Symbol: |
Gm25038 |
Name: |
predicted gene, 25038 |
RGD ID: |
14997786 |
MGI Page |
MGI |
Description: |
Acts upstream of or within response to bacterium. |
Type: |
snorna
|
RefSeq Status: |
MODEL |
RGD Orthologs |
|
Alliance Orthologs |
|
More Info |
more info ...
|
More Info |
|
Latest Assembly: |
GRCm39 - Mouse Genome Assembly GRCm39 |
Position: |
Mouse Assembly | Chr | Position (strand) | Source | Genome Browsers |
---|
JBrowse | NCBI | UCSC | Ensembl |
---|
GRCm39 | 16 | 78,220,618 - 78,220,747 (-) | NCBI | GRCm39 | GRCm39 | mm39 | | GRCm39 Ensembl | 16 | 78,220,618 - 78,220,747 (-) | Ensembl | | GRCm39 Ensembl | | | GRCm38 | 16 | 78,423,730 - 78,423,859 (-) | NCBI | GRCm38 | GRCm38 | mm10 | GRCm38 | GRCm38.p6 Ensembl | 16 | 78,423,730 - 78,423,859 (-) | Ensembl | GRCm38 | | mm10 | GRCm38 | Cytogenetic Map | 16 | C3.1 | NCBI | | | | |
|
JBrowse: |
View Region in Genome Browser (JBrowse)
|
Model |
|
Gm25038 (Mus musculus - house mouse) |
Mouse Assembly | Chr | Position (strand) | Source | Genome Browsers |
---|
JBrowse | NCBI | UCSC | Ensembl |
---|
GRCm39 | 16 | 78,220,618 - 78,220,747 (-) | NCBI | GRCm39 | GRCm39 | mm39 | | GRCm39 Ensembl | 16 | 78,220,618 - 78,220,747 (-) | Ensembl | | GRCm39 Ensembl | | | GRCm38 | 16 | 78,423,730 - 78,423,859 (-) | NCBI | GRCm38 | GRCm38 | mm10 | GRCm38 | GRCm38.p6 Ensembl | 16 | 78,423,730 - 78,423,859 (-) | Ensembl | GRCm38 | | mm10 | GRCm38 | Cytogenetic Map | 16 | C3.1 | NCBI | | | | |
|
SNORA75B (Homo sapiens - human) |
Human Assembly | Chr | Position (strand) | Source | Genome Browsers |
---|
JBrowse | NCBI | UCSC | Ensembl |
---|
GRCh38 | 4 | 17,320,746 - 17,320,882 (-) | NCBI | GRCh38 | GRCh38 | hg38 | GRCh38 | GRCh38.p14 Ensembl | 4 | 17,320,746 - 17,320,882 (-) | Ensembl | GRCh38 | | hg38 | GRCh38 | GRCh37 | 4 | 17,322,369 - 17,322,505 (-) | NCBI | GRCh37 | GRCh37 | hg19 | GRCh37 | Cytogenetic Map | 4 | p15.32 | NCBI | | | | | T2T-CHM13v2.0 | 4 | 17,302,431 - 17,302,567 (-) | NCBI | | T2T-CHM13v2.0 | | |
|
.
Predicted Target Of
Count of predictions: | 68 | Count of miRNA genes: | 67 | Interacting mature miRNAs: | 67 | Transcripts: | ENSMUST00000082928 | Prediction methods: | Miranda, Rnahybrid | Result types: | miRGate_prediction |
1301394 | Eae11_m | susceptibility to experimental allergic encephalomyelitis 11 (mouse) | | | Not determined | | 16 | 53561891 | 87562035 | Mouse | 1302194 | Pgia10_m | proteoglycan induced arthritis 10 (mouse) | | | Not determined | | 16 | 68600722 | 98008968 | Mouse | 26884376 | Skwq4_m | skull length QTL 4, 5 week (mouse) | | | | | 16 | 8417864 | 90896888 | Mouse | 1302096 | Aod1a_m | autoimmune ovarian dysgenesis 1a (mouse) | | | Not determined | | 16 | 35446643 | 92573008 | Mouse | 4141212 | Imraq3_m | immune response to AAV2 QTL 3 (mouse) | | | Not determined | | 16 | 44383350 | 78383506 | Mouse | 1558740 | Bpq9_m | blood pressure QTL 9 (mouse) | | | Not determined | | 16 | 63327336 | 97327472 | Mouse | 1301719 | Remslp3_m | rapid eye movement sleep 3 (mouse) | | | Not determined | | 16 | 44383350 | 78383506 | Mouse | 1357778 | Diobq_m | diet-induced obesity QTL (mouse) | | | Not determined | | 16 | 42197817 | 82331174 | Mouse | 4141113 | Tgq28_m | triglyceride QTL 28 (mouse) | | | Not determined | | | 62986646 | 96986646 | Mouse | 1301364 | Lith14_m | lithogenic gene 14 (mouse) | | | Not determined | | 16 | 55661846 | 89661961 | Mouse | 4142262 | Lmr18_m | leishmaniasis resistance 18 (mouse) | | | Not determined | | 16 | 69127611 | 98008968 | Mouse | 11049573 | Lmr18b_m | leishmaniasis resistance 18b (mouse) | | | | | 16 | 69127611 | 98008968 | Mouse | 1301598 | Renf2_m | renal failure 2 (mouse) | | | Not determined | | 16 | 70380252 | 98008968 | Mouse | 11049574 | Lmr18a_m | leishmaniasis resistance 18a (mouse) | | | | | 16 | 69127611 | 98008968 | Mouse | 11522753 | Cocia19_m | cocaine-induced activity, QTL 19 (mouse) | | | | | 16 | 69254482 | 98008968 | Mouse | 10412076 | Pod_m | plasticity of ocular dominance (mouse) | | | Not determined | | 16 | 73544845 | 84350326 | Mouse | 1300928 | Etia_m | ethanol induced activation (mouse) | | | Not determined | | 16 | 63313907 | 97314016 | Mouse | 14928310 | Manh80_m | mandible shape 80 (mouse) | | | | | 16 | 48219841 | 82219841 | Mouse | 1301125 | Sluc27_m | susceptibility to lung cancer 27 (mouse) | | | Not determined | | 16 | 61608644 | 95608764 | Mouse | 12880403 | Sefq1_m | stress effect QTL 1 (mouse) | | | | | 16 | 74696643 | 78896643 | Mouse | 1357517 | Bwtn1_m | body weight at necropsy 1 (mouse) | | | Not determined | | 16 | 20019329 | 85600826 | Mouse | 26884416 | Bzwq5_m | bi-zygomatic width QTL 5, 5 week (mouse) | | | | | 16 | 37320362 | 84696888 | Mouse | 1301032 | Tauph_m | tau phosphorylation (mouse) | | | Not determined | | 16 | 69076132 | 98008968 | Mouse |
Ensembl Acc Id: |
ENSMUST00000082928 |
Type: |
CODING |
Position: |
Mouse Assembly | Chr | Position (strand) | Source |
---|
GRCm39 Ensembl | 16 | 78,220,618 - 78,220,747 (-) | Ensembl | GRCm38.p6 Ensembl | 16 | 78,423,730 - 78,423,859 (-) | Ensembl |
|
RefSeq Acc Id: |
XR_004939375 |
Type: |
NON-CODING |
Position: |
Mouse Assembly | Chr | Position (strand) | Source |
---|
GRCm39 | 16 | 78,220,618 - 78,220,747 (-) | NCBI |
|
Sequence: |
GTCTTTTCACTGAGCCCCTTTCTGTCAACCGGTGGCAGATTATGGATTCGCACAAGAGGAGAGAGGTCACAGAGCTAGCACTTATCTTCTGTTTTTGCAGAGGTATATTTGGTTGTTGTGTGAGACAC TC
hide sequence
|
|
|