Symbol: |
MIR4732 |
Name: |
microRNA 4732 |
RGD ID: |
5134065 |
HGNC Page |
HGNC:41639 |
Description: |
Located in extracellular space. |
Type: |
ncrna (Ensembl: miRNA)
|
RefSeq Status: |
PROVISIONAL |
Previously known as: |
mir-4732 |
Allele / Splice: |
See ClinVar data |
Latest Assembly: |
GRCh38 - Human Genome Assembly GRCh38 |
Position: |
Human Assembly | Chr | Position (strand) | Source | Genome Browsers |
---|
JBrowse | NCBI | UCSC | Ensembl |
---|
GRCh38 | 17 | 28,861,655 - 28,861,730 (-) | NCBI | GRCh38 | GRCh38 | hg38 | GRCh38 | GRCh38.p14 Ensembl | 17 | 28,861,655 - 28,861,730 (-) | Ensembl | GRCh38 | | hg38 | GRCh38 | GRCh37 | 17 | 27,188,673 - 27,188,748 (-) | NCBI | GRCh37 | GRCh37 | hg19 | GRCh37 | Cytogenetic Map | 17 | q11.2 | NCBI | | | | | HuRef | 17 | 23,396,963 - 23,397,038 (-) | NCBI | | HuRef | | | CHM1_1 | 17 | 27,251,187 - 27,251,262 (-) | NCBI | | CHM1_1 | | | T2T-CHM13v2.0 | 17 | 29,804,428 - 29,804,503 (-) | NCBI | | T2T-CHM13v2.0 | | |
|
JBrowse: |
View Region in Genome Browser (JBrowse)
|
Model |
|
.
Predicted Targets
Count of predictions: | 31312 | Count of gene targets: | 12003 | Count of transcripts: | 24019 | Interacting mature miRNAs: | hsa-miR-4732-3p, hsa-miR-4732-5p | Prediction methods: | Microtar, Miranda, Pita, Rnahybrid, Targetscan | Result types: | miRGate_prediction |
1298406 | BP16_H | Blood pressure QTL 16 (human) | | 0.0004 | Blood pressure | hypertension susceptibility | 17 | 14778647 | 40778647 | Human |
Ensembl Acc Id: |
ENST00000581873 |
Type: |
CODING |
Position: |
Human Assembly | Chr | Position (strand) | Source |
---|
GRCh38.p14 Ensembl | 17 | 28,861,655 - 28,861,730 (-) | Ensembl |
|
RefSeq Acc Id: |
NR_039885 |
RefSeq Status: |
PROVISIONAL |
Type: |
NON-CODING |
Position: |
Human Assembly | Chr | Position (strand) | Source |
---|
GRCh38 | 17 | 28,861,655 - 28,861,730 (-) | NCBI | GRCh37 | 17 | 27,188,673 - 27,188,748 (-) | ENTREZGENE | HuRef | 17 | 23,396,963 - 23,397,038 (-) | ENTREZGENE | CHM1_1 | 17 | 27,251,187 - 27,251,262 (-) | NCBI | T2T-CHM13v2.0 | 17 | 29,804,428 - 29,804,503 (-) | NCBI |
|
Sequence: |
GAGGGAGCTGTAGAGCAGGGAGCAGGAAGCTGTGTGTGTCCAGCCCTGACCTGTCCTGTTCTGCCCCCAGCCCCTC
hide sequence
|
|
|