D14Mgh4 Marker Search Result - Rat Genome Database

Send us a Message
Submit Data |  Help |  Video Tutorials |  News |  Publications |  Download |  REST API |  Citing RGD |  Contact   
Search RGD Grant Resources Citing RGD About Us Contact Us
Genes Variants Community Projects QTLs Strains Markers Genome Information Ontologies Cell Lines References Download Submit Data
OntoMate (Literature Search) JBrowse (Genome Browser) Synteny Browser (VCMap) Variant Visualizer Multi-Ontology Enrichment (MOET) Gene-Ortholog Location Finder (GOLF) InterViewer (Protein-Protein Interactions) PhenoMiner (Quatitative Phenotypes) Gene Annotator OLGA (Gene List Generator) AllianceMine GViewer (Genome Viewer)
Aging & Age-Related Disease Behavioral & Substance Use Disorder Cancer & Neoplastic Disease Cardiovascular Disease Coronavirus Disease Developmental Disease Diabetes Hematologic Disease Immune & Inflammatory Disease Infectious Disease Liver Disease Neurological Disease Obesity & Metabolic Syndrome Renal Disease Respiratory Disease Sensory Organ Disease
Find Models Genetic Models Autism Models Rat PhenoMiner (Quantitative Phenotypes) Chinchilla PhenoMiner Expected Ranges (Quantitative Phenotype) PhenoMiner Term Comparison Hybrid Rat Diversity Panel Phenotypes Phenotypes in Other Animal Models Animal Husbandry Strain Medical Records Phylogenetics Strain Availability Calendar Rats 101 Submissions Photo Archive
Pathways
Rat Community Forum Directory of Rat Laboratories Video Tutorials News RGD Publications RGD Presentations Archive Nomenclature Guidelines Resource Links Laboratory Resources Employment Resources
Advanced Search (OLGA)

Marker: D14Mgh4

Symbol: D14Mgh4
Previously known as: oxsts5176; 
RGD ID: 10781
Expected Size: 250 (bp)
Position
Rat AssemblyChrPosition (strand)SourceJBrowse
mRatBN7.26132,309,318 - 132,309,572 (+)MAPPERmRatBN7.2
Rnor_6.06138,041,417 - 138,041,666NCBIRnor6.0
Rnor_6.06134,017,217 - 134,017,466NCBIRnor6.0
Rnor_5.06143,171,100 - 143,171,349UniSTSRnor5.0
Rnor_5.06147,034,023 - 147,034,272UniSTSRnor5.0
RGSC_v3.46138,229,582 - 138,229,831UniSTSRGSC3.4
RGSC_v3.46138,229,581 - 138,229,831RGDRGSC3.4
Celera6129,843,383 - 129,843,632UniSTS
RGSC_v3.16138,235,768 - 138,236,018RGD
RH 3.4 Map6782.9RGD
RH 3.4 Map6782.9UniSTS
RH 2.0 Map61128.7RGD
Is Marker For: Strains:   ACI/N ; AVN/Orl ; BBDR/Rhw ; BBDP/Rhw ; BC/CpbU ; BDIX/Han ; BDVII/Cub ; BN/SsNHsd ; BP/Cub ; BUF/Pit ; COP/OlaHsd ; DA/PitN ; FHH/Eur ; F344/Pit ; GK/KyoSwe ; DON/Melb ; M520/N ; IS/Kyo ; WN/N ; LH/Mav ; LE/Mol ; LEW/Pit ; LOU/CHan ; LN/Mav ; MHS/Gib ; MNR/N ; MNRA/N ; MNS/Gib ; MR/Pit ; NEDH/K ; NP9 ; ODU/N ; OKA/Wsl ; OM/Ztm ; P5C ; PVG/Pit ; SD/Rij ; SHR/OlaHsd ; SR/Jr ; SHRSP/Riv ; SS/Jr ; WAG/RijKyo ; WF/Pit ; WIST/Nhg ; WKY/OlaHsd ; WTC/Kyo
Genes:   Ighen  


Annotation


References - curated
# Reference Title Reference Citation
1. A linkage map of the rat genome derived from three F2 crosses. Bihoreau MT, etal., Genome Res 1997 May;7(5):434-40.
2. Data downloaded from Wellcome Trust, University of Oxford Data downloaded from Wellcome Trust, University of Oxford
3. High-density rat radiation hybrid maps containing over 24,000 SSLPs, genes, and ESTs provide a direct link to the rat genome sequence. Kwitek AE, etal., Genome Res. 2004 Apr;14(4):750-7
4. UniSTS Pipeline RGD automated pipelines
5. RH Map Project RH Map Project, Laboratory of Genetic Research Website, 1-JUL-99, Laboratory of Genetic Research, Medical College of Wisconsin, http://www.lgr.mcw.edu/LGR/
6. A high density integrated genetic linkage and radiation hybrid map of the laboratory rat Steen RG, Kwitek-Black AE, etal., Genome Research, 1999, 6:1-8

Strains and Sequence

Sequence
 
Forward Primer CAGAGTGAGTCACTCGGCAG
Reverse Primer CTGAAACAGGGCTTGCTCAC
 

Region

Nucleotide Sequences
GenBank Nucleotide JH615665.1 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  X52421 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles


Additional Information

Database Acc Id Source(s)
NCBI Gene 24488 UniSTS