Symbol: |
1700087M22Rik |
Name: |
RIKEN cDNA 1700087M22 gene |
RGD ID: |
1611687 |
MGI Page |
MGI |
Description: |
|
Type: |
ncrna (Ensembl: lncRNA)
|
RefSeq Status: |
MODEL |
Previously known as: |
hypothetical protein LOC78467; uncharacterized protein LOC78467 |
Latest Assembly: |
GRCm39 - Mouse Genome Assembly GRCm39 |
Position: |
Mouse Assembly | Chr | Position (strand) | Source | Genome Browsers |
---|
JBrowse | NCBI | UCSC | Ensembl |
---|
GRCm39 | 14 | 30,492,636 - 30,499,981 (-) | NCBI | GRCm39 | GRCm39 | mm39 | | GRCm39 Ensembl | 14 | 30,454,327 - 30,500,003 (-) | Ensembl | | GRCm39 Ensembl | | | GRCm38 | 14 | 30,770,679 - 30,778,024 (-) | NCBI | GRCm38 | GRCm38 | mm10 | GRCm38 | GRCm38.p6 Ensembl | 14 | 30,770,681 - 30,778,004 (-) | Ensembl | GRCm38 | | mm10 | GRCm38 | Celera | 14 | 27,029,823 - 27,037,113 (-) | NCBI | | Celera | | | Cytogenetic Map | 14 | B | NCBI | | | | | cM Map | 14 | 19.08 | NCBI | | | | |
|
JBrowse: |
View Region in Genome Browser (JBrowse)
|
Model |
|
.
Predicted Target Of
Count of predictions: | 78 | Count of miRNA genes: | 76 | Interacting mature miRNAs: | 78 | Transcripts: | ENSMUST00000128554 | Prediction methods: | Miranda, Rnahybrid, Targetscan | Result types: | miRGate_prediction |
1357589 | Kdnw2_m | kidney weight 2 (mouse) | | | Not determined | | 14 | 20887473 | 121269804 | Mouse | 27226748 | Femd8_m | femur midshaft diameter 8, 10 week (mouse) | | | | | 14 | 13769273 | 46737457 | Mouse | 1357527 | Epfpq1_m | epididymal fat percentage QTL 1 (mouse) | | | Not determined | | 14 | 21062450 | 71885801 | Mouse | 27226744 | Metcl6_m | metatarsal-calcaneal length 6, 5 week (mouse) | | | | | 14 | 30321957 | 52937457 | Mouse | 27226775 | Tibl7_m | tibia length 7, 5 week (mouse) | | | | | 14 | 30321957 | 48837457 | Mouse | 27226774 | Tibl15_m | tibia length 15, 10 week (mouse) | | | | | 14 | 30321957 | 87937436 | Mouse | 4142485 | Modor2_m | modifier of ocular retardation 2 (mouse) | | | Not determined | | 14 | 24926248 | 58179769 | Mouse | 1301372 | Sluc13_m | susceptibility to lung cancer 13 (mouse) | | | Not determined | | 14 | 18827604 | 52827726 | Mouse | 4141550 | Dbm3_m | diabetes modifier 3 (mouse) | | | Not determined | | | 5143473 | 39143596 | Mouse | 1300544 | Hypn_m | hyperinsulinemia (mouse) | | | Not determined | | 14 | 15160616 | 49160765 | Mouse | 1301991 | Wta3_m | weight adult 3 (mouse) | | | Not determined | | 14 | 3887473 | 37887650 | Mouse | 1300998 | Cia17_m | collagen induced arthritis 17 (mouse) | | | Not determined | | 14 | 30335250 | 64335381 | Mouse | 4141864 | Mrdq4_m | modifier of retinal degeneration QTL 4 (mouse) | | | Not determined | | | 9923245 | 48765082 | Mouse | 10043886 | Cia49_m | collagen induced arthritis QTL 49 (mouse) | | | Not determined | | 14 | 29996994 | 63997133 | Mouse | 1300779 | Dyscalc4_m | dystrophic cardiac calcinosis 4 (mouse) | | | Not determined | | 14 | 12212871 | 46213007 | Mouse | 14746973 | Manh76_m | mandible shape 76 (mouse) | | | | | 14 | 22287217 | 56287217 | Mouse | 1300909 | Ath13_m | atherosclerosis 13 (mouse) | | | Not determined | | 14 | 30335250 | 64335381 | Mouse | 27226752 | Femd4_m | femur midshaft diameter 4, 5 week (mouse) | | | | | 14 | 13769273 | 47237457 | Mouse | 13506929 | Recrq10_m | recombination rate in male meiosis QTL 10 (mouse) | | | | | 14 | 27921957 | 61137449 | Mouse |
Ensembl Acc Id: |
ENSMUST00000227408 |
Type: |
CODING |
Position: |
Mouse Assembly | Chr | Position (strand) | Source |
---|
GRCm39 Ensembl | 14 | 30,454,329 - 30,499,986 (-) | Ensembl | GRCm38.p6 Ensembl | 14 | 30,770,681 - 30,778,004 (-) | Ensembl |
|
Ensembl Acc Id: |
ENSMUST00000278529 |
Type: |
CODING |
Position: |
Mouse Assembly | Chr | Position (strand) | Source |
---|
GRCm39 Ensembl | 14 | 30,454,327 - 30,499,975 (-) | Ensembl |
|
Ensembl Acc Id: |
ENSMUST00000278530 |
Type: |
CODING |
Position: |
Mouse Assembly | Chr | Position (strand) | Source |
---|
GRCm39 Ensembl | 14 | 30,456,198 - 30,499,961 (-) | Ensembl |
|
Ensembl Acc Id: |
ENSMUST00000278531 |
Type: |
CODING |
Position: |
Mouse Assembly | Chr | Position (strand) | Source |
---|
GRCm39 Ensembl | 14 | 30,458,395 - 30,499,961 (-) | Ensembl |
|
Ensembl Acc Id: |
ENSMUST00000278532 |
Type: |
CODING |
Position: |
Mouse Assembly | Chr | Position (strand) | Source |
---|
GRCm39 Ensembl | 14 | 30,470,119 - 30,499,965 (-) | Ensembl |
|
Ensembl Acc Id: |
ENSMUST00000278533 |
Type: |
CODING |
Position: |
Mouse Assembly | Chr | Position (strand) | Source |
---|
GRCm39 Ensembl | 14 | 30,470,119 - 30,499,939 (-) | Ensembl |
|
Ensembl Acc Id: |
ENSMUST00000278534 |
Type: |
CODING |
Position: |
Mouse Assembly | Chr | Position (strand) | Source |
---|
GRCm39 Ensembl | 14 | 30,470,706 - 30,499,965 (-) | Ensembl |
|
Ensembl Acc Id: |
ENSMUST00000278535 |
Type: |
CODING |
Position: |
Mouse Assembly | Chr | Position (strand) | Source |
---|
GRCm39 Ensembl | 14 | 30,470,706 - 30,499,949 (-) | Ensembl |
|
Ensembl Acc Id: |
ENSMUST00000278536 |
Type: |
CODING |
Position: |
Mouse Assembly | Chr | Position (strand) | Source |
---|
GRCm39 Ensembl | 14 | 30,486,402 - 30,500,003 (-) | Ensembl |
|
Ensembl Acc Id: |
ENSMUST00000278537 |
Type: |
CODING |
Position: |
Mouse Assembly | Chr | Position (strand) | Source |
---|
GRCm39 Ensembl | 14 | 30,486,402 - 30,499,961 (-) | Ensembl |
|
Ensembl Acc Id: |
ENSMUST00000278538 |
Type: |
CODING |
Position: |
Mouse Assembly | Chr | Position (strand) | Source |
---|
GRCm39 Ensembl | 14 | 30,470,118 - 30,471,560 (-) | Ensembl |
|
Ensembl Acc Id: |
ENSMUST00000278539 |
Type: |
CODING |
Position: |
Mouse Assembly | Chr | Position (strand) | Source |
---|
GRCm39 Ensembl | 14 | 30,470,119 - 30,471,554 (-) | Ensembl |
|
Ensembl Acc Id: |
ENSMUST00000278540 |
Type: |
CODING |
Position: |
Mouse Assembly | Chr | Position (strand) | Source |
---|
GRCm39 Ensembl | 14 | 30,470,706 - 30,471,544 (-) | Ensembl |
|
RefSeq Acc Id: |
XR_874489 |
Type: |
NON-CODING |
Position: |
Mouse Assembly | Chr | Position (strand) | Source |
---|
GRCm39 | 14 | 30,492,636 - 30,499,981 (-) | NCBI | GRCm38 | 14 | 30,770,679 - 30,778,024 (-) | NCBI |
|
Sequence: |
TTTTCTATACTGGTTTAAGCAGTGATACTCACGCCCTCTAGCAGAGACACGGGAGGACCACAGGCTCCTATCAGGGTCTGCTGTAGGAATGCATTCCAATCAGACACTTTATCTCTGATGCCTGTGTA AGAGAAGAAATGGTTATTATTCATGTCATAGAACACAAAGAAACTTGACATACACAAACTGCTTACAGTTTTACAGGTGAATAAAACAATGGTTTCAGTCTC
hide sequence
|
RGD ID: | 8681780 |
Promoter ID: | EPDNEW_M18921 |
Type: | multiple initiation site |
Name: | AK018913_1 |
Description: | n/a |
SO ACC ID: | SO:0000170 |
Source: | EPDNEW (Eukaryotic Promoter Database, http://epd.vital-it.ch/) |
Experiment Methods: | Single-end sequencing. |
Position: | Mouse Assembly | Chr | Position (strand) | Source |
---|
GRCm38 | 14 | 30,778,004 - 30,778,064 | EPDNEW |
|
RGD ID: | 15094408 |
Promoter ID: | EPDNEWNC_M2321 |
Type: | single initiation site |
Name: | 1700087M22Rik_1 |
Description: | RIKEN cDNA 1700087M22 gene [Source:MGISymbol;Acc:MGI:1925717] |
SO ACC ID: | SO:0000170 |
Source: | EPDNEWNC (Eukaryotic Promoter Database, http://epd.vital-it.ch/) |
Experiment Methods: | Single-end sequencing. |
Position: | Mouse Assembly | Chr | Position (strand) | Source |
---|
GRCm38 | 14 | 30,778,004 - 30,778,064 | EPDNEWNC |
|
|
|