D2Mgh13 Marker Search Result - Rat Genome Database

Send us a Message
Submit Data |  Help |  Video Tutorials |  News |  Publications |  Download |  REST API |  Citing RGD |  Contact   
Search RGD Grant Resources Citing RGD About Us Contact Us
Genes Variants Community Projects QTLs Strains Markers Genome Information Ontologies Cell Lines References Download Submit Data
OntoMate (Literature Search) JBrowse (Genome Browser) Synteny Browser (VCMap) Variant Visualizer Multi-Ontology Enrichment (MOET) Gene-Ortholog Location Finder (GOLF) InterViewer (Protein-Protein Interactions) PhenoMiner (Quatitative Phenotypes) Gene Annotator OLGA (Gene List Generator) AllianceMine GViewer (Genome Viewer)
Aging & Age-Related Disease Behavioral & Substance Use Disorder Cancer & Neoplastic Disease Cardiovascular Disease Coronavirus Disease Developmental Disease Diabetes Hematologic Disease Immune & Inflammatory Disease Infectious Disease Liver Disease Neurological Disease Obesity & Metabolic Syndrome Renal Disease Respiratory Disease Sensory Organ Disease
Find Models Genetic Models Autism Models Rat PhenoMiner (Quantitative Phenotypes) Chinchilla PhenoMiner Expected Ranges (Quantitative Phenotype) PhenoMiner Term Comparison Hybrid Rat Diversity Panel Phenotypes Phenotypes in Other Animal Models Animal Husbandry Strain Medical Records Phylogenetics Strain Availability Calendar Rats 101 Submissions Photo Archive
Pathways
Rat Community Forum Directory of Rat Laboratories Video Tutorials News RGD Publications RGD Presentations Archive Nomenclature Guidelines Resource Links Laboratory Resources Employment Resources
Advanced Search (OLGA)

Marker: D2Mgh13

Symbol: D2Mgh13
Previously known as: oxsts9024; R1100-C08; 
RGD ID: 11478
Expected Size: 141 (bp)
Position
Rat AssemblyChrPosition (strand)SourceJBrowse
GRCr82238,161,243 - 238,161,384 (+)Marker Load Pipeline
mRatBN7.22235,500,980 - 235,501,121 (+)MAPPERmRatBN7.2
Rnor_6.02252,466,425 - 252,466,565NCBIRnor6.0
Rnor_5.02270,992,735 - 270,992,875UniSTSRnor5.0
RGSC_v3.42244,809,624 - 244,809,764UniSTSRGSC3.4
RGSC_v3.42244,809,623 - 244,809,764RGDRGSC3.4
Celera2227,479,263 - 227,479,403UniSTS
RGSC_v3.12244,796,363 - 244,796,504RGD
SHRSP x BN Map2101.1198RGD
SHRSP x BN Map2101.1198UniSTS
Cytogenetic Map2q44UniSTS
Is Marker For: Strains:   ACI/N ; AVN/Orl ; BBDP/Rhw ; BC/CpbU ; BDIX/Han ; BDVII/Cub ; BN-Lx/Cub ; BN/SsNHsd ; BUF/Pit ; COP/OlaHsd ; DA/PitN ; FHH/Eur ; F344/Pit ; GH/Omr ; GK/KyoSwe ; DON/Melb ; IS/Kyo ; WN/N ; LH/Mav ; LE/Mol ; LEW/Pit ; LOU/CHan ; MHS/Gib ; MNR/N ; MNRA/N ; MNS/Gib ; MR/Pit ; NEDH/K ; NP9 ; ODU/N ; OKA/Wsl ; OM/Ztm ; P5C ; PVG/Pit ; SD/Rij ; SHR/OlaHsd ; SR/Jr ; SS/Jr ; WAG/RijKyo ; WF/Pit ; WIST/Nhg ; WKY/OlaHsd ; WTC/Kyo ; SHR.WKY-(D2Rat10-D2Mgh13)
Genes:   Uox  


Annotation


References - curated
# Reference Title Reference Citation
1. Data downloaded from Wellcome Trust, University of Oxford Data downloaded from Wellcome Trust, University of Oxford
2. Rat Genetic Map Data Rat Genetic Map Data, Whitehead Institute for Biomedical Research/MIT Center for Genome Research Website, http://waldo.wi.mit.edu/rat/public/distribution/rat_sslp_releases/jan00/
3. Electronic Transfer of SSLP Data Rat Genetic Mapping Project, Whitehead Institute for Biomedical Research. APR. 2001.
4. UniSTS Pipeline RGD automated pipelines

Strains and Sequence

Sequence
 
Forward Primer TCTGGCTGTCTATCCTGCG
Reverse Primer AAGAGACTCCTGCGAATCTCC
 

Region

Genes in Region
The following Genes overlap with this region.    Full Report CSV TAB Printer Analysis Tools
RGD IDSymbolNameChrStartStopSpecies
70901Dnase2bdeoxyribonuclease 2 beta2238131182238168041Rat
621369Uoxurate oxidase2238147130238183320Rat

Nucleotide Sequences
GenBank Nucleotide FT000729 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles


QTLs in Region (GRCr8)
The following QTLs overlap with this region.    Full Report CSV TAB Printer Gviewer
RGD IDSymbolNameLODP ValueTraitSub TraitChrStartStopSpecies
1331734Bp204Blood pressure QTL 2043.61192arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)2170656145239614549Rat
1331767Hrtrt12Heart rate QTL 123.373heart pumping trait (VT:2000009)heart rate (CMO:0000002)2221088977243501206Rat
631501Bp101Blood pressure QTL 1012.4arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)2205135267250135267Rat
2307174Activ3Activity QTL 34.830.000058locomotor behavior trait (VT:0001392)number of entries into a discrete space in an experimental apparatus (CMO:0000960)2210956252251712708Rat
8693697Alc36Alcohol consumption QTL 3620.592drinking behavior trait (VT:0001422)calculated ethanol drink intake rate (CMO:0001615)2219814164239320906Rat
1331794Bp202Blood pressure QTL 2023.66819arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)2143344967251712708Rat
1298075Scl17Serum cholesterol level QTL 173.4blood cholesterol amount (VT:0000180)plasma total cholesterol level (CMO:0000585)2214404877251712708Rat
1331805Cm29Cardiac mass QTL 293.50746heart mass (VT:0007028)heart wet weight (CMO:0000069)2143344967251712708Rat
2293833Kiddil8Kidney dilation QTL 82.9kidney pelvis morphology trait (VT:0004194)hydronephrosis severity score (CMO:0001208)2220274283249795005Rat
1598835Anxrr18Anxiety related response QTL 182.98body movement coordination trait (VT:0005424)number of rearing movements in an experimental apparatus (CMO:0001752)2203664411248664411Rat
1300126Bp175Blood pressure QTL 1753.46arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)2204795005249795005Rat
7207490Bss111Bone structure and strength QTL 1116.4femur morphology trait (VT:0000559)femur midshaft cortical cross-sectional area (CMO:0001663)2214404877251712708Rat
7207484Bss108Bone structure and strength QTL 1085.3femur strength trait (VT:0010010)femur total energy absorbed before break (CMO:0001677)2214404877251712708Rat
2313073Bmd75Bone mineral density QTL 754.10.0001tibia mineral mass (VT:1000283)total volumetric bone mineral density (CMO:0001728)2218051934251712708Rat
8693622Alc26Alcohol consumption QTL 262.40.667drinking behavior trait (VT:0001422)calculated ethanol drink intake rate (CMO:0001615)2223810546243965570Rat
7207482Bss107Bone structure and strength QTL 1077femur strength trait (VT:0010010)femur ultimate force (CMO:0001675)2214404877251712708Rat
2293844Kiddil7Kidney dilation QTL 73.5kidney pelvis morphology trait (VT:0004194)hydronephrosis severity score (CMO:0001208)2220274283249795005Rat
1641891Alcrsp17Alcohol response QTL 17response to alcohol trait (VT:0010489)duration of loss of righting reflex (CMO:0002289)2151869660251712708Rat
2317752Glom23Glomerulus QTL 233.6urine protein amount (VT:0005160)urine protein level (CMO:0000591)2196140964251540988Rat
61467Bp14Blood pressure QTL 142.2arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)2205135267250135267Rat
1549836Bss2Bone structure and strength QTL 27.5femur strength trait (VT:0010010)femur midshaft polar moment of inertia (CMO:0001669)2214404877251712708Rat
70175BpQTLCluster3Blood pressure QTL cluster 34.128arterial blood pressure trait (VT:2000000)absolute change in systolic blood pressure (CMO:0000607)2205135267250135267Rat


Additional Information

Database Acc Id Source(s)
NCBI Gene 114768 UniSTS