No known orthologs.
Symbol: |
Gm24173 |
Name: |
predicted gene, 24173 |
RGD ID: |
15000800 |
MGI Page |
MGI |
Description: |
|
Type: |
snorna
|
RefSeq Status: |
MODEL |
RGD Orthologs |
|
Alliance Orthologs |
|
More Info |
homologs ...
|
More Info |
|
Latest Assembly: |
GRCm39 - Mouse Genome Assembly GRCm39 |
Position: |
Mouse Assembly | Chr | Position (strand) | Source | Genome Browsers |
---|
JBrowse | NCBI | UCSC | Ensembl |
---|
GRCm39 | 1 | 11,204,335 - 11,204,462 (-) | NCBI | GRCm39 | GRCm39 | mm39 | | GRCm39 Ensembl | 1 | 11,204,335 - 11,204,462 (-) | Ensembl | | GRCm39 Ensembl | | | GRCm38 | 1 | 11,134,111 - 11,134,238 (-) | NCBI | GRCm38 | GRCm38 | mm10 | GRCm38 | GRCm38.p6 Ensembl | 1 | 11,134,111 - 11,134,238 (-) | Ensembl | GRCm38 | | mm10 | GRCm38 | Cytogenetic Map | 1 | A2 | NCBI | | | | |
|
JBrowse: |
View Region in Genome Browser (JBrowse)
|
Model |
|
.
Predicted Target Of
Count of predictions: | 31 | Count of miRNA genes: | 29 | Interacting mature miRNAs: | 31 | Transcripts: | ENSMUST00000104130 | Prediction methods: | Miranda, Rnahybrid, Targetscan | Result types: | miRGate_prediction |
11039528 | Ccc3_m | colitis susceptibility in the Collaborative Cross 3 (mouse) | | | | | 1 | 3680142 | 195051546 | Mouse | 1301011 | Cplaq4_m | circadian period of locomotor activity 4 (mouse) | | | Not determined | | 1 | 9673442 | 43673601 | Mouse | 1301275 | Sle10_m | systematic lupus erythematosus susceptibility 10 (mouse) | | | Not determined | | 1 | 2882194 | 36882352 | Mouse | 15092046 | Wngrme1_m | week nine growth rate, maternal effect 1 (mouse) | | | | | 1 | 3280142 | 37782236 | Mouse | 1301370 | Adip1_m | adiposity 1 (mouse) | | | Not determined | | 1 | 2882194 | 36882352 | Mouse | 13824984 | Twq5_m | testis weight QTL 5 (mouse) | | | | | 1 | 3069992 | 184732197 | Mouse | 15092044 | Wtgrme1_m | week ten growth rate, maternal effect 1 (mouse) | | | | | 1 | 3280142 | 37782236 | Mouse | 1301471 | Obq2_m | obesity QTL 2 (mouse) | | | Not determined | | 1 | 3941620 | 37941887 | Mouse | 1301891 | Alcp25_m | alcohol preference locus 25 (mouse) | | | Not determined | | 1 | 1 | 25203185 | Mouse | 1300834 | Cia20_m | collagen induced arthritis 20 (mouse) | | | Not determined | | 1 | 1 | 25203185 | Mouse | 15092055 | Lgrme1_m | late growth rate, maternal effect 1 (mouse) | | | | | 1 | 3280142 | 37782236 | Mouse | 15092050 | Wsegrme1_m | week seven growth rate, maternal effect 1 (mouse) | | | | | 1 | 3280142 | 37782236 | Mouse | 15092051 | Wegrme1_m | week eight growth rate, maternal effect 1 (mouse) | | | | | 1 | 3280142 | 37782236 | Mouse | 15092048 | Wsigrme1_m | week six growth rate, maternal effect 1 (mouse) | | | | | 1 | 3280142 | 37782236 | Mouse | 1301482 | Morph1_m | morphine antinociception 1 (mouse) | | | Not determined | | 1 | 1 | 30367747 | Mouse | 10043970 | Obq23_m | obesity QTL 23 (mouse) | | | Not determined | | 1 | 5012665 | 39012665 | Mouse | 10412226 | Alpq4_m | alcohol preference QTL 4 (mouse) | | | Not determined | | 1 | 1 | 22976684 | Mouse |
Ensembl Acc Id: |
ENSMUST00000104130 |
Type: |
CODING |
Position: |
Mouse Assembly | Chr | Position (strand) | Source |
---|
GRCm39 Ensembl | 1 | 11,204,335 - 11,204,462 (-) | Ensembl | GRCm38.p6 Ensembl | 1 | 11,134,111 - 11,134,238 (-) | Ensembl |
|
RefSeq Acc Id: |
XR_004936838 |
Type: |
NON-CODING |
Position: |
Mouse Assembly | Chr | Position (strand) | Source |
---|
GRCm39 | 1 | 11,204,335 - 11,204,462 (-) | NCBI |
|
Sequence: |
AGCACTTGGTGTGTTTTTGTTCAGCTGTTGGACAAAGGCCAGTTGAACGGGTGCAAAAAATAAATCCTCTTTTGCAACCCAGAACTCACTGCTCAGTATGAGTTTTGATGCATACCAGAAGGAATATA
hide sequence
|
|
|