Advanced Search (OLGA)

Gene: Krtap4-6 (keratin associated protein 4-6) Mus musculus

Subscribe to Updates

Analyze

Symbol:

Krtap4-6

Name:

keratin associated protein 4-6

RGD ID:

1615090

MGI Page

MGI

Description:

Predicted to be located in cytosol and keratin filament. Orthologous to several human genes including KRTAP4-3 (keratin associated protein 4-3).

Type:

protein-coding

RefSeq Status:

VALIDATED

Previously known as:

1110054P19Rik

RGD Orthologs

Alliance Orthologs

More Info

more info ...

Latest Assembly:

GRCm39 - Mouse Genome Assembly GRCm39

Position:

Mouse Assembly	Chr	Position (strand)	Source	Genome Browsers
Mouse Assembly	Chr	Position (strand)	Source	JBrowse	NCBI	UCSC	Ensembl
GRCm39	11	99,555,869 - 99,556,786 (-)	NCBI	GRCm39	GRCm39	mm39
GRCm39 Ensembl	11	99,555,869 - 99,556,786 (-)	Ensembl		GRCm39 Ensembl
GRCm38	11	99,665,043 - 99,665,960 (-)	NCBI	GRCm38	GRCm38	mm10	GRCm38
GRCm38.p6 Ensembl	11	99,665,043 - 99,665,960 (-)	Ensembl	GRCm38		mm10	GRCm38
MGSCv37	11	99,526,357 - 99,527,274 (-)	NCBI	GRCm37	MGSCv37	mm9	NCBIm37
MGSCv36	11	100,445,096 - 100,446,015 (-)	NCBI		MGSCv36	mm8
MGSCv36	11	99,481,131 - 99,482,050 (-)	NCBI		MGSCv36	mm8
Cytogenetic Map	11	D	NCBI
cM Map	11	63.01	NCBI

JBrowse:

View Region in Genome Browser (JBrowse)

Model

Only show annotations with direct experimental evidence (0 objects hidden)

Object Symbol	Species	Term	Qualifier	Evidence	With	Reference	Notes	Source	Original Reference(s)
Krtap4-6	Mouse	cadmium atom	multiple interactions	ISO	KRTAP4-6 (Homo sapiens)	6480464	[Cadmium Chloride results in increased abundance of Cadmium] which results in decreased expression of KRTAP4-6 mRNA	CTD	PMID:35301059
Krtap4-6	Mouse	cadmium dichloride	multiple interactions	ISO	KRTAP4-6 (Homo sapiens)	6480464	[Cadmium Chloride results in increased abundance of Cadmium] which results in decreased expression of KRTAP4-6 mRNA	CTD	PMID:35301059
Krtap4-6	Mouse	chromium(6+)	affects expression	EXP		6480464	chromium hexavalent ion affects the expression of KRTAP4-6 mRNA	CTD	PMID:28472532

Cellular Component

Only show annotations with direct experimental evidence (0 objects hidden)

Object Symbol	Species	Term	Qualifier	Evidence	With	Reference	Notes	Source	Original Reference(s)
Krtap4-6	Mouse	cellular_component	is_active_in	ND		2290270		MGI	GO_REF:0000015
Krtap4-6	Mouse	cytosol	located_in	IEA	ARBA:ARBA00029243	2290270		UniProt	GO_REF:0000117
Krtap4-6	Mouse	keratin filament	located_in	IEA	InterPro:IPR002494	2290270		InterPro	GO_REF:0000002

#	Reference Title	Reference Citation
1.	Data Import for Chemical-Gene Interactions	RGD automated import pipeline for gene-chemical interactions

PMID:10349636	PMID:11042159	PMID:11076861	PMID:11217851	PMID:11591653	PMID:12466851	PMID:12477932	PMID:16141072	PMID:16141073	PMID:18721477

Krtap4-6
(Mus musculus - house mouse)

Mouse Assembly	Chr	Position (strand)	Source	Genome Browsers
Mouse Assembly	Chr	Position (strand)	Source	JBrowse	NCBI	UCSC	Ensembl
GRCm39	11	99,555,869 - 99,556,786 (-)	NCBI	GRCm39	GRCm39	mm39
GRCm39 Ensembl	11	99,555,869 - 99,556,786 (-)	Ensembl		GRCm39 Ensembl
GRCm38	11	99,665,043 - 99,665,960 (-)	NCBI	GRCm38	GRCm38	mm10	GRCm38
GRCm38.p6 Ensembl	11	99,665,043 - 99,665,960 (-)	Ensembl	GRCm38		mm10	GRCm38
MGSCv37	11	99,526,357 - 99,527,274 (-)	NCBI	GRCm37	MGSCv37	mm9	NCBIm37
MGSCv36	11	100,445,096 - 100,446,015 (-)	NCBI		MGSCv36	mm8
MGSCv36	11	99,481,131 - 99,482,050 (-)	NCBI		MGSCv36	mm8
Cytogenetic Map	11	D	NCBI
cM Map	11	63.01	NCBI

KRTAP4-6
(Homo sapiens - human)

Human Assembly	Chr	Position (strand)	Source	Genome Browsers
Human Assembly	Chr	Position (strand)	Source	JBrowse	NCBI	UCSC	Ensembl
GRCh38	17	41,139,433 - 41,140,544 (-)	NCBI	GRCh38	GRCh38	hg38	GRCh38
GRCh38.p14 Ensembl	17	41,139,433 - 41,140,544 (-)	Ensembl	GRCh38		hg38	GRCh38
GRCh37	17	39,295,685 - 39,296,796 (-)	NCBI	GRCh37	GRCh37	hg19	GRCh37
Build 36	17	36,549,211 - 36,551,661 (-)	NCBI	NCBI36	Build 36	hg18	NCBI36
Build 34	17	36,549,211 - 36,550,229	NCBI
Celera	17	35,957,664 - 35,958,712 (-)	NCBI		Celera
Cytogenetic Map	17	q21.2	NCBI
HuRef	17	35,069,907 - 35,070,949 (-)	NCBI		HuRef
CHM1_1	17	39,531,036 - 39,532,090 (-)	NCBI		CHM1_1
T2T-CHM13v2.0	17	42,004,278 - 42,005,389 (-)	NCBI		T2T-CHM13v2.0

Krtap4-6
(Rattus norvegicus - Norway rat)

Rat Assembly	Chr	Position (strand)	Source	Genome Browsers
Rat Assembly	Chr	Position (strand)	Source	JBrowse	NCBI	UCSC	Ensembl
GRCr8	10	85,123,917 - 85,124,654 (-)	NCBI		GRCr8
mRatBN7.2	10	84,627,782 - 84,628,519 (-)	NCBI	mRatBN7.2	mRatBN7.2
Rnor_6.0	10	87,585,888 - 87,586,650 (-)	NCBI	Rnor6.0	Rnor_6.0	rn6	Rnor6.0
Rnor_5.0	10	87,379,558 - 87,380,295 (-)	NCBI	Rnor5.0	Rnor_5.0	rn5	Rnor5.0
RGSC_v3.4	10	88,620,297 - 88,621,034 (-)	NCBI	RGSC3.4	RGSC_v3.4	rn4	RGSC3.4
Celera	10	83,364,679 - 83,365,441 (-)	NCBI		Celera
Cytogenetic Map	10	q31	NCBI

LOC117976696
(Pan paniscus - bonobo/pygmy chimpanzee)

Bonobo Assembly	Chr	Position (strand)	Source	Genome Browsers
Bonobo Assembly	Chr	Position (strand)	Source	JBrowse	NCBI	UCSC	Ensembl
NHGRI_mPanPan1-v2	19	23,813,609 - 23,814,720 (+)	NCBI		NHGRI_mPanPan1-v2
NHGRI_mPanPan1	17	25,704,029 - 25,705,140 (+)	NCBI		NHGRI_mPanPan1
Mhudiblu_PPA_v0	17	16,145,590 - 16,146,644 (+)	NCBI	Mhudiblu_PPA_v0	Mhudiblu_PPA_v0	panPan3

LOC490996
(Canis lupus familiaris - dog)

Dog Assembly	Chr	Position (strand)	Source	Genome Browsers
Dog Assembly	Chr	Position (strand)	Source	JBrowse	NCBI	UCSC	Ensembl
CanFam3.1	9	21,592,244 - 21,593,603 (+)	NCBI	CanFam3.1	CanFam3.1	canFam3	CanFam3.1
Dog10K_Boxer_Tasha	9	21,064,845 - 21,066,056 (+)	NCBI		Dog10K_Boxer_Tasha
ROS_Cfam_1.0	9	22,379,114 - 22,380,326 (+)	NCBI		ROS_Cfam_1.0
UMICH_Zoey_3.1	9	21,160,066 - 21,161,275 (+)	NCBI		UMICH_Zoey_3.1
UNSW_CanFamBas_1.0	9	21,419,012 - 21,420,224 (+)	NCBI		UNSW_CanFamBas_1.0
UU_Cfam_GSD_1.0	9	21,542,809 - 21,544,021 (+)	NCBI		UU_Cfam_GSD_1.0

Variants in Krtap4-6
24 total Variants

Predicted Target Of

	Summary Value
Count of predictions:	86
Count of miRNA genes:	84
Interacting mature miRNAs:	85
Transcripts:	ENSMUST00000100476
Prediction methods:	Miranda, Rnahybrid
Result types:	miRGate_prediction

The detailed report is available here: Full Report CSV TAB Printer

miRNA Target Status data imported from miRGate (http://mirgate.bioinfo.cnio.es/).
For more information about miRGate, see PMID:25858286 or access the full paper here.

The following QTLs overlap with this region.

RGD ID	Symbol	Name	LOD	P Value	Trait	Sub Trait	Chr	Start	Stop	Species
27226783	Tibl5_m	tibia length 5, 5 week (mouse)					11	68190826	101890826	Mouse
1302034	Pkccl_m	protein kinase C content in lungs (mouse)			Not determined		11	91604608	121973369	Mouse
1300628	Lgth6_m	body length 6 (mouse)			Not determined		11	66733420	100733652	Mouse
4141367	Inf1_m	acute ozone induced inflammation (mouse)			Not determined			44630038	113058009	Mouse
1558812	Rafar_m	retinoic acid induced forelimb autopod reduction (mouse)			Not determined		11	70691198	104691366	Mouse
1301535	Pas5b_m	pulmonary adenoma susceptibility 5b (mouse)			Not determined		11	96176465	108806384	Mouse
1300766	Skull16_m	skull morphology 16 (mouse)			Not determined		11	81574481	115574636	Mouse
1301404	Sbmd4_m	spinal bone mineral density 4 (mouse)			Not determined		11	72019649	106019734	Mouse
12910539	Sstapa3_m	suseptibility to Staphylococcus aureus infection 3 (mouse)					11	96897693	110603991	Mouse
4142121	Tmc1m2_m	Tmc1 modifier 2 (mouse)			Not determined		11	56864027	114157957	Mouse
27226758	Femd3_m	femur midshaft diameter 3, 5 week (mouse)					11	80890826	101890826	Mouse
14747003	Mancz9_m	mandible centroid size 9 (mouse)					11	85844911	119844911	Mouse
1301640	Lore4_m	loss of righting induced by ethanol 4 (mouse)			Not determined		11	79156009	107616472	Mouse
10412288	Carg4_m	Candida albicans resistance gene 4 (mouse)			Not determined		11	81810267	115810267	Mouse
11251723	Ewc5_m	ethanol withdrawal and consumption 5 (mouse)					11	89869251	121973369	Mouse
1301681	Sle13_m	systematic lupus erythematosus susceptibility 13 (mouse)			Not determined		11	70691198	104691366	Mouse
1300784	Prdt3_m	prion disease incubation time 3 (mouse)			Not determined		11	66733420	100733652	Mouse
4141339	Nilac2_m	nicotine induced locomotor activity 2 (mouse)			Not determined		11	70691198	104691366	Mouse
10413882	Moe1_m	modifier of epilepsy 1 (mouse)					11	77770978	111771099	Mouse
4141465	Dbm2_m	diabetes modifier 2 (mouse)			Not determined			94437183	118022724	Mouse
10045617	Heal26_m	wound healing/regeneration 26 (mouse)			Not determined		11	92939373	112544554	Mouse
10045616	Heal25_m	wound healing/regeneration 25 (mouse)			Not determined		11	77437183	111437322	Mouse
1357631	Motr1_m	modifier of tubby retinal degeneration 1 (mouse)			Not determined		11	87691198	103274115	Mouse
1301310	Tmevd5_m	Theiler's murine encephalomyelitis virus induced demyelinating disease susceptibility 5 (mouse)			Not determined		11	72726125	106726289	Mouse
4142348	Pstc2_m	periosteal circumference 2 (mouse)			Not determined		11	72818615	106818733	Mouse
1301414	Heal10_m	wound healing/regeneration 10 (mouse)			Not determined		11	77437183	111437322	Mouse
1300651	Pcyts3_m	plasmacytoma susceptibility 3 (mouse)			Not determined		11	70691198	104691366	Mouse
1301546	Pcir2_m	periosteal circumference 2 (mouse)			Not determined		11	66733420	100733652	Mouse
1300649	Crhq1_m	compensatory renal hypertrophy QTL 1 (mouse)			Not determined		11	81574481	115574636	Mouse
27226789	Feml16_m	femur length 16, 10 week (mouse)					11	87490826	121873369	Mouse
14746970	Manh71_m	mandible shape 71 (mouse)					11	79416257	113416257	Mouse
10043865	T2dm5sa_m	type 2 diabetes mellitus 5 in SMXA RI mice (mouse)			Not determined		11	79813759	104502698	Mouse
39128214	Lwq20_m	liver weight QTL 20 (mouse)					11	12268637	118022724	Mouse
10043866	Adip19_m	adiposity 19 (mouse)			Not determined		11	72818615	106818733	Mouse
1301072	Eae22_m	experimental allergic encephalomyelitis 22 (mouse)			Not determined		11	82377698	116377820	Mouse
1300944	Alcp20_m	alcohol preference locus 20 (mouse)			Not determined		11	95403965	121973369	Mouse
4141939	Pregq2_m	pregnancy QTL 2 (mouse)			Not determined		11	94063779	118022724	Mouse
1301983	Berr2_m	berghei resistance locus 2 (mouse)			Not determined		11	98352609	121973369	Mouse
11038695	Par8_m	pulmonary adenoma resistance 8 (mouse)					11	77063779	111063918	Mouse
10043976	Obq33_m	obesity QTL 33 (mouse)			Not determined		11	98500469	121973369	Mouse
1357766	Si5lq6_m	serum IGFBP-5 level QTL 6 (mouse)			Not determined		11	66733420	100733652	Mouse
1301057	Nidd4_m	non-insulin-dependent diabetes mellitus 4 (mouse)			Not determined		11	96810136	121973369	Mouse
1301958	Alcp18_m	alcohol preference locus 18 (mouse)			Not determined		11	95403965	121973369	Mouse
1301833	Tbbmd5_m	total body bone mineral density 5 (mouse)			Not determined		11	66733420	100733652	Mouse
15014785	Mvlq1_m	macrovesicular liver lesion QTL 1 (mouse)					11	86608320	120608320	Mouse
4141012	Femwf6_m	femur work to failure 6 (mouse)			Not determined			66733420	100733652	Mouse
15039374	Adip29_m	adiposity 29 (mouse)					11	86608320	120608320	Mouse
1300962	Cd8mts4_m	CD8 memory T cell subset 4 (mouse)			Not determined		11	96137674	121973369	Mouse
1301095	El6_m	epilepsy 6 (mouse)			Not determined		11	93229183	121973369	Mouse
27226731	Tibmd4_m	tibia midshaft diameter 4, 10 week (mouse)					11	94190826	118890826	Mouse
27226730	Tibmd1_m	tibia midshaft diameter 1, 5 week (mouse)					11	62590826	109390826	Mouse
15039376	Bw42_m	body weight QTL 42 (mouse)					11	86608320	120608320	Mouse
1558753	Ath19_m	atherosclerosis 19 (mouse)			Not determined		11	91604608	121973369	Mouse
10044001	Alcw8_m	alcohol withdrawal 8 (mouse)			Not determined		11	99254187	121973369	Mouse
10044007	Hbnr14_m	Heligmosomoides bakeri nematode resistance 14 (mouse)			Not determined		11	87502600	121502698	Mouse

UniSTS:492202

Mouse Assembly	Chr	Position (strand)	Source	JBrowse
GRCm38	11	99,665,248 - 99,665,927	UniSTS	GRCm38
MGSCv37	11	99,526,562 - 99,527,241	UniSTS	GRCm37
Cytogenetic Map	11	D	UniSTS

Click on a value in the shaded box below the category label to view a detailed expression data table for that system.


RefSeq Transcripts	NM_026834	(Get FASTA)	NCBI Sequence Viewer	Search GEO for Microarray Profiles
GenBank Nucleotide	AK004258	(Get FASTA)	NCBI Sequence Viewer	Search GEO for Microarray Profiles
	AL590997	(Get FASTA)	NCBI Sequence Viewer	Search GEO for Microarray Profiles
	BC120646	(Get FASTA)	NCBI Sequence Viewer	Search GEO for Microarray Profiles
	BC120648	(Get FASTA)	NCBI Sequence Viewer	Search GEO for Microarray Profiles

Ensembl Acc Id:

ENSMUST00000100476 ⟹ ENSMUSP00000098045

Type:

CODING

Position:

Mouse Assembly	Chr	Position (strand)	Source
GRCm39 Ensembl	11	99,555,869 - 99,556,786 (-)	Ensembl
GRCm38.p6 Ensembl	11	99,665,043 - 99,665,960 (-)	Ensembl

RefSeq Acc Id:

NM_026834 ⟹ NP_081110

RefSeq Status:

VALIDATED

Type:

CODING

Position:

Mouse Assembly	Chr	Position (strand)	Source
GRCm39	11	99,555,869 - 99,556,786 (-)	NCBI
GRCm38	11	99,665,043 - 99,665,960 (-)	ENTREZGENE
MGSCv37	11	99,526,357 - 99,527,274 (-)	RGD
cM Map	11		ENTREZGENE

Sequence:

show sequence

ACTTCCAAACCTTCCAACCCATCTTCTTGTAAACCCATCCAGAACCTCCACCTCTGACACCATGGCCAACTCTTGTTGTGGCTCTGTCTGCTCTGAGGAGAGCTGTGGCCAAGGCTGCTGCCAGCCCA
GCTGCTGCCAGACCACCTGCTGTAGGACCACCTGCTGCCGCCCCAGCTGCTGTGTGTCCAGCTGCTGCAGACCCCAGTGCTGCCAGTCTCTGTGCTGCCAGCCCACCTGCTGCCGCCCCAGCTGCTGC
ATTTCCAGCTGCTGCAGGCCCACCTGCTGCCGCCCCACCTGCTGTATTTCCAGCTGCTGCAGGCCCACCTGCTGTCGCCCCAGCTGCTGCATTTCCAGCTGCTGCAGGCCCACCTGCTGCCGCCCCAG
CTGCTGTATTTCCAGCTGCTGCAGGCCTTCTTGCTGCCGCCCCAGCTGCTGCATTTCCAGCTGCTGCAGGCCTTCCTGCTGCCGCCCCAGCTGCTGCAGACCTAGCTGTTGCATTTCTAGCTGCTGCC
GCCCCAGCTGCTGTGTGTCCAGCTGCTGCAGACCCCAGTGCTGCATCTCCAGCTGCTGCCGCCCCATCTGTTGCCAGACCACCTGCTGCAGGACCACCTGCTACCGCCCAGCGTGCTCTAGTGGTTCT
TGCTGCTGAGCACCTTCATCCAGTCTTCATCACCCCCCCACTCTTAATATAGACCATGAATGAGGTGAACCCCAAGAGGTCAATCAAAGCCTCTGTTGGATCTTGACTTAGGCTCCAAATGCACTCAG
TTTCTTCCCCAACTAGGTTTCTCTCAAATAAAAGCAAATTTCTAGGGTTTTTTTTTTAAATAATCTATCATTTTACTCCCACATTGATGTTTATGTCATATTTATATAAGTATTTTTATATTTCAAAT
AAACCTGAATTTTAGACATCTG

hide sequence


Protein RefSeqs	NP_081110	(Get FASTA)	NCBI Sequence Viewer
GenBank Protein	BAE43167	(Get FASTA)	NCBI Sequence Viewer
Ensembl Protein	ENSMUSP00000098045
	ENSMUSP00000098045.3

RefSeq Acc Id:	NP_081110 ⟸ NM_026834
- UniProtKB:	Q3V4B7 (UniProtKB/TrEMBL)
- Sequence:	show sequence MANSCCGSVCSEESCGQGCCQPSCCQTTCCRTTCCRPSCCVSSCCRPQCCQSLCCQPTCCRPSCCISSCCRPTCCRPTCCISSCCRPTCCRPSCCISSCCRPTCCRPSCCISSCCRPSCCRPSCCISS CCRPSCCRPSCCRPSCCISSCCRPSCCVSSCCRPQCCISSCCRPICCQTTCCRTTCYRPACSSGSCC hide sequence

Ensembl Acc Id:

ENSMUSP00000098045 ⟸ ENSMUST00000100476

Name	Modeler	Protein Id	AA Range	Protein Structure
AF-Q3V4B7-F1-model_v2	AlphaFold	Q3V4B7	1-195	view protein structure

RGD ID:

8676610

Promoter ID:

EPDNEW_M16336

Type:

single initiation site

Name:

Krtap4-6_1

Description:

Mus musculus keratin associated protein 4-6 (Krtap4-6), mRNA.

SO ACC ID:

SO:0000170

Source:

EPDNEW (Eukaryotic Promoter Database, http://epd.vital-it.ch/)

Experiment Methods:

Single-end sequencing.

Position:

Mouse Assembly	Chr	Position (strand)	Source
GRCm38	11	99,665,960 - 99,666,020	EPDNEW

Database	Acc Id	Source(s)
Ensembl Genes	ENSMUSG00000075566	Ensembl, ENTREZGENE, UniProtKB/TrEMBL
Ensembl Transcript	ENSMUST00000100476	ENTREZGENE
	ENSMUST00000100476.3	UniProtKB/TrEMBL
InterPro	Keratin_B2	UniProtKB/TrEMBL
KEGG Report	mmu:68768	UniProtKB/TrEMBL
MGD	MGI:1916018	ENTREZGENE
NCBI Gene	68768	ENTREZGENE
PANTHER	KERATIN-ASSOCIATED PROTEIN 4-6	UniProtKB/TrEMBL
	Keratin_B2	UniProtKB/TrEMBL
Pfam	Keratin_B2_2	UniProtKB/TrEMBL
PhenoGen	Krtap4-6	PhenoGen
UniProt	Q3V4B7	ENTREZGENE, UniProtKB/TrEMBL

Gene Annotator (Functional Annotation) unavailable	Gene Annotator (Annotation Distribution) unavailable	Variant Visualizer (Genomic Variants) unavailable


InterViewer (Protein-Protein Interactions) unavailable	Gviewer (Genome Viewer) unavailable	Variant Visualizer (Damaging Variants) unavailable


Gene Annotator (Annotation Comparison) unavailable	OLGA (Gene List Generator) unavailable
		Excel (Download)

MOET (Multi-Ontology Enrichement) unavailable	GOLF (Gene-Ortholog Location Finder) unavailable

Send us a Message