Symbol: |
Scarna8 |
Name: |
small Cajal body-specific RNA 8 |
RGD ID: |
2303925 |
MGI Page |
MGI |
Description: |
INTERACTS WITH 2-hydroxypropanoic acid (ortholog); aflatoxin B1 (ortholog); benzene-1,2,4-triol (ortholog) |
Type: |
ncrna (Ensembl: scaRNA)
|
RefSeq Status: |
PROVISIONAL |
Previously known as: |
MBI-5; MBI-57 |
RGD Orthologs |
|
Alliance Orthologs |
|
More Info |
more info ...
|
More Info |
|
Latest Assembly: |
GRCm39 - Mouse Genome Assembly GRCm39 |
Position: |
Mouse Assembly | Chr | Position (strand) | Source | Genome Browsers |
---|
JBrowse | NCBI | UCSC | Ensembl |
---|
GRCm39 | 4 | 86,504,690 - 86,504,807 (-) | NCBI | GRCm39 | GRCm39 | mm39 | | GRCm39 Ensembl | 4 | 86,504,690 - 86,504,820 (-) | Ensembl | | GRCm39 Ensembl | | | GRCm38 | 4 | 86,586,453 - 86,586,570 (-) | NCBI | GRCm38 | GRCm38 | mm10 | GRCm38 | GRCm38.p6 Ensembl | 4 | 86,586,453 - 86,586,583 (-) | Ensembl | GRCm38 | | mm10 | GRCm38 | MGSCv37 | 4 | 86,232,357 - 86,232,474 (-) | NCBI | GRCm37 | MGSCv37 | mm9 | NCBIm37 | Celera | 4 | 85,101,242 - 85,101,359 (-) | NCBI | | Celera | | | Cytogenetic Map | 4 | C4 | NCBI | | | | | cM Map | 4 | 40.69 | NCBI | | | | |
|
JBrowse: |
View Region in Genome Browser (JBrowse)
|
Model |
|
Scarna8 (Mus musculus - house mouse) |
Mouse Assembly | Chr | Position (strand) | Source | Genome Browsers |
---|
JBrowse | NCBI | UCSC | Ensembl |
---|
GRCm39 | 4 | 86,504,690 - 86,504,807 (-) | NCBI | GRCm39 | GRCm39 | mm39 | | GRCm39 Ensembl | 4 | 86,504,690 - 86,504,820 (-) | Ensembl | | GRCm39 Ensembl | | | GRCm38 | 4 | 86,586,453 - 86,586,570 (-) | NCBI | GRCm38 | GRCm38 | mm10 | GRCm38 | GRCm38.p6 Ensembl | 4 | 86,586,453 - 86,586,583 (-) | Ensembl | GRCm38 | | mm10 | GRCm38 | MGSCv37 | 4 | 86,232,357 - 86,232,474 (-) | NCBI | GRCm37 | MGSCv37 | mm9 | NCBIm37 | Celera | 4 | 85,101,242 - 85,101,359 (-) | NCBI | | Celera | | | Cytogenetic Map | 4 | C4 | NCBI | | | | | cM Map | 4 | 40.69 | NCBI | | | | |
|
SCARNA8 (Homo sapiens - human) |
Human Assembly | Chr | Position (strand) | Source | Genome Browsers |
---|
JBrowse | NCBI | UCSC | Ensembl |
---|
GRCh38 | 9 | 19,063,656 - 19,063,786 (-) | NCBI | GRCh38 | GRCh38 | hg38 | GRCh38 | GRCh38.p14 Ensembl | 9 | 19,063,656 - 19,063,786 (-) | Ensembl | GRCh38 | | hg38 | GRCh38 | GRCh37 | 9 | 19,063,654 - 19,063,784 (-) | NCBI | GRCh37 | GRCh37 | hg19 | GRCh37 | Build 36 | 9 | 19,053,654 - 19,053,784 (-) | NCBI | NCBI36 | Build 36 | hg18 | NCBI36 | Celera | 9 | 18,989,849 - 18,989,979 (-) | NCBI | | Celera | | | Cytogenetic Map | 9 | p22.1 | NCBI | | | | | HuRef | 9 | 19,025,259 - 19,025,389 (-) | NCBI | | HuRef | | | CHM1_1 | 9 | 19,063,646 - 19,063,776 (-) | NCBI | | CHM1_1 | | | T2T-CHM13v2.0 | 9 | 19,076,523 - 19,076,653 (-) | NCBI | | T2T-CHM13v2.0 | | |
|
Scarna8 (Rattus norvegicus - Norway rat) |
Rat Assembly | Chr | Position (strand) | Source | Genome Browsers |
---|
JBrowse | NCBI | UCSC | Ensembl |
---|
GRCr8 | 5 | 106,170,119 - 106,170,249 (-) | NCBI | | GRCr8 | | | mRatBN7.2 | 5 | 101,124,125 - 101,124,255 (-) | NCBI | mRatBN7.2 | mRatBN7.2 | | | mRatBN7.2 Ensembl | 5 | 101,124,125 - 101,124,255 (-) | Ensembl | | mRatBN7.2 Ensembl | | | Rnor_6.0 Ensembl | 5 | 104,951,851 - 104,951,981 (-) | NCBI | Rnor6.0 | | rn6 | Rnor6.0 | Cytogenetic Map | 5 | q31 | NCBI | | | | |
|
LOC119874085 (Canis lupus familiaris - dog) |
Dog Assembly | Chr | Position (strand) | Source | Genome Browsers |
---|
JBrowse | NCBI | UCSC | Ensembl |
---|
Dog10K_Boxer_Tasha | 11 | 37,558,669 - 37,558,799 (-) | NCBI | | Dog10K_Boxer_Tasha | | | ROS_Cfam_1.0 | 11 | 39,832,953 - 39,833,083 (-) | NCBI | | ROS_Cfam_1.0 | | | UMICH_Zoey_3.1 | 11 | 38,526,225 - 38,526,355 (-) | NCBI | | UMICH_Zoey_3.1 | | | UNSW_CanFamBas_1.0 | 11 | 38,321,136 - 38,321,266 (-) | NCBI | | UNSW_CanFamBas_1.0 | | | UU_Cfam_GSD_1.0 | 11 | 38,958,225 - 38,958,355 (-) | NCBI | | UU_Cfam_GSD_1.0 | | |
|
.
Predicted Target Of
Count of predictions: | 128 | Count of miRNA genes: | 125 | Interacting mature miRNAs: | 127 | Transcripts: | ENSMUST00000158333 | Prediction methods: | Miranda, Rnahybrid | Result types: | miRGate_prediction |
11532714 | Sluc43_m | susceptibility to lung cancer 43 (mouse) | | | | | 4 | 46642108 | 123127211 | Mouse | 13506251 | Cytrq1_m | cytokine response QTL 1 (mouse) | | | | | 4 | 65718086 | 99718086 | Mouse | 25314312 | Syncl2_m | synaptonemal complex length 2 (mouse) | | | | | 4 | 65718237 | 146584457 | Mouse | 1357726 | Lnopy1_m | lens opacity 1 (mouse) | | | Not determined | | 4 | 85428838 | 119429037 | Mouse | 11532708 | Sluc43i_m | susceptibility to lung cancer 43i (mouse) | | | | | 4 | 74444699 | 108444983 | Mouse | 11532707 | Sluc43h_m | susceptibility to lung cancer 43h (mouse) | | | | | 4 | 74444699 | 108444983 | Mouse | 11532706 | Sluc43c_m | susceptibility to lung cancer 43c (mouse) | | | | | 4 | 74444699 | 108444983 | Mouse | 11532705 | Sluc43b_m | susceptibility to lung cancer 43b (mouse) | | | | | 4 | 74444699 | 108444983 | Mouse | 10412176 | Habiir3_m | hyperoxic acute lung injury imprinted region 3 (mouse) | | | Not determined | | 4 | 83757130 | 94293740 | Mouse | 1302044 | Nss1_m | NOD Sjogren's syndrome 1 (mouse) | | | Not determined | | 4 | 71982069 | 105982216 | Mouse | 11532704 | Sluc43a_m | susceptibility to lung cancer 43a (mouse) | | | | | 4 | 74444699 | 108444983 | Mouse | 1357453 | Kidq4_m | kidney weight QTL 4 (mouse) | | | Not determined | | 4 | 17892616 | 88982216 | Mouse | 1302031 | Bulb1_m | bulb size 1 (mouse) | | | Not determined | | 4 | 74033887 | 108034029 | Mouse | 27095939 | Ulnl9_m | ulna length 9, 16 week (mouse) | | | | | 4 | 65318237 | 118857197 | Mouse | 27095938 | Ulnl6_m | ulna length 6, 10 week (mouse) | | | | | 4 | 66718237 | 98588237 | Mouse | 11567249 | Elorr3_m | ethanol induced loss of righting response 3 (mouse) | | | | | 4 | 3722677 | 156268235 | Mouse | 12904933 | Edlmmq3_m | extensor digitorum longus muscle mass QTL 3 (mouse) | | | | | 4 | 81213991 | 115213991 | Mouse | 10043964 | Obq26_m | obesity QTL 26 (mouse) | | | Not determined | | 4 | 59047251 | 93047251 | Mouse | 13524841 | Hbasrq1_m | habituation of the acoustic startle response QTL 1 (mouse) | | | | | 4 | 54471589 | 88471589 | Mouse | 1301556 | Cd4vts1_m | CD4 virgin T cell subset 1 (mouse) | | | Not determined | | 4 | 85428838 | 119429037 | Mouse | 13524838 | Hbasrq1a_m | habituation of the acoustic startle response QTL 1a (mouse) | | | | | 4 | 54471589 | 88471589 | Mouse | 26884406 | Huml3_m | humerus length 3, 10 week (mouse) | | | | | 4 | 75618237 | 100157197 | Mouse | 1302204 | Spm1_m | splenomegaly modifier (mouse) | | | Not determined | | 4 | 82244395 | 116244582 | Mouse | 11532703 | Sluc43g_m | susceptibility to lung cancer 43g (mouse) | | | | | 4 | 74444699 | 108444983 | Mouse | 11532702 | Sluc43f_m | susceptibility to lung cancer 43f (mouse) | | | | | 4 | 74444699 | 108444983 | Mouse | 11532701 | Sluc43e_m | susceptibility to lung cancer 43e (mouse) | | | | | 4 | 74444699 | 108444983 | Mouse | 1558948 | Ath8_m | atherosclerosis 8 (mouse) | | | Not determined | | 4 | 45658442 | 105156995 | Mouse | 11532700 | Sluc43d_m | susceptibility to lung cancer 43d (mouse) | | | | | 4 | 74444699 | 108444983 | Mouse | 11039517 | Ltpr4_m | Leishmania tropica response 4 (mouse) | | | | | 4 | 79365751 | 113365867 | Mouse | 11039504 | Ltpr4a_m | Leishmania tropica response 4a (mouse) | | | | | 4 | 79365751 | 113365867 | Mouse | 11039505 | Ltpr4c_m | Leishmania tropica response 4c (mouse) | | | | | 4 | 79365751 | 113365867 | Mouse | 1301930 | Papg1_m | pulmonary adenoma progression 1 (mouse) | | | Not determined | | 4 | 85781167 | 119781279 | Mouse | 1301033 | Abbp2_m | A/J and C57BL/6 blood pressure 2 (mouse) | | | Not determined | | 4 | 53550839 | 93763305 | Mouse | 1357870 | Pfat1_m | predicted fat percentage 1 (mouse) | | | Not determined | | 4 | 63619526 | 97619685 | Mouse | 1302057 | Pgia27_m | proteoglycan induced arthritis 27 (mouse) | | | Not determined | | 4 | 70067227 | 104067464 | Mouse | 1301545 | Gauc_m | glucose area under curve (mouse) | | | Not determined | | 4 | 76763107 | 110763305 | Mouse | 11039506 | Ltpr4b_m | Leishmania tropica response 4b (mouse) | | | | | 4 | 79365751 | 113365867 | Mouse | 27226787 | Feml14_m | femur length 14, 10 week (mouse) | | | | | 4 | 84918237 | 107157197 | Mouse | 10412193 | Plep_m | plasma lepin levels (mouse) | | | Not determined | | 4 | 74444699 | 108444983 | Mouse | 27095900 | Scvln9_m | sacral vertebrae length 2, 10 week (mouse) | | | | | 4 | 68018237 | 107157197 | Mouse | 4142203 | Lyr_m | lymphoma resistance (mouse) | | | Not determined | | | 80752445 | 88769188 | Mouse | 39128211 | Lwq22_m | liver weight QTL 22 (mouse) | | | | | 4 | 17892616 | 88982216 | Mouse | 26884445 | Sklq7_m | skull length QTL 7, 10 week (mouse) | | | | | 4 | 68018237 | 150884457 | Mouse | 26884434 | Zlq1_m | zygomatic length QTL 1, 5 week (mouse) | | | | | 4 | 53700000 | 103257197 | Mouse | 26884435 | Zlq4_m | zygomatic length QTL 4, 10 week (mouse) | | | | | 4 | 85118237 | 104957197 | Mouse | 1300697 | Sle2_m | systemic lupus erythmatosus susceptibility 2 (mouse) | | | Not determined | | 4 | 77957579 | 111957775 | Mouse | 1301597 | Anxty_m | anxiety (mouse) | | | Not determined | | 4 | 74137574 | 128009280 | Mouse | 26884437 | Sklq13_m | skull length QTL 13, 16 week (mouse) | | | | | 4 | 57700000 | 155684457 | Mouse | 12880404 | Embq1_m | emotional behavior QTL 1 (mouse) | | | | | 4 | 65757203 | 95921546 | Mouse | 1357895 | Ctrcts_m | cataract severity (mouse) | | | Not determined | | 4 | 45709925 | 138342753 | Mouse | 1301190 | Cd4ts2_m | CD4 T cell subset 2 (mouse) | | | Not determined | | 4 | 60145277 | 94145424 | Mouse | 26884431 | Zlq8_m | zygomatic length QTL 8, 16 week (mouse) | | | | | 4 | 74718237 | 108357197 | Mouse | 1357507 | Synch2_m | synechia 2 (mouse) | | | Not determined | | 4 | 60145277 | 94145424 | Mouse | 12879903 | Berr8_m | berghei resistance locus 8 (mouse) | | | | | 4 | 64222460 | 98222460 | Mouse | 13207572 | Spir2_m | Streptococcus pneumoniae infection resistance 2 (mouse) | | | | | 4 | 50682795 | 88510637 | Mouse | 12879897 | Berr4_m | berghei resistance locus 4 (mouse) | | | | | 4 | 71982069 | 105982216 | Mouse | 4142047 | Mvwf3_m | modifier of von Willebrand factor 3 (mouse) | | | Not determined | | | 14010457 | 117072206 | Mouse | 27095934 | Ulnl2_m | ulna length 2, 5 week (mouse) | | | | | 4 | 57700000 | 94788237 | Mouse | 12904738 | Idohtq_m | iris defect with ocular hypertension QTL (mouse) | | | | | 4 | 80752467 | 93112991 | Mouse | 4141911 | W6q15_m | weight 6 weeks QTL 15 (mouse) | | | Not determined | | | 17892616 | 88982216 | Mouse | 27095924 | Pglq2_m | pelvic girdle length QTL 2, 5 week (mouse) | | | | | 4 | 69118237 | 130727311 | Mouse | 27095921 | Pglq12_m | pelvic girdle length QTL 12, 16 week (mouse) | | | | | 4 | 83118237 | 108357197 | Mouse | 1357561 | Mbsyd_m | metabolic syndrome (mouse) | | | Not determined | | 4 | 66888445 | 100888588 | Mouse | 1301118 | Bbaa23_m | B.burgdorferi-associated arthritis 23 (mouse) | | | Not determined | | 4 | 85781167 | 119781279 | Mouse | 1301757 | Tlsr4_m | thymic lymphoma suppressor region 4 (mouse) | | | Not determined | | 4 | 66757130 | 100757258 | Mouse | 27095917 | Scvln14_m | sacral vertebrae length 2, 16 week (mouse) | | | | | 4 | 68018237 | 130277062 | Mouse | 4141900 | Skts-fp1_m | skin tumor susceptibility in FVB and PWK 1 (mouse) | | | Not determined | | 4 | 53550839 | 124055180 | Mouse | 1300966 | Pabr2_m | plasma apolipoprotein B (human) regulator 2 (mouse) | | | Not determined | | 4 | 46332646 | 105801860 | Mouse | 1301739 | Pitm2_m | prion incubation time 2 (mouse) | | | Not determined | | 4 | 71982069 | 105982216 | Mouse | 1301867 | Idd11_m | insulin dependent diabetes susceptibility 11 (mouse) | | | Not determined | | 4 | 83604870 | 117605006 | Mouse | 26884449 | Sklq2_m | skull length QTL 2, 5 week (mouse) | | | | | 4 | 36700000 | 128993793 | Mouse | 27226724 | Tibw2_m | tibia width 2, proximal, 10 week (mouse) | | | | | 4 | 43000000 | 108357197 | Mouse | 27095905 | Scvln3_m | sacral vertebrae length 2, 5 week (mouse) | | | | | 4 | 55600000 | 128993793 | Mouse |
Ensembl Acc Id: |
ENSMUST00000158333 |
Type: |
CODING |
Position: |
Mouse Assembly | Chr | Position (strand) | Source |
---|
GRCm39 Ensembl | 4 | 86,504,690 - 86,504,820 (-) | Ensembl | GRCm38.p6 Ensembl | 4 | 86,586,453 - 86,586,583 (-) | Ensembl |
|
RefSeq Acc Id: |
NR_028545 |
RefSeq Status: |
PROVISIONAL |
Type: |
NON-CODING |
Position: |
Mouse Assembly | Chr | Position (strand) | Source |
---|
GRCm39 | 4 | 86,504,690 - 86,504,807 (-) | NCBI | GRCm38 | 4 | 86,586,453 - 86,586,570 (-) | ENTREZGENE | MGSCv37 | 4 | 86,232,357 - 86,232,474 (-) | RGD | Celera | 4 | 85,101,242 - 85,101,359 (-) | RGD | cM Map | 4 | | ENTREZGENE |
|
Sequence: |
CGCAACTTGGGCAGAAGTACTGCTCCAGTTGTCACTGGACCTCCCCAGAGTAAACTGCCTTTTGATGACCAGGGCGAATTGAGTGAAATCGTCATGGACAGATACGGGGCAGACAATT
hide sequence
|
|
|