Symbol: |
Gm24732 |
Name: |
predicted gene, 24732 |
RGD ID: |
14996911 |
MGI Page |
MGI |
Description: |
|
Type: |
snrna
|
RefSeq Status: |
MODEL |
Latest Assembly: |
GRCm39 - Mouse Genome Assembly GRCm39 |
Position: |
Mouse Assembly | Chr | Position (strand) | Source | Genome Browsers |
---|
JBrowse | NCBI | UCSC | Ensembl |
---|
GRCm39 | 1 | 32,607,440 - 32,607,502 (-) | NCBI | GRCm39 | GRCm39 | mm39 | | GRCm39 Ensembl | 1 | 32,607,440 - 32,607,502 (-) | Ensembl | | GRCm39 Ensembl | | | GRCm38 | 1 | 32,568,359 - 32,568,421 (-) | NCBI | GRCm38 | GRCm38 | mm10 | GRCm38 | GRCm38.p6 Ensembl | 1 | 32,568,359 - 32,568,421 (-) | Ensembl | GRCm38 | | mm10 | GRCm38 | Cytogenetic Map | 1 | B | NCBI | | | | |
|
JBrowse: |
View Region in Genome Browser (JBrowse)
|
Model |
|
.
Predicted Target Of
Count of predictions: | 106 | Count of miRNA genes: | 103 | Interacting mature miRNAs: | 103 | Transcripts: | ENSMUST00000158864 | Prediction methods: | Miranda, Rnahybrid | Result types: | miRGate_prediction |
11039528 | Ccc3_m | colitis susceptibility in the Collaborative Cross 3 (mouse) | | | | | 1 | 3680142 | 195051546 | Mouse | 1301011 | Cplaq4_m | circadian period of locomotor activity 4 (mouse) | | | Not determined | | 1 | 9673442 | 43673601 | Mouse | 1301073 | Orch5_m | autoimmune orchitis resistance 5 (mouse) | | | Not determined | | 1 | 19065351 | 53065454 | Mouse | 1301275 | Sle10_m | systematic lupus erythematosus susceptibility 10 (mouse) | | | Not determined | | 1 | 2882194 | 36882352 | Mouse | 15092046 | Wngrme1_m | week nine growth rate, maternal effect 1 (mouse) | | | | | 1 | 3280142 | 37782236 | Mouse | 11100001 | Col4a1m1_m | collagen, type IV, alpha 1 modifier 1 (mouse) | | | | | 1 | 25550191 | 62946882 | Mouse | 1301370 | Adip1_m | adiposity 1 (mouse) | | | Not determined | | 1 | 2882194 | 36882352 | Mouse | 13824984 | Twq5_m | testis weight QTL 5 (mouse) | | | | | 1 | 3069992 | 184732197 | Mouse | 15092044 | Wtgrme1_m | week ten growth rate, maternal effect 1 (mouse) | | | | | 1 | 3280142 | 37782236 | Mouse | 1301240 | Sluc15_m | susceptibility to lung cancer 15 (mouse) | | | Not determined | | 1 | 19065351 | 53065454 | Mouse | 1301471 | Obq2_m | obesity QTL 2 (mouse) | | | Not determined | | 1 | 3941620 | 37941887 | Mouse | 14700685 | Civq2_m | cerebral infarct volume QTL 2 (mouse) | | | | | 1 | 11340482 | 45340482 | Mouse | 1301756 | Pgia1_m | proteoglycan induced arthritis 1 (mouse) | | | Not determined | | 1 | 19065351 | 53065454 | Mouse | 15092055 | Lgrme1_m | late growth rate, maternal effect 1 (mouse) | | | | | 1 | 3280142 | 37782236 | Mouse | 12880407 | V125Dq2_m | vitamin D active form serum level QTL 2 (mouse) | | | | | 1 | 19339081 | 53339081 | Mouse | 15092050 | Wsegrme1_m | week seven growth rate, maternal effect 1 (mouse) | | | | | 1 | 3280142 | 37782236 | Mouse | 15092051 | Wegrme1_m | week eight growth rate, maternal effect 1 (mouse) | | | | | 1 | 3280142 | 37782236 | Mouse | 15092048 | Wsigrme1_m | week six growth rate, maternal effect 1 (mouse) | | | | | 1 | 3280142 | 37782236 | Mouse | 1357475 | w3q13_m | weight 3 weeks QTL 13 (mouse) | | | Not determined | | 1 | 23109591 | 73976915 | Mouse | 10043970 | Obq23_m | obesity QTL 23 (mouse) | | | Not determined | | 1 | 5012665 | 39012665 | Mouse | 12880409 | V125Dq1_m | vitamin D active form serum level QTL 1 (mouse) | | | | | 1 | 26039160 | 60039160 | Mouse | 4142433 | Hbnr1_m | Heligmosomoides bakeri nematode resistance 1 (mouse) | | | Not determined | | | 25550191 | 58273271 | Mouse |
Ensembl Acc Id: |
ENSMUST00000158864 |
Type: |
CODING |
Position: |
Mouse Assembly | Chr | Position (strand) | Source |
---|
GRCm39 Ensembl | 1 | 32,607,440 - 32,607,502 (-) | Ensembl | GRCm38.p6 Ensembl | 1 | 32,568,359 - 32,568,421 (-) | Ensembl |
|
RefSeq Acc Id: |
XR_004936748 |
Type: |
NON-CODING |
Position: |
Mouse Assembly | Chr | Position (strand) | Source |
---|
GRCm39 | 1 | 32,607,440 - 32,607,502 (-) | NCBI |
|
Sequence: |
AGCTAACACAGCTCTTGTACAATTTTTCTAGCAAGTTTTCCACACTTTGGTTGGAAGACCCGT
hide sequence
|
|
|