049,759 - 83,049,819 EPDNEW