Symbol: |
1700065J18Rik |
Name: |
RIKEN cDNA 1700065J18 gene |
RGD ID: |
1610809 |
MGI Page |
MGI |
Description: |
|
Type: |
ncrna (Ensembl: lncRNA)
|
RefSeq Status: |
VALIDATED |
Previously known as: |
hypothetical protein LOC73455 |
Latest Assembly: |
GRCm39 - Mouse Genome Assembly GRCm39 |
Position: |
Mouse Assembly | Chr | Position (strand) | Source | Genome Browsers |
---|
JBrowse | NCBI | UCSC | Ensembl |
---|
GRCm39 | 1 | 192,524,013 - 192,525,047 (+) | NCBI | GRCm39 | GRCm39 | mm39 | | GRCm39 Ensembl | 1 | 192,517,237 - 192,525,660 (+) | Ensembl | | GRCm39 Ensembl | | | GRCm38 | 1 | 192,841,705 - 192,842,739 (+) | NCBI | GRCm38 | GRCm38 | mm10 | GRCm38 | GRCm38.p6 Ensembl | 1 | 192,841,661 - 192,842,740 (+) | Ensembl | GRCm38 | | mm10 | GRCm38 | Celera | 1 | 199,723,606 - 199,724,640 (+) | NCBI | | Celera | | | Cytogenetic Map | 1 | H6 | NCBI | | | | |
|
JBrowse: |
View Region in Genome Browser (JBrowse)
|
Model |
|
.
11039528 | Ccc3_m | colitis susceptibility in the Collaborative Cross 3 (mouse) | | | | | 1 | 3680142 | 195051546 | Mouse | 1301431 | Pcho1_m | plasma cholesterol 1 (mouse) | | | Not determined | | 1 | 159262573 | 193262693 | Mouse | 1300823 | Ath9_m | atherosclerosis 9 (mouse) | | | Not determined | | 1 | 160112768 | 194112883 | Mouse | 1300727 | Mptp1_m | MPTP sensitivity 1 (mouse) | | | Not determined | | 1 | 171632048 | 192681050 | Mouse | 1558802 | Skmw6_m | skeletal muscle weight 6 (mouse) | | | Not determined | | 1 | 167954584 | 195154279 | Mouse | 1559024 | Zit1_m | zinc induced tolerance 1 (mouse) | | | Not determined | | 1 | 167462514 | 195154279 | Mouse | 1301652 | Cpfd2_m | cerebellum pattern fissures (mouse) | | | Not determined | | 1 | 172303451 | 195154279 | Mouse | 12790987 | Tgl5_m | triglyceride 5 (mouse) | | | | | 1 | 160097157 | 194097157 | Mouse | 1301339 | Hdlq15_m | HDL QTL 15 (mouse) | | | Not determined | | 1 | 165873675 | 195154279 | Mouse | 12880429 | V25Dq1_m | vitamin D inactive form serum level QTL 1 (mouse) | | | | | 1 | 172632197 | 195154279 | Mouse | 10043863 | Swrl5_m | SWR lupus locus 5 (mouse) | | | Not determined | | 1 | 172303451 | 195154279 | Mouse | 12880426 | V25Dq2_m | vitamin D inactive form serum level QTL 2 (mouse) | | | | | 1 | 172532197 | 195154279 | Mouse | 12790988 | Phdlc5_m | plasma HDL cholesterol 5 (mouse) | | | | | 9 | 160097157 | 194097157 | Mouse | 1301596 | Elnt_m | escape latencies during navigation task (mouse) | | | Not determined | | 1 | 162145207 | 194111528 | Mouse | 11049575 | Lmr8b_m | leishmaniasis resistance 8b (mouse) | | | | | 1 | 172303451 | 195154279 | Mouse | 1301251 | Scc3_m | colon tumor susceptibility 3 (mouse) | | | Not determined | | 1 | 168213823 | 195154279 | Mouse | 1357732 | Tbbmd1_m | total body bone mineral density 1 (mouse) | | | Not determined | | 1 | 171983110 | 195154279 | Mouse | 1301632 | Bw8q1_m | body weight at 8 weeks QTL 1 (mouse) | | | Not determined | | 1 | 161201261 | 195154279 | Mouse | 4141483 | Femwf7_m | femur work to failure 7 (mouse) | | | Not determined | | | 167462514 | 195154279 | Mouse | 1302023 | Orch4_m | autoimmune orchitis resistance 4 (mouse) | | | Not determined | | 1 | 175211318 | 195154279 | Mouse | 1302158 | Fembrs5_m | femur breaking strength 5 (mouse) | | | Not determined | | 1 | 167462514 | 195154279 | Mouse | 11532690 | Sluc37_m | susceptibility to lung cancer 37 (mouse) | | | | | 1 | 175468817 | 194111528 | Mouse | 1301132 | Mors1_m | modifier of obesity related sterility 1 (mouse) | | | Not determined | | 1 | 170379500 | 195154279 | Mouse |
Ensembl Acc Id: |
ENSMUST00000188648 |
Type: |
CODING |
Position: |
Mouse Assembly | Chr | Position (strand) | Source |
---|
GRCm39 Ensembl | 1 | 192,523,938 - 192,525,050 (+) | Ensembl | GRCm38.p6 Ensembl | 1 | 192,841,671 - 192,842,740 (+) | Ensembl |
|
Ensembl Acc Id: |
ENSMUST00000190576 |
Type: |
CODING |
Position: |
Mouse Assembly | Chr | Position (strand) | Source |
---|
GRCm39 Ensembl | 1 | 192,523,945 - 192,525,050 (+) | Ensembl | GRCm38.p6 Ensembl | 1 | 192,841,661 - 192,842,734 (+) | Ensembl |
|
Ensembl Acc Id: |
ENSMUST00000267377 |
Type: |
CODING |
Position: |
Mouse Assembly | Chr | Position (strand) | Source |
---|
GRCm39 Ensembl | 1 | 192,517,237 - 192,525,048 (+) | Ensembl |
|
Ensembl Acc Id: |
ENSMUST00000267378 |
Type: |
CODING |
Position: |
Mouse Assembly | Chr | Position (strand) | Source |
---|
GRCm39 Ensembl | 1 | 192,522,627 - 192,525,660 (+) | Ensembl |
|
Ensembl Acc Id: |
ENSMUST00000267379 |
Type: |
CODING |
Position: |
Mouse Assembly | Chr | Position (strand) | Source |
---|
GRCm39 Ensembl | 1 | 192,523,452 - 192,525,048 (+) | Ensembl |
|
Ensembl Acc Id: |
ENSMUST00000267380 |
Type: |
CODING |
Position: |
Mouse Assembly | Chr | Position (strand) | Source |
---|
GRCm39 Ensembl | 1 | 192,523,735 - 192,525,048 (+) | Ensembl |
|
Ensembl Acc Id: |
ENSMUST00000267381 |
Type: |
CODING |
Position: |
Mouse Assembly | Chr | Position (strand) | Source |
---|
GRCm39 Ensembl | 1 | 192,523,772 - 192,525,050 (+) | Ensembl |
|
Ensembl Acc Id: |
ENSMUST00000267382 |
Type: |
CODING |
Position: |
Mouse Assembly | Chr | Position (strand) | Source |
---|
GRCm39 Ensembl | 1 | 192,523,938 - 192,525,050 (+) | Ensembl |
|
Ensembl Acc Id: |
ENSMUST00000267383 |
Type: |
CODING |
Position: |
Mouse Assembly | Chr | Position (strand) | Source |
---|
GRCm39 Ensembl | 1 | 192,523,938 - 192,525,050 (+) | Ensembl |
|
Ensembl Acc Id: |
ENSMUST00000267384 |
Type: |
CODING |
Position: |
Mouse Assembly | Chr | Position (strand) | Source |
---|
GRCm39 Ensembl | 1 | 192,523,947 - 192,525,050 (+) | Ensembl |
|
Ensembl Acc Id: |
ENSMUST00000267385 |
Type: |
CODING |
Position: |
Mouse Assembly | Chr | Position (strand) | Source |
---|
GRCm39 Ensembl | 1 | 192,523,947 - 192,525,050 (+) | Ensembl |
|
Ensembl Acc Id: |
ENSMUST00000267386 |
Type: |
CODING |
Position: |
Mouse Assembly | Chr | Position (strand) | Source |
---|
GRCm39 Ensembl | 1 | 192,523,947 - 192,525,050 (+) | Ensembl |
|
Ensembl Acc Id: |
ENSMUST00000267387 |
Type: |
CODING |
Position: |
Mouse Assembly | Chr | Position (strand) | Source |
---|
GRCm39 Ensembl | 1 | 192,523,960 - 192,525,050 (+) | Ensembl |
|
Ensembl Acc Id: |
ENSMUST00000267388 |
Type: |
CODING |
Position: |
Mouse Assembly | Chr | Position (strand) | Source |
---|
GRCm39 Ensembl | 1 | 192,524,607 - 192,525,050 (+) | Ensembl |
|
Ensembl Acc Id: |
ENSMUST00000267389 |
Type: |
CODING |
Position: |
Mouse Assembly | Chr | Position (strand) | Source |
---|
GRCm39 Ensembl | 1 | 192,524,609 - 192,525,048 (+) | Ensembl |
|
RefSeq Acc Id: |
NR_040468 |
RefSeq Status: |
VALIDATED |
Type: |
NON-CODING |
Position: |
Mouse Assembly | Chr | Position (strand) | Source |
---|
GRCm39 | 1 | 192,524,013 - 192,525,047 (+) | NCBI | GRCm38 | 1 | 192,841,705 - 192,842,739 (+) | ENTREZGENE | Celera | 1 | 199,723,606 - 199,724,640 (+) | ENTREZGENE | cM Map | 1 | | ENTREZGENE |
|
Sequence: |
ACCCAGCTCCCATGTCAAGAGCCAGGTATGGAGATTGTTCTATCATGCCATCATGACACCGACCGTTGGCTTTGCAGAGACCTCGCAAGATTAACAGAGATATGGTAACCTTAACTTTACATGAAGGA TACAGACCTAACTTCAGTGGAGGAAACCTGCCACCTTGTCTGCTGTTTAGCCCTGATGTTGGCATCTCCTGGTGCTCTGTCAGGACGAGGGCAACCGGTACAGTTGTATGTGCCACAATTTTCTGACT GGCCATGCTTCACTGGAGTCTGCTTCCTGCGTGGCTCCTGATACCCAGCCCTTGTGTGACAAACGAGCATGTCGGACCTTCTAAGTCTCTATTGCTTTGGAAGATCACATCAAAGAGGTTTTACTAAT GAATAATGGTTACTGAAGGG
hide sequence
|
RGD ID: | 6876146 |
Promoter ID: | EPDNEW_M1524 |
Type: | multiple initiation site |
Name: | 1700065J18Rik_1 |
Description: | Mus musculus RIKEN cDNA 1700065J18 gene , long non-coding RNA. |
SO ACC ID: | SO:0000170 |
Source: | EPDNEW (Eukaryotic Promoter Database, http://epd.vital-it.ch/) |
Experiment Methods: | Single-end sequencing. |
Position: | Mouse Assembly | Chr | Position (strand) | Source |
---|
GRCm38 | 1 | 192,841,687 - 192,841,747 | EPDNEW |
|
|
|