Symbol: |
Gm23758 |
Name: |
predicted gene, 23758 |
RGD ID: |
15002940 |
MGI Page |
MGI |
Description: |
|
Type: |
snorna
|
RefSeq Status: |
MODEL |
RGD Orthologs |
|
Alliance Orthologs |
|
More Info |
more info ...
|
More Info |
|
Latest Assembly: |
GRCm39 - Mouse Genome Assembly GRCm39 |
Position: |
Mouse Assembly | Chr | Position (strand) | Source | Genome Browsers |
---|
JBrowse | NCBI | UCSC | Ensembl |
---|
GRCm39 | 14 | 52,513,988 - 52,514,077 (+) | NCBI | GRCm39 | GRCm39 | mm39 | | GRCm39 Ensembl | 14 | 52,513,988 - 52,514,077 (+) | Ensembl | | GRCm39 Ensembl | | | GRCm38 | 14 | 52,276,531 - 52,276,620 (+) | NCBI | GRCm38 | GRCm38 | mm10 | GRCm38 | GRCm38.p6 Ensembl | 14 | 52,276,531 - 52,276,620 (+) | Ensembl | GRCm38 | | mm10 | GRCm38 | Cytogenetic Map | 14 | C2 | NCBI | | | | |
|
JBrowse: |
View Region in Genome Browser (JBrowse)
|
Model |
|
Gm23758 (Mus musculus - house mouse) |
Mouse Assembly | Chr | Position (strand) | Source | Genome Browsers |
---|
JBrowse | NCBI | UCSC | Ensembl |
---|
GRCm39 | 14 | 52,513,988 - 52,514,077 (+) | NCBI | GRCm39 | GRCm39 | mm39 | | GRCm39 Ensembl | 14 | 52,513,988 - 52,514,077 (+) | Ensembl | | GRCm39 Ensembl | | | GRCm38 | 14 | 52,276,531 - 52,276,620 (+) | NCBI | GRCm38 | GRCm38 | mm10 | GRCm38 | GRCm38.p6 Ensembl | 14 | 52,276,531 - 52,276,620 (+) | Ensembl | GRCm38 | | mm10 | GRCm38 | Cytogenetic Map | 14 | C2 | NCBI | | | | |
|
SNORA72 (Homo sapiens - human) |
Human Assembly | Chr | Position (strand) | Source | Genome Browsers |
---|
JBrowse | NCBI | UCSC | Ensembl |
---|
GRCh38 | 1 | 224,179,641 - 224,179,767 (+) | NCBI | GRCh38 | GRCh38 | hg38 | GRCh38 | GRCh38.p14 Ensembl | 1 | 224,179,641 - 224,179,767 (+) | Ensembl | GRCh38 | | hg38 | GRCh38 | Cytogenetic Map | 1 | q42.11 | NCBI | | | | | T2T-CHM13v2.0 | 1 | 223,368,884 - 223,369,010 (+) | NCBI | | T2T-CHM13v2.0 | | |
|
Snora72 (Rattus norvegicus - Norway rat) |
Rat Assembly | Chr | Position (strand) | Source | Genome Browsers |
---|
JBrowse | NCBI | UCSC | Ensembl |
---|
GRCr8 | 15 | 27,459,539 - 27,459,631 (+) | NCBI | | GRCr8 | | | mRatBN7.2 | 15 | 24,986,050 - 24,986,142 (+) | NCBI | mRatBN7.2 | mRatBN7.2 | | | mRatBN7.2 Ensembl | 15 | 24,986,050 - 24,986,142 (+) | Ensembl | | mRatBN7.2 Ensembl | | | Rnor_6.0 Ensembl | 15 | 28,693,182 - 28,693,274 (+) | NCBI | Rnor6.0 | | rn6 | Rnor6.0 | Cytogenetic Map | 15 | p14 | NCBI | | | | |
|
LOC119864018 (Canis lupus familiaris - dog) |
Dog Assembly | Chr | Position (strand) | Source | Genome Browsers |
---|
JBrowse | NCBI | UCSC | Ensembl |
---|
Dog10K_Boxer_Tasha | 17 | 37,147,052 - 37,147,159 (-) | NCBI | | Dog10K_Boxer_Tasha | | | ROS_Cfam_1.0 | 17 | 38,155,105 - 38,155,212 (-) | NCBI | | ROS_Cfam_1.0 | | | ROS_Cfam_1.0 Ensembl | 17 | 38,155,105 - 38,155,212 (-) | Ensembl | | ROS_Cfam_1.0 Ensembl | | | UMICH_Zoey_3.1 | 17 | 37,290,233 - 37,290,339 (-) | NCBI | | UMICH_Zoey_3.1 | | | UNSW_CanFamBas_1.0 | 17 | 37,346,600 - 37,346,707 (-) | NCBI | | UNSW_CanFamBas_1.0 | | | UU_Cfam_GSD_1.0 | 17 | 37,559,619 - 37,559,727 (-) | NCBI | | UU_Cfam_GSD_1.0 | | |
|
.
Predicted Target Of
Count of predictions: | 52 | Count of miRNA genes: | 51 | Interacting mature miRNAs: | 52 | Transcripts: | ENSMUST00000158354 | Prediction methods: | Miranda, Rnahybrid, Targetscan | Result types: | miRGate_prediction |
1357589 | Kdnw2_m | kidney weight 2 (mouse) | | | Not determined | | 14 | 20887473 | 121269804 | Mouse | 1300625 | Cosz2_m | cocaine seizure 2 (mouse) | | | Not determined | | 14 | 35045797 | 68785736 | Mouse | 1301777 | Bglq15_m | body growth late QTL 15 (mouse) | | | Not determined | | 14 | 42962416 | 76962593 | Mouse | 1357527 | Epfpq1_m | epididymal fat percentage QTL 1 (mouse) | | | Not determined | | 14 | 21062450 | 71885801 | Mouse | 27226774 | Tibl15_m | tibia length 15, 10 week (mouse) | | | | | 14 | 30321957 | 87937436 | Mouse | 4141484 | Hcbip1_m | hexachlorobenzene induced porphyria 1 (mouse) | | | Not determined | | | 47335250 | 59962593 | Mouse | 1300998 | Cia17_m | collagen induced arthritis 17 (mouse) | | | Not determined | | 14 | 30335250 | 64335381 | Mouse | 1300805 | Mors3_m | modifier of obesity related sterility 3 (mouse) | | | Not determined | | 14 | 43037270 | 77037418 | Mouse | 4142310 | Carg1_m | Candida albicans resistance gene 1 (mouse) | | | Not determined | | | 51382459 | 54461655 | Mouse | 1301424 | Skull21_m | skull morphology 21 (mouse) | | | Not determined | | 14 | 42962416 | 76962593 | Mouse | 4142364 | Pbwg18_m | postnatal body weight growth 18 (mouse) | | | Not determined | | 14 | 52281984 | 86282125 | Mouse | 27226744 | Metcl6_m | metatarsal-calcaneal length 6, 5 week (mouse) | | | | | 14 | 30321957 | 52937457 | Mouse | 4141400 | Nilac8_m | nicotine induced locomotor activity 8 (mouse) | | | Not determined | | 14 | 43065847 | 77066045 | Mouse | 4142485 | Modor2_m | modifier of ocular retardation 2 (mouse) | | | Not determined | | 14 | 24926248 | 58179769 | Mouse | 4142419 | Tgq26_m | triglyceride QTL 26 (mouse) | | | Not determined | | | 40337319 | 74337319 | Mouse | 27226737 | Metcl12_m | metatarsal-calcaneal length 12, 10 week (mouse) | | | | | 14 | 33221957 | 59437449 | Mouse | 1300605 | El5_m | epilepsy 5 (mouse) | | | Not determined | | 14 | 49455425 | 83455556 | Mouse | 1301372 | Sluc13_m | susceptibility to lung cancer 13 (mouse) | | | Not determined | | 14 | 18827604 | 52827726 | Mouse | 1301091 | Bbaa21_m | B.burgdorferi-associated arthritis 21 (mouse) | | | Not determined | | 14 | 43065847 | 77066045 | Mouse | 10043887 | Cia50_m | collagen induced arthritis QTL 50 (mouse) | | | Not determined | | 14 | 37430185 | 71430320 | Mouse | 10043886 | Cia49_m | collagen induced arthritis QTL 49 (mouse) | | | Not determined | | 14 | 29996994 | 63997133 | Mouse | 27226727 | Tibl21_m | tibia length 21, 16 week (mouse) | | | | | 14 | 34121957 | 52937457 | Mouse | 14746973 | Manh76_m | mandible shape 76 (mouse) | | | | | 14 | 22287217 | 56287217 | Mouse | 1300909 | Ath13_m | atherosclerosis 13 (mouse) | | | Not determined | | 14 | 30335250 | 64335381 | Mouse | 13506929 | Recrq10_m | recombination rate in male meiosis QTL 10 (mouse) | | | | | 14 | 27921957 | 61137449 | Mouse |
Ensembl Acc Id: |
ENSMUST00000158354 |
Type: |
CODING |
Position: |
Mouse Assembly | Chr | Position (strand) | Source |
---|
GRCm39 Ensembl | 14 | 52,513,988 - 52,514,077 (+) | Ensembl | GRCm38.p6 Ensembl | 14 | 52,276,531 - 52,276,620 (+) | Ensembl |
|
RefSeq Acc Id: |
XR_004938698 |
Type: |
NON-CODING |
Position: |
Mouse Assembly | Chr | Position (strand) | Source |
---|
GRCm39 | 14 | 52,513,988 - 52,514,077 (+) | NCBI |
|
Sequence: |
TTTTTAAGATCTGAGGGGGAAAAACCCACGTATGTGTTACCAGAGTTAGTTCTTTCCCTAGATCTGGTTTTATAAATTCTAGTAATAAAC
hide sequence
|
|
|