Symbol: |
MIR6125 |
Name: |
microRNA 6125 |
RGD ID: |
8551217 |
HGNC Page |
HGNC:49931 |
Description: |
Located in extracellular exosome. |
Type: |
ncrna (Ensembl: miRNA)
|
RefSeq Status: |
PROVISIONAL |
Previously known as: |
hsa-mir-6125; mir-6125 |
Allele / Splice: |
See ClinVar data |
Latest Assembly: |
GRCh38 - Human Genome Assembly GRCh38 |
Position: |
Human Assembly | Chr | Position (strand) | Source | Genome Browsers |
---|
JBrowse | NCBI | UCSC | Ensembl |
---|
GRCh38 | 12 | 62,260,359 - 62,260,454 (+) | NCBI | GRCh38 | GRCh38 | hg38 | GRCh38 | GRCh38.p14 Ensembl | 12 | 62,260,359 - 62,260,454 (+) | Ensembl | GRCh38 | | hg38 | GRCh38 | GRCh37 | 12 | 62,654,140 - 62,654,235 (+) | NCBI | GRCh37 | GRCh37 | hg19 | GRCh37 | Cytogenetic Map | 12 | q14.1 | NCBI | | | | | HuRef | 12 | 59,705,076 - 59,705,171 (+) | NCBI | | HuRef | | | CHM1_1 | 12 | 62,622,050 - 62,622,145 (+) | NCBI | | CHM1_1 | | | T2T-CHM13v2.0 | 12 | 62,239,173 - 62,239,268 (+) | NCBI | | T2T-CHM13v2.0 | | |
|
JBrowse: |
View Region in Genome Browser (JBrowse)
|
Model |
|
.
Predicted Targets
Count of predictions: | 11193 | Count of gene targets: | 5408 | Count of transcripts: | 9808 | Interacting mature miRNAs: | hsa-miR-6125 | Prediction methods: | Microtar, Miranda, Pita, Rnahybrid, Targetscan | Result types: | miRGate_prediction |
Ensembl Acc Id: |
ENST00000618986 |
Type: |
CODING |
Position: |
Human Assembly | Chr | Position (strand) | Source |
---|
GRCh38.p14 Ensembl | 12 | 62,260,359 - 62,260,454 (+) | Ensembl |
|
RefSeq Acc Id: |
NR_106740 |
RefSeq Status: |
PROVISIONAL |
Type: |
NON-CODING |
Position: |
Human Assembly | Chr | Position (strand) | Source |
---|
GRCh38 | 12 | 62,260,359 - 62,260,454 (+) | NCBI | HuRef | 12 | 59,705,076 - 59,705,171 (+) | NCBI | CHM1_1 | 12 | 62,622,050 - 62,622,145 (+) | NCBI | T2T-CHM13v2.0 | 12 | 62,239,173 - 62,239,268 (+) | NCBI |
|
Sequence: |
GCTCTGGGGCGTGCCGCCGCCGTCGCTGCCACCTCCCCTACCGCTAGTGGAAGAAGATGGCGGAAGGCGGAGCGGCGGATCTGGACACCCAGCGGT
hide sequence
|
|
|