P2ry2<sup>em5Mcwi</sup> (purinergic receptor P2Y2; CRISPR/Cas9 induced mutant 5, Mcwi) - Rat Genome Database

Send us a Message



Submit Data |  Help |  Video Tutorials |  News |  Publications |  Download |  REST API |  Citing RGD |  Contact   
Gene: P2ry2em5Mcwi (purinergic receptor P2Y2; CRISPR/Cas9 induced mutant 5, Mcwi) Rattus norvegicus
Analyze
Symbol: P2ry2em5Mcwi
Name: purinergic receptor P2Y2; CRISPR/Cas9 induced mutant 5, Mcwi
RGD ID: 14394507
Description: CRISPR/Cas9 system was used to induce a mutation in the P2ry2 gene of SS/JrHsdMcwi rat embryos. The resulting mutation is a 27-bp deletion in exon 3
Type: allele
Previously known as: P2ry2^[em5Mcwi]
Is Marker For: Strains:   SS-P2ry2em5Mcwi  
Latest Assembly: mRatBN7.2 - mRatBN7.2 Assembly
Position: No map positions available.


References

Genomics

Allelic Variants
Name Chromosome Start Pos End Pos Reference Nucleotide Variant Nucleotide Variant Type Assembly
P2ry2em5Mcwi-var1 chr1 155354461 155354487 AAATGGCCAGTGGTCACCCTGGGCGTA - deletion mRatBN7.2

Related Rat Strains
The following Strains have been annotated to P2ry2em5Mcwi


Expression


Sequence

Nucleotide Sequences


Additional Information