D2Rat28 Marker Search Result - Rat Genome Database

Send us a Message



Submit Data |  Help |  Video Tutorials |  News |  Publications |  Download |  REST API |  Citing RGD |  Contact   
Pathways

Marker: D2Rat28

Symbol: D2Rat28
Previously known as: oxsts6845; R028-D02; R0028-D02; 
RGD ID: 35995
Expected Size: 271 (bp)
Position
Rat AssemblyChrPosition (strand)SourceJBrowse
mRatBN7.22104,814,877 - 104,815,148 (+)MAPPERmRatBN7.2
Rnor_6.02107,083,299 - 107,083,569NCBIRnor6.0
Rnor_5.02126,824,467 - 126,824,737UniSTSRnor5.0
RGSC_v3.42107,574,469 - 107,574,826RGDRGSC3.4
RGSC_v3.42107,574,499 - 107,574,769UniSTSRGSC3.4
Celera2100,131,211 - 100,131,482UniSTS
RGSC_v3.12107,519,431 - 107,519,788RGD
RH 3.4 Map2737.7RGD
RH 3.4 Map2737.7UniSTS
SHRSP x BN Map238.7498UniSTS
SHRSP x BN Map238.7498RGD
FHH x ACI Map250.0599RGD
Cytogenetic Map2q24UniSTS
Is Marker For: Strains:   AVN/Orl ; BBDR/Rhw ; BBDP/Rhw ; BC/CpbU ; BDIX/Han ; BDVII/Cub ; BN-Lx/Cub ; BN/SsNHsd ; BP/Cub ; BUF/Pit ; COP/OlaHsd ; DA/PitN ; FHH/Eur ; F344/Pit ; GK/KyoSwe ; DON/Melb ; M520/N ; IS/Kyo ; WN/N ; LH/Mav ; LE/Mol ; LEW/Pit ; LOU/CHan ; MHS/Gib ; MNR/N ; MNRA/N ; MNS/Gib ; MR/Pit ; NEDH/K ; NP9 ; ODU/N ; OKA/Wsl ; P5C ; PVG/Pit ; SD/Rij ; SHR/OlaHsd ; SR/Jr ; SHRSP/Riv ; SS/Jr ; WAG/RijKyo ; WF/Pit ; WIST/Nhg ; WKY/OlaHsd ; WTC/Kyo ; WKY.SHR-(D2Rat174-D2Rat28)
Genes:   Tbl1xr1  


Annotation


References - curated
# Reference Title Reference Citation
1. Data downloaded from Wellcome Trust, University of Oxford Data downloaded from Wellcome Trust, University of Oxford
2. High-density rat radiation hybrid maps containing over 24,000 SSLPs, genes, and ESTs provide a direct link to the rat genome sequence. Kwitek AE, etal., Genome Res. 2004 Apr;14(4):750-7
3. Rat Genetic Map Data Rat Genetic Map Data, Whitehead Institute for Biomedical Research/MIT Center for Genome Research Website, http://waldo.wi.mit.edu/rat/public/distribution/rat_sslp_releases/jan00/
4. Electronic Transfer of SSLP Data Rat Genetic Mapping Project, Whitehead Institute for Biomedical Research. APR. 2001.
5. UniSTS Pipeline RGD automated pipelines

Strains and Sequence

Sequence
 
Forward Primer GAGTGCAAAGCCCAGTCTTC
Reverse Primer CCACATGCCTTTCAGTTTCC
 

Region

Nucleotide Sequences
GenBank Nucleotide JH613470.1 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles


Additional Information

Database Acc Id Source(s)
NCBI Gene 365755 UniSTS