Symbol:
Tbx21
Name:
T-box transcription factor 21
RGD ID:
1308264
Description:
Predicted to enable DNA-binding transcription activator activity, RNA polymerase II-specific; DNA-binding transcription repressor activity, RNA polymerase II-specific; and RNA polymerase II cis-regulatory region sequence-specific DNA binding activity. Predicted to be involved in several processes, including T-helper 1 cell lineage commitment; negative regulation of T-helper 17 cell lineage commitment; and regulation of gene expression. Predicted to act upstream of or within T cell differentiation and positive regulation of isotype switching to IgG isotypes. Predicted to be located in neuronal cell body. Predicted to be active in chromatin and nucleus. Human ortholog(s) of this gene implicated in asthma, nasal polyps, and aspirin intolerance and immunodeficiency 88. Orthologous to human TBX21 (T-box transcription factor 21); PARTICIPATES IN interleukin-12 signaling pathway; interleukin-27 signaling pathway; INTERACTS WITH 1-naphthyl isothiocyanate; 2,3,7,8-tetrachlorodibenzodioxine; acetamide.
Type:
protein-coding
RefSeq Status:
PROVISIONAL
Previously known as:
LOC303496; T-box 21; T-box transcription factor TBX21
RGD Orthologs
Alliance Orthologs
More Info
more info ...
More Info
Species
Gene symbol and name
Data Source
Assertion derived from
less info ...
Orthologs 1
Homo sapiens (human):
TBX21 (T-box transcription factor 21) HGNC
EggNOG, Ensembl, HomoloGene, Inparanoid, NCBI, OMA, OrthoDB, OrthoMCL, Panther, PhylomeDB, Treefam
Mus musculus (house mouse):
Tbx21 (T-box 21) Transitive Ortholog Pipeline
Transitive Ortholog Pipeline
Chinchilla lanigera (long-tailed chinchilla):
Tbx21 (T-box transcription factor 21) Transitive Ortholog Pipeline
Transitive Ortholog Pipeline
Pan paniscus (bonobo/pygmy chimpanzee):
TBX21 (T-box transcription factor 21) Transitive Ortholog Pipeline
Transitive Ortholog Pipeline
Canis lupus familiaris (dog):
TBX21 (T-box transcription factor 21) Transitive Ortholog Pipeline
Transitive Ortholog Pipeline
Ictidomys tridecemlineatus (thirteen-lined ground squirrel):
Tbx21 (T-box transcription factor 21) Transitive Ortholog Pipeline
Transitive Ortholog Pipeline
Sus scrofa (pig):
TBX21 (T-box transcription factor 21) Transitive Ortholog Pipeline
Transitive Ortholog Pipeline
Chlorocebus sabaeus (green monkey):
TBX21 (T-box transcription factor 21) Transitive Ortholog Pipeline
Transitive Ortholog Pipeline
Heterocephalus glaber (naked mole-rat):
Tbx21 (T-box transcription factor 21) Transitive Ortholog Pipeline
Transitive Ortholog Pipeline
Alliance orthologs 3
Homo sapiens (human):
TBX21 (T-box transcription factor 21)
Alliance
DIOPT (Ensembl Compara|HGNC|Hieranoid|InParanoid|OMA|OrthoFinder|OrthoInspector|PANTHER|PhylomeDB|SonicParanoid)
Mus musculus (house mouse):
Tbx21 (T-box 21)
Alliance
DIOPT (Ensembl Compara|Hieranoid|InParanoid|OMA|OrthoFinder|OrthoInspector|PANTHER|PhylomeDB|SonicParanoid)
Danio rerio (zebrafish):
tbx21 (T-box 21)
Alliance
DIOPT (Ensembl Compara|PANTHER)
Caenorhabditis elegans (roundworm):
tbx-43
Alliance
DIOPT (Ensembl Compara|OrthoFinder|PANTHER)
Latest Assembly:
GRCr8 - GRCr8 Assembly
Position:
Rat Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl GRCr8 10 82,578,751 - 82,595,253 (-) NCBI GRCr8 mRatBN7.2 10 82,082,322 - 82,098,831 (-) NCBI mRatBN7.2 mRatBN7.2 mRatBN7.2 Ensembl 10 82,082,322 - 82,098,831 (-) Ensembl mRatBN7.2 Ensembl UTH_Rnor_SHR_Utx 10 87,030,758 - 87,047,326 (-) NCBI Rnor_SHR UTH_Rnor_SHR_Utx UTH_Rnor_SHRSP_BbbUtx_1.0 10 86,528,813 - 86,545,383 (-) NCBI Rnor_SHRSP UTH_Rnor_SHRSP_BbbUtx_1.0 UTH_Rnor_WKY_Bbb_1.0 10 81,921,417 - 81,937,988 (-) NCBI Rnor_WKY UTH_Rnor_WKY_Bbb_1.0 Rnor_6.0 10 85,032,799 - 85,049,331 (-) NCBI Rnor6.0 Rnor_6.0 rn6 Rnor6.0 Rnor_6.0 Ensembl 10 85,032,799 - 85,049,331 (-) Ensembl Rnor6.0 rn6 Rnor6.0 Rnor_5.0 10 84,822,665 - 84,839,295 (-) NCBI Rnor5.0 Rnor_5.0 rn5 Rnor5.0 RGSC_v3.4 10 85,817,743 - 85,834,178 (-) NCBI RGSC3.4 RGSC_v3.4 rn4 RGSC3.4 RGSC_v3.1 10 85,832,581 - 85,865,421 (-) NCBI Celera 10 80,842,416 - 80,858,935 (-) NCBI Celera Cytogenetic Map 10 q31 NCBI
JBrowse:
View Region in Genome Browser (JBrowse)
Model
Only show annotations with direct experimental evidence (0 objects hidden)
Tbx21 Rat 1,2-dimethylhydrazine decreases expression ISO Tbx21 (Mus musculus) 6480464 1 and 2-Dimethylhydrazine results in decreased expression of TBX21 mRNA CTD PMID:22206623 Tbx21 Rat 1-naphthyl isothiocyanate decreases expression ISO Tbx21 (Mus musculus) 6480464 1-Naphthylisothiocyanate results in decreased expression of TBX21 mRNA CTD PMID:20594950 Tbx21 Rat 1-naphthyl isothiocyanate decreases expression EXP 6480464 1-Naphthylisothiocyanate results in decreased expression of TBX21 mRNA CTD PMID:30723492 Tbx21 Rat 17beta-estradiol multiple interactions ISO TBX21 (Homo sapiens) 6480464 TBX21 protein inhibits the reaction [Estradiol promotes the reaction [ESR1 protein binds to GREB1 enhancer]] more ... CTD PMID:20068169 Tbx21 Rat 17beta-estradiol decreases expression ISO Tbx21 (Mus musculus) 6480464 Estradiol results in decreased expression of TBX21 mRNA CTD PMID:39298647 Tbx21 Rat 2,3,7,8-tetrachlorodibenzodioxine affects expression ISO Tbx21 (Mus musculus) 6480464 Tetrachlorodibenzodioxin affects the expression of TBX21 mRNA CTD PMID:24058054 Tbx21 Rat 2,3,7,8-tetrachlorodibenzodioxine increases expression EXP 6480464 Tetrachlorodibenzodioxin results in increased expression of TBX21 mRNA CTD PMID:34747641 Tbx21 Rat 2,3,7,8-tetrachlorodibenzodioxine decreases expression ISO TBX21 (Homo sapiens) 6480464 Tetrachlorodibenzodioxin results in decreased expression of TBX21 mRNA CTD PMID:27783946 Tbx21 Rat 2-tert-butylhydroquinone multiple interactions ISO Tbx21 (Mus musculus) 6480464 [2-tert-butylhydroquinone results in increased activity of NFE2L2 protein] which results in decreased activity of TBX21 protein CTD PMID:22250088 Tbx21 Rat 4,4'-sulfonyldiphenol decreases methylation ISO Tbx21 (Mus musculus) 6480464 bisphenol S results in decreased methylation of TBX21 exon CTD PMID:33297965 Tbx21 Rat acetamide increases expression EXP 6480464 acetamide results in increased expression of TBX21 mRNA CTD PMID:31881176 Tbx21 Rat acetylsalicylic acid affects response to substance ISO TBX21 (Homo sapiens) 6480464 TBX21 SNP affects the susceptibility to Aspirin CTD PMID:15806396 Tbx21 Rat aflatoxin B1 decreases methylation ISO TBX21 (Homo sapiens) 6480464 Aflatoxin B1 results in decreased methylation of TBX21 exon CTD PMID:30157460 Tbx21 Rat all-trans-retinoic acid decreases expression ISO TBX21 (Homo sapiens) 6480464 Tretinoin results in decreased expression of TBX21 mRNA CTD PMID:17118196 Tbx21 Rat alpha-galactosylceramide multiple interactions ISO Tbx21 (Mus musculus) 6480464 [Ovalbumin co-treated with alpha-galactosylceramide] results in increased expression of TBX21 mRNA CTD PMID:30803854 Tbx21 Rat amphetamine decreases expression EXP 6480464 Amphetamine results in decreased expression of TBX21 mRNA CTD PMID:30779732 Tbx21 Rat antirheumatic drug decreases expression ISO TBX21 (Homo sapiens) 6480464 Antirheumatic Agents results in decreased expression of TBX21 mRNA CTD PMID:24449571 Tbx21 Rat apigenin multiple interactions ISO Tbx21 (Mus musculus) 6480464 Apigenin inhibits the reaction [Ovalbumin results in decreased expression of TBX21 mRNA] and Apigenin inhibits the reaction [Ovalbumin results in decreased expression of TBX21 protein] CTD PMID:36350155 Tbx21 Rat arsane multiple interactions ISO Tbx21 (Mus musculus) 6480464 [sodium arsenite results in increased abundance of Arsenic] which results in decreased expression of TBX21 mRNA and [sodium arsenite results in increased abundance of Arsenic] which results in increased expression of TBX21 mRNA CTD PMID:30889423 and PMID:33148380 Tbx21 Rat arsenic atom multiple interactions ISO Tbx21 (Mus musculus) 6480464 [sodium arsenite results in increased abundance of Arsenic] which results in decreased expression of TBX21 mRNA and [sodium arsenite results in increased abundance of Arsenic] which results in increased expression of TBX21 mRNA CTD PMID:30889423 and PMID:33148380 Tbx21 Rat azathioprine increases expression ISO Tbx21 (Mus musculus) 6480464 Azathioprine results in increased expression of TBX21 mRNA CTD PMID:24184165 Tbx21 Rat benzo[a]pyrene decreases expression ISO Tbx21 (Mus musculus) 6480464 Benzo(a)pyrene results in decreased expression of TBX21 mRNA CTD PMID:21569818 Tbx21 Rat benzo[a]pyrene affects methylation ISO TBX21 (Homo sapiens) 6480464 Benzo(a)pyrene affects the methylation of TBX21 exon more ... CTD PMID:27901495 and PMID:30157460 Tbx21 Rat benzo[a]pyrene multiple interactions ISO Tbx21 (Mus musculus) 6480464 [Benzo(a)pyrene co-treated with benz(a)anthracene co-treated with benzo(b)fluoranthene co-treated with chrysene] results in decreased expression of TBX21 mRNA CTD PMID:27858113 Tbx21 Rat benzo[b]fluoranthene multiple interactions ISO Tbx21 (Mus musculus) 6480464 [Benzo(a)pyrene co-treated with benz(a)anthracene co-treated with benzo(b)fluoranthene co-treated with chrysene] results in decreased expression of TBX21 mRNA CTD PMID:27858113 Tbx21 Rat bisphenol A affects expression EXP 6480464 bisphenol A affects the expression of TBX21 mRNA CTD PMID:25181051 Tbx21 Rat bisphenol A decreases expression EXP 6480464 bisphenol A results in decreased expression of TBX21 mRNA CTD PMID:34947998 and PMID:38750585 Tbx21 Rat bisphenol A multiple interactions ISO Tbx21 (Mus musculus) 6480464 Phytochemicals inhibits the reaction [bisphenol A results in decreased expression of TBX21 protein] CTD PMID:20553123 Tbx21 Rat bisphenol A decreases expression ISO Tbx21 (Mus musculus) 6480464 bisphenol A results in decreased expression of TBX21 protein CTD PMID:20553123 and PMID:27743673 Tbx21 Rat bleomycin A2 increases expression ISO Tbx21 (Mus musculus) 6480464 Bleomycin results in increased expression of TBX21 mRNA CTD PMID:29033951 Tbx21 Rat butanal increases expression ISO TBX21 (Homo sapiens) 6480464 butyraldehyde results in increased expression of TBX21 mRNA CTD PMID:26079696 Tbx21 Rat cannabidiol multiple interactions ISO Tbx21 (Mus musculus) 6480464 Cannabidiol inhibits the reaction [[myelin oligodendrocyte glycoprotein (35-55) results in increased susceptibility to myelin oligodendrocyte glycoprotein (35-55)] which results in increased expression of TBX21 mRNA] CTD PMID:30123217 Tbx21 Rat carbamazepine decreases expression ISO Tbx21 (Mus musculus) 6480464 Carbamazepine results in decreased expression of TBX21 mRNA CTD PMID:22790970 Tbx21 Rat carbon nanotube affects expression ISO Tbx21 (Mus musculus) 6480464 Nanotubes and Carbon affects the expression of TBX21 mRNA CTD PMID:25554681 Tbx21 Rat carbon nanotube multiple interactions ISO Tbx21 (Mus musculus) 6480464 [TBX21 gene mutant form results in increased susceptibility to Nanotubes and Carbon] which results in increased expression of CCL2 protein CTD PMID:24499286 Tbx21 Rat carbon nanotube increases response to substance ISO Tbx21 (Mus musculus) 6480464 TBX21 gene mutant form results in increased susceptibility to Nanotubes and Carbon CTD PMID:24499286 Tbx21 Rat carbon nanotube decreases expression ISO Tbx21 (Mus musculus) 6480464 Nanotubes and Carbon analog results in decreased expression of TBX21 mRNA CTD PMID:25554681 Tbx21 Rat caryophyllene oxide multiple interactions ISO Tbx21 (Mus musculus) 6480464 caryophyllene oxide inhibits the reaction [Ovalbumin results in increased expression of TBX21 mRNA] CTD PMID:28344896 Tbx21 Rat chloroprene decreases expression ISO Tbx21 (Mus musculus) 6480464 Chloroprene results in decreased expression of TBX21 mRNA CTD PMID:23125180 Tbx21 Rat chromium(6+) affects expression ISO Tbx21 (Mus musculus) 6480464 chromium hexavalent ion affects the expression of TBX21 mRNA CTD PMID:28472532 Tbx21 Rat chrysene multiple interactions ISO Tbx21 (Mus musculus) 6480464 [Benzo(a)pyrene co-treated with benz(a)anthracene co-treated with benzo(b)fluoranthene co-treated with chrysene] results in decreased expression of TBX21 mRNA CTD PMID:27858113 Tbx21 Rat chrysin multiple interactions ISO Tbx21 (Mus musculus) 6480464 chrysin inhibits the reaction [Diazinon results in decreased expression of TBX21 mRNA] CTD PMID:36114367 Tbx21 Rat cyclophosphamide multiple interactions ISO Tbx21 (Mus musculus) 6480464 Fungal Polysaccharides inhibits the reaction [Cyclophosphamide results in decreased expression of TBX21 protein] and Levamisole inhibits the reaction [Cyclophosphamide results in decreased expression of TBX21 protein] CTD PMID:32151603 Tbx21 Rat cyclophosphamide decreases expression ISO Tbx21 (Mus musculus) 6480464 Cyclophosphamide results in decreased expression of TBX21 protein CTD PMID:32151603 Tbx21 Rat cytisine decreases expression ISO Tbx21 (Mus musculus) 6480464 cytisine analog results in decreased expression of TBX21 mRNA CTD PMID:17630191 Tbx21 Rat DDT decreases methylation EXP 6480464 DDT results in decreased methylation of TBX21 gene CTD PMID:30207508 Tbx21 Rat decabromodiphenyl ether increases expression ISO Tbx21 (Mus musculus) 6480464 decabromobiphenyl ether results in increased expression of TBX21 mRNA CTD PMID:33571618 Tbx21 Rat dexamethasone decreases expression ISO Tbx21 (Mus musculus) 6480464 Dexamethasone results in decreased expression of TBX21 mRNA CTD PMID:25900201 Tbx21 Rat dexamethasone multiple interactions ISO Tbx21 (Mus musculus) 6480464 Dexamethasone inhibits the reaction [Ovalbumin results in decreased expression of TBX21 mRNA] and Dexamethasone inhibits the reaction [Ovalbumin results in decreased expression of TBX21 protein] CTD PMID:36350155 Tbx21 Rat dextran sulfate multiple interactions ISO Tbx21 (Mus musculus) 6480464 Qingdai compound inhibits the reaction [Dextran Sulfate results in increased expression of TBX21 mRNA] CTD PMID:31737179 Tbx21 Rat dextran sulfate increases expression ISO Tbx21 (Mus musculus) 6480464 Dextran Sulfate results in increased expression of TBX21 mRNA CTD PMID:31737179 Tbx21 Rat diazinon multiple interactions ISO Tbx21 (Mus musculus) 6480464 chrysin inhibits the reaction [Diazinon results in decreased expression of TBX21 mRNA] CTD PMID:36114367 Tbx21 Rat diazinon decreases expression ISO Tbx21 (Mus musculus) 6480464 Diazinon results in decreased expression of TBX21 mRNA CTD PMID:36114367 Tbx21 Rat Dibutyl phosphate affects expression ISO TBX21 (Homo sapiens) 6480464 di-n-butylphosphoric acid affects the expression of TBX21 mRNA CTD PMID:37042841 Tbx21 Rat diclofenac decreases expression ISO Tbx21 (Mus musculus) 6480464 Diclofenac results in decreased expression of TBX21 mRNA CTD PMID:22285467 Tbx21 Rat flucloxacillin decreases expression ISO Tbx21 (Mus musculus) 6480464 Floxacillin results in decreased expression of TBX21 mRNA CTD PMID:24652713 Tbx21 Rat formaldehyde decreases expression ISO TBX21 (Homo sapiens) 6480464 Formaldehyde results in decreased expression of TBX21 mRNA CTD PMID:18849615 Tbx21 Rat fragrance increases expression ISO TBX21 (Homo sapiens) 6480464 Perfume results in increased expression of TBX21 mRNA CTD PMID:24768652 Tbx21 Rat furan increases methylation EXP 6480464 furan results in increased methylation of TBX21 gene CTD PMID:22079235 Tbx21 Rat genistein multiple interactions EXP 6480464 Genistein inhibits the reaction [Collagen Type II results in increased expression of TBX21 mRNA] CTD PMID:18499367 Tbx21 Rat ibuprofen decreases expression ISO Tbx21 (Mus musculus) 6480464 Ibuprofen analog results in decreased expression of TBX21 mRNA and Ibuprofen results in decreased expression of TBX21 mRNA CTD PMID:17630191 Tbx21 Rat ionomycin multiple interactions ISO Tbx21 (Mus musculus) 6480464 [PSMB8 protein co-treated with PSMB10 protein] affects the reaction [[Tetradecanoylphorbol Acetate co-treated with Ionomycin] results in increased expression of TBX21 mRNA] more ... CTD PMID:22398747 Tbx21 Rat lactacystin multiple interactions ISO Tbx21 (Mus musculus) 6480464 lactacystin inhibits the reaction [[Tetradecanoylphorbol Acetate co-treated with Ionomycin] results in increased expression of TBX21 mRNA] CTD PMID:22398747 Tbx21 Rat levamisole multiple interactions ISO Tbx21 (Mus musculus) 6480464 Levamisole inhibits the reaction [Cyclophosphamide results in decreased expression of TBX21 protein] CTD PMID:32151603 Tbx21 Rat lipopolysaccharide multiple interactions ISO TBX21 (Homo sapiens) 6480464 [S-(1 and 2-dichlorovinyl)cysteine affects the susceptibility to Lipopolysaccharides] which results in increased expression of TBX21 mRNA CTD PMID:35811015 Tbx21 Rat metacetamol decreases expression ISO Tbx21 (Mus musculus) 6480464 3-hydroxyacetanilide results in decreased expression of TBX21 mRNA CTD PMID:18544908 Tbx21 Rat methimazole decreases expression ISO Tbx21 (Mus musculus) 6480464 Methimazole results in decreased expression of TBX21 mRNA CTD PMID:22407903 Tbx21 Rat nickel atom increases expression ISO TBX21 (Homo sapiens) 6480464 Nickel results in increased expression of TBX21 mRNA CTD PMID:24768652 Tbx21 Rat nickel atom increases response to substance ISO Tbx21 (Mus musculus) 6480464 TBX21 gene mutant form results in increased susceptibility to Nickel analog CTD PMID:24499286 Tbx21 Rat nickel atom multiple interactions ISO Tbx21 (Mus musculus) 6480464 [TBX21 gene mutant form results in increased susceptibility to Nickel analog] which results in increased expression of CCL2 protein more ... CTD PMID:24499286 Tbx21 Rat ozone multiple interactions ISO Tbx21 (Mus musculus) 6480464 [Air Pollutants results in increased abundance of [Ozone co-treated with Soot]] which results in decreased expression of TBX21 mRNA CTD PMID:34911549 Tbx21 Rat ozone decreases expression ISO Tbx21 (Mus musculus) 6480464 Ozone results in decreased expression of TBX21 mRNA CTD PMID:33026818 Tbx21 Rat paracetamol decreases expression ISO Tbx21 (Mus musculus) 6480464 Acetaminophen results in decreased expression of TBX21 mRNA CTD PMID:18544908 Tbx21 Rat paracetamol decreases expression ISO TBX21 (Homo sapiens) 6480464 Acetaminophen results in decreased expression of TBX21 mRNA CTD PMID:22230336 Tbx21 Rat pentanal increases expression ISO TBX21 (Homo sapiens) 6480464 pentanal results in increased expression of TBX21 mRNA CTD PMID:26079696 Tbx21 Rat phenytoin multiple interactions ISO Tbx21 (Mus musculus) 6480464 [Phenytoin co-treated with Buthionine Sulfoximine] results in decreased expression of TBX21 mRNA CTD PMID:23986454 Tbx21 Rat phenytoin decreases expression ISO Tbx21 (Mus musculus) 6480464 Phenytoin results in decreased expression of TBX21 mRNA CTD PMID:23986454 Tbx21 Rat phorbol 13-acetate 12-myristate multiple interactions ISO Tbx21 (Mus musculus) 6480464 [PSMB8 protein co-treated with PSMB10 protein] affects the reaction [[Tetradecanoylphorbol Acetate co-treated with Ionomycin] results in increased expression of TBX21 mRNA] more ... CTD PMID:22398747 Tbx21 Rat prostaglandin E2 decreases expression ISO TBX21 (Homo sapiens) 6480464 Dinoprostone results in decreased expression of TBX21 mRNA CTD PMID:19273625 Tbx21 Rat resveratrol decreases expression ISO Tbx21 (Mus musculus) 6480464 resveratrol results in decreased expression of TBX21 mRNA CTD PMID:22962611 Tbx21 Rat S-(1,2-dichlorovinyl)-L-cysteine multiple interactions ISO TBX21 (Homo sapiens) 6480464 [S-(1 and 2-dichlorovinyl)cysteine affects the susceptibility to Lipopolysaccharides] which results in increased expression of TBX21 mRNA CTD PMID:35811015 Tbx21 Rat S-butyl-DL-homocysteine (S,R)-sulfoximine multiple interactions ISO Tbx21 (Mus musculus) 6480464 [Phenytoin co-treated with Buthionine Sulfoximine] results in decreased expression of TBX21 mRNA CTD PMID:23986454 Tbx21 Rat silicon dioxide increases expression ISO TBX21 (Homo sapiens) 6480464 Silicon Dioxide analog results in increased expression of TBX21 mRNA CTD PMID:25895662 Tbx21 Rat silicon dioxide increases expression ISO Tbx21 (Mus musculus) 6480464 Silicon Dioxide results in increased expression of TBX21 mRNA CTD PMID:29341224 Tbx21 Rat sodium arsenite decreases expression ISO Tbx21 (Mus musculus) 6480464 sodium arsenite results in decreased expression of TBX21 mRNA CTD PMID:28843991 more ... Tbx21 Rat sodium arsenite multiple interactions ISO Tbx21 (Mus musculus) 6480464 [sodium arsenite results in increased abundance of Arsenic] which results in decreased expression of TBX21 mRNA and [sodium arsenite results in increased abundance of Arsenic] which results in increased expression of TBX21 mRNA CTD PMID:30889423 and PMID:33148380 Tbx21 Rat tamoxifen decreases response to substance ISO TBX21 (Homo sapiens) 6480464 TBX21 protein results in decreased susceptibility to Tamoxifen CTD PMID:20068169 Tbx21 Rat tebuconazole increases expression ISO TBX21 (Homo sapiens) 6480464 tebuconazole results in increased expression of TBX21 mRNA CTD PMID:30458266 Tbx21 Rat tetrachloromethane decreases expression EXP 6480464 Carbon Tetrachloride results in decreased expression of TBX21 mRNA CTD PMID:31150632 Tbx21 Rat tetraphene multiple interactions ISO Tbx21 (Mus musculus) 6480464 [Benzo(a)pyrene co-treated with benz(a)anthracene co-treated with benzo(b)fluoranthene co-treated with chrysene] results in decreased expression of TBX21 mRNA CTD PMID:27858113 Tbx21 Rat thioacetamide increases expression EXP 6480464 Thioacetamide results in increased expression of TBX21 mRNA CTD PMID:34492290 Tbx21 Rat titanium dioxide decreases expression ISO Tbx21 (Mus musculus) 6480464 titanium dioxide results in decreased expression of TBX21 mRNA CTD PMID:27760801 Tbx21 Rat titanium dioxide decreases methylation ISO Tbx21 (Mus musculus) 6480464 titanium dioxide results in decreased methylation of TBX21 promoter CTD PMID:35295148 Tbx21 Rat toluene decreases expression ISO Tbx21 (Mus musculus) 6480464 Toluene results in decreased expression of TBX21 mRNA CTD PMID:19571489 and PMID:22057034 Tbx21 Rat trichloroacetaldehyde multiple interactions ISO Tbx21 (Mus musculus) 6480464 [Trichloroethylene results in increased abundance of trichloroacetaldehyde] which results in increased expression of TBX21 mRNA CTD PMID:38518092 Tbx21 Rat trichloroethene increases expression EXP 6480464 Trichloroethylene results in increased expression of TBX21 mRNA CTD PMID:33387578 Tbx21 Rat trichloroethene multiple interactions ISO Tbx21 (Mus musculus) 6480464 [Trichloroethylene results in increased abundance of trichloroacetaldehyde] which results in increased expression of TBX21 mRNA CTD PMID:38518092 Tbx21 Rat trimellitic anhydride increases expression ISO Tbx21 (Mus musculus) 6480464 trimellitic anhydride results in increased expression of TBX21 mRNA CTD PMID:19042947 Tbx21 Rat triphenyl phosphate affects expression ISO TBX21 (Homo sapiens) 6480464 triphenyl phosphate affects the expression of TBX21 mRNA CTD PMID:37042841 Tbx21 Rat triptonide increases expression ISO Tbx21 (Mus musculus) 6480464 triptonide results in increased expression of TBX21 mRNA CTD PMID:33045310 Tbx21 Rat urethane decreases expression ISO TBX21 (Homo sapiens) 6480464 Urethane results in decreased expression of TBX21 mRNA CTD PMID:28818685 Tbx21 Rat vinclozolin decreases methylation EXP 6480464 vinclozolin results in decreased methylation of TBX21 gene CTD PMID:31079544
Imported Annotations - PID (archival)
1,2-dimethylhydrazine (ISO) 1-naphthyl isothiocyanate (EXP,ISO) 17beta-estradiol (ISO) 2,3,7,8-tetrachlorodibenzodioxine (EXP,ISO) 2-tert-butylhydroquinone (ISO) 4,4'-sulfonyldiphenol (ISO) acetamide (EXP) acetylsalicylic acid (ISO) aflatoxin B1 (ISO) all-trans-retinoic acid (ISO) alpha-galactosylceramide (ISO) amphetamine (EXP) antirheumatic drug (ISO) apigenin (ISO) arsane (ISO) arsenic atom (ISO) azathioprine (ISO) benzo[a]pyrene (ISO) benzo[b]fluoranthene (ISO) bisphenol A (EXP,ISO) bleomycin A2 (ISO) butanal (ISO) cannabidiol (ISO) carbamazepine (ISO) carbon nanotube (ISO) caryophyllene oxide (ISO) chloroprene (ISO) chromium(6+) (ISO) chrysene (ISO) chrysin (ISO) cyclophosphamide (ISO) cytisine (ISO) DDT (EXP) decabromodiphenyl ether (ISO) dexamethasone (ISO) dextran sulfate (ISO) diazinon (ISO) Dibutyl phosphate (ISO) diclofenac (ISO) flucloxacillin (ISO) formaldehyde (ISO) fragrance (ISO) furan (EXP) genistein (EXP) ibuprofen (ISO) ionomycin (ISO) lactacystin (ISO) levamisole (ISO) lipopolysaccharide (ISO) metacetamol (ISO) methimazole (ISO) nickel atom (ISO) ozone (ISO) paracetamol (ISO) pentanal (ISO) phenytoin (ISO) phorbol 13-acetate 12-myristate (ISO) prostaglandin E2 (ISO) resveratrol (ISO) S-(1,2-dichlorovinyl)-L-cysteine (ISO) S-butyl-DL-homocysteine (S,R)-sulfoximine (ISO) silicon dioxide (ISO) sodium arsenite (ISO) tamoxifen (ISO) tebuconazole (ISO) tetrachloromethane (EXP) tetraphene (ISO) thioacetamide (EXP) titanium dioxide (ISO) toluene (ISO) trichloroacetaldehyde (ISO) trichloroethene (EXP,ISO) trimellitic anhydride (ISO) triphenyl phosphate (ISO) triptonide (ISO) urethane (ISO) vinclozolin (EXP)
Biological Process
cell fate specification (IBA) lymphocyte migration (IBA,IEA,ISO) negative regulation of DNA-templated transcription (IEA,ISO) negative regulation of interleukin-2 production (IEA,ISO) negative regulation of T-helper 17 cell differentiation (IEA,ISO) negative regulation of T-helper 17 cell lineage commitment (IEA,ISO) negative regulation of T-helper 2 cell cytokine production (IEA,ISO) negative regulation of transcription by RNA polymerase II (IEA,ISO) positive regulation of DNA-templated transcription (IEA,ISO) positive regulation of gene expression (IEA,ISO) positive regulation of isotype switching to IgG isotypes (IEA,ISO) positive regulation of T-helper 1 cell cytokine production (IEA,ISO) positive regulation of transcription by RNA polymerase II (IEA,ISO) proteasome-mediated ubiquitin-dependent protein catabolic process (IEA,ISO) regulation of DNA-templated transcription (IEA) regulation of immune response (IEA,ISO) regulation of T cell differentiation (IEA,ISO) regulation of transcription by RNA polymerase II (IBA) response to virus (IEA,ISO) T cell differentiation (IEA,ISO) T-helper 1 cell lineage commitment (IEA,ISO)
Molecular Function
DNA binding (IEA,ISO) DNA-binding transcription activator activity, RNA polymerase II-specific (IEA,ISO) DNA-binding transcription factor activity (IEA) DNA-binding transcription factor activity, RNA polymerase II-specific (IBA) DNA-binding transcription repressor activity, RNA polymerase II-specific (IEA,ISO) protein binding (ISO) RNA polymerase II cis-regulatory region sequence-specific DNA binding (IBA,IEA) sequence-specific DNA binding (IEA,ISO) sequence-specific double-stranded DNA binding (IEA,ISO) transcription cis-regulatory region binding (IEA,ISO)
Tbx21 Rat Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl GRCr8 10 82,578,751 - 82,595,253 (-) NCBI GRCr8 mRatBN7.2 10 82,082,322 - 82,098,831 (-) NCBI mRatBN7.2 mRatBN7.2 mRatBN7.2 Ensembl 10 82,082,322 - 82,098,831 (-) Ensembl mRatBN7.2 Ensembl UTH_Rnor_SHR_Utx 10 87,030,758 - 87,047,326 (-) NCBI Rnor_SHR UTH_Rnor_SHR_Utx UTH_Rnor_SHRSP_BbbUtx_1.0 10 86,528,813 - 86,545,383 (-) NCBI Rnor_SHRSP UTH_Rnor_SHRSP_BbbUtx_1.0 UTH_Rnor_WKY_Bbb_1.0 10 81,921,417 - 81,937,988 (-) NCBI Rnor_WKY UTH_Rnor_WKY_Bbb_1.0 Rnor_6.0 10 85,032,799 - 85,049,331 (-) NCBI Rnor6.0 Rnor_6.0 rn6 Rnor6.0 Rnor_6.0 Ensembl 10 85,032,799 - 85,049,331 (-) Ensembl Rnor6.0 rn6 Rnor6.0 Rnor_5.0 10 84,822,665 - 84,839,295 (-) NCBI Rnor5.0 Rnor_5.0 rn5 Rnor5.0 RGSC_v3.4 10 85,817,743 - 85,834,178 (-) NCBI RGSC3.4 RGSC_v3.4 rn4 RGSC3.4 RGSC_v3.1 10 85,832,581 - 85,865,421 (-) NCBI Celera 10 80,842,416 - 80,858,935 (-) NCBI Celera Cytogenetic Map 10 q31 NCBI
TBX21 Human Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl GRCh38 17 47,733,236 - 47,746,122 (+) NCBI GRCh38 GRCh38 hg38 GRCh38 GRCh38.p14 Ensembl 17 47,733,236 - 47,746,122 (+) Ensembl GRCh38 hg38 GRCh38 GRCh37 17 45,810,602 - 45,823,488 (+) NCBI GRCh37 GRCh37 hg19 GRCh37 Build 36 17 43,165,609 - 43,178,484 (+) NCBI NCBI36 Build 36 hg18 NCBI36 Build 34 17 43,165,608 - 43,178,484 NCBI Celera 17 42,263,420 - 42,276,290 (+) NCBI Celera Cytogenetic Map 17 q21.32 NCBI HuRef 17 41,179,683 - 41,192,556 (+) NCBI HuRef CHM1_1 17 45,875,536 - 45,888,411 (+) NCBI CHM1_1 T2T-CHM13v2.0 17 48,595,046 - 48,607,933 (+) NCBI T2T-CHM13v2.0
Tbx21 Mouse Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl GRCm39 11 96,988,833 - 97,006,157 (-) NCBI GRCm39 GRCm39 mm39 GRCm39 Ensembl 11 96,988,897 - 97,006,157 (-) Ensembl GRCm39 Ensembl GRCm38 11 97,098,007 - 97,115,331 (-) NCBI GRCm38 GRCm38 mm10 GRCm38 GRCm38.p6 Ensembl 11 97,098,071 - 97,115,331 (-) Ensembl GRCm38 mm10 GRCm38 MGSCv37 11 96,959,321 - 96,976,645 (-) NCBI GRCm37 MGSCv37 mm9 NCBIm37 MGSCv36 11 96,914,161 - 96,931,370 (-) NCBI MGSCv36 mm8 Celera 11 106,750,749 - 106,768,081 (-) NCBI Celera Cytogenetic Map 11 D NCBI cM Map 11 60.95 NCBI
Tbx21 Chinchilla Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl ChiLan1.0 Ensembl NW_004955451 13,315,859 - 13,325,937 (-) Ensembl ChiLan1.0 ChiLan1.0 NW_004955451 13,315,237 - 13,317,888 (-) NCBI ChiLan1.0 ChiLan1.0
TBX21 Bonobo Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl NHGRI_mPanPan1-v2 19 17,354,255 - 17,369,752 (-) NCBI NHGRI_mPanPan1-v2 NHGRI_mPanPan1 17 19,321,328 - 19,335,352 (-) NCBI NHGRI_mPanPan1 Mhudiblu_PPA_v0 17 9,791,008 - 9,803,894 (-) NCBI Mhudiblu_PPA_v0 Mhudiblu_PPA_v0 panPan3 PanPan1.1 17 9,973,343 - 9,988,131 (-) NCBI panpan1.1 PanPan1.1 panPan2 PanPan1.1 Ensembl 17 9,973,920 - 9,985,660 (-) Ensembl panpan1.1 panPan2
TBX21 Dog Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl CanFam3.1 9 24,077,752 - 24,086,560 (+) NCBI CanFam3.1 CanFam3.1 canFam3 CanFam3.1 CanFam3.1 Ensembl 9 24,077,761 - 24,086,261 (+) Ensembl CanFam3.1 canFam3 CanFam3.1 Dog10K_Boxer_Tasha 9 23,543,406 - 23,555,259 (+) NCBI Dog10K_Boxer_Tasha ROS_Cfam_1.0 9 24,869,329 - 24,881,229 (+) NCBI ROS_Cfam_1.0 ROS_Cfam_1.0 Ensembl 9 24,869,329 - 24,881,632 (+) Ensembl ROS_Cfam_1.0 Ensembl UMICH_Zoey_3.1 9 23,639,751 - 23,651,595 (+) NCBI UMICH_Zoey_3.1 UNSW_CanFamBas_1.0 9 23,901,069 - 23,912,963 (+) NCBI UNSW_CanFamBas_1.0 UU_Cfam_GSD_1.0 9 24,027,863 - 24,039,741 (+) NCBI UU_Cfam_GSD_1.0
Tbx21 Squirrel Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl HiC_Itri_2 NW_024405602 23,516,504 - 23,528,815 (+) NCBI HiC_Itri_2 SpeTri2.0 Ensembl NW_004936490 13,546,292 - 13,558,635 (-) Ensembl SpeTri2.0 SpeTri2.0 Ensembl SpeTri2.0 NW_004936490 13,546,405 - 13,558,635 (-) NCBI SpeTri2.0 SpeTri2.0 SpeTri2.0
TBX21 Pig Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl Sscrofa11.1 Ensembl 12 23,996,415 - 24,009,355 (+) Ensembl Sscrofa11.1 susScr11 Sscrofa11.1 Sscrofa11.1 12 23,996,415 - 24,009,353 (+) NCBI Sscrofa11.1 Sscrofa11.1 susScr11 Sscrofa11.1 Sscrofa10.2 12 23,867,157 - 23,880,241 (+) NCBI Sscrofa10.2 Sscrofa10.2 susScr3
TBX21 Green Monkey Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl ChlSab1.1 16 68,131,258 - 68,145,579 (+) NCBI ChlSab1.1 ChlSab1.1 chlSab2 ChlSab1.1 Ensembl 16 68,131,536 - 68,144,415 (+) Ensembl ChlSab1.1 ChlSab1.1 Ensembl chlSab2 Vero_WHO_p1.0 NW_023666077 39,176,675 - 39,190,489 (+) NCBI Vero_WHO_p1.0 Vero_WHO_p1.0
Tbx21
.
Predicted Target Of
Count of predictions: 108 Count of miRNA genes: 75 Interacting mature miRNAs: 93 Transcripts: ENSRNOT00000012538 Prediction methods: Miranda, Rnahybrid, Targetscan Result types: miRGate_prediction
1549846 Scl47 Serum cholesterol level QTL 47 3.6 blood cholesterol amount (VT:0000180) serum total cholesterol level (CMO:0000363) 10 50574707 95574707 Rat 1298069 Bp168 Blood pressure QTL 168 5.5 blood pressure trait (VT:0000183) systolic blood pressure (CMO:0000004) 10 26521957 98003205 Rat 631552 Vetf2 Vascular elastic tissue fragility QTL 2 4.5 0.0002 aorta elastic tissue integrity trait (VT:0010556) artery internal elastic lamina non-tumorous lesion count (CMO:0001913) 10 41142633 86142633 Rat 61449 Ciaa2 CIA Autoantibody QTL 2 7.1 blood autoantibody amount (VT:0003725) calculated serum anti-type 2 collagen antibody titer (CMO:0001279) 10 63221094 107211142 Rat 631555 Bp134 Blood pressure QTL 134 0.001 arterial blood pressure trait (VT:2000000) systolic blood pressure (CMO:0000004) 10 80515287 91230079 Rat 61325 Aia5 Adjuvant induced arthritis QTL 5 0.01 joint integrity trait (VT:0010548) joint inflammation composite score (CMO:0000919) 10 23444813 104060283 Rat 1298078 Stresp5 Stress response QTL 5 2.99 0.00025 blood corticosterone amount (VT:0005345) plasma corticosterone level (CMO:0001173) 10 42045676 104670812 Rat 1549831 Bss6 Bone structure and strength QTL 6 4 lumbar vertebra strength trait (VT:0010574) vertebra ultimate force (CMO:0001678) 10 57576521 102576521 Rat 70164 Bw21 Body weight QTL 21 4.36 0.00005 body mass (VT:0001259) body weight (CMO:0000012) 10 53797494 98952626 Rat 61463 Bp12 Blood pressure QTL 12 6.3 0.0001 arterial blood pressure trait (VT:2000000) systolic blood pressure (CMO:0000004) 10 41333258 86333258 Rat 2298548 Neuinf7 Neuroinflammation QTL 7 3.4 nervous system integrity trait (VT:0010566) spinal cord RT1-B protein level (CMO:0002132) 10 72224939 107211142 Rat 1579919 Bp281 Blood pressure QTL 281 0.01 arterial blood pressure trait (VT:2000000) mean arterial blood pressure (CMO:0000009) 10 74372084 94965338 Rat 1302404 Cia27 Collagen induced arthritis QTL 27 2.6 0.0045 joint integrity trait (VT:0010548) experimental arthritis severity measurement (CMO:0001459) 10 76452683 107211142 Rat 1300107 Rf18 Renal function QTL 18 3.41 urine output (VT:0003620) timed urine volume (CMO:0000260) 10 78775516 98279596 Rat 8694173 Bw149 Body weight QTL 149 4.38 0.001 body mass (VT:0001259) body weight gain (CMO:0000420) 10 44441699 89441699 Rat 2300218 Hpcl2 Hepatic cholesterol level QTL 2 liver cholesterol amount (VT:0010498) liver cholesterol level (CMO:0001597) 10 45029650 95600334 Rat 1554317 Bmd4 Bone mineral density QTL 4 9.4 0.0001 lumbar vertebra mineral mass (VT:0010511) volumetric bone mineral density (CMO:0001553) 10 19816042 99406971 Rat 70171 Cari1 Carrageenan-induced inflammation QTL 1 4.9 0.0005 hypodermis integrity trait (VT:0010550) inflammatory exudate volume (CMO:0001429) 10 53797385 107211142 Rat 10450495 Bp383 Blood pressure QTL 383 0.002 arterial blood pressure trait (VT:2000000) mean arterial blood pressure (CMO:0000009) 10 76246085 94965338 Rat 61354 Pia10 Pristane induced arthritis QTL 10 0.01 joint integrity trait (VT:0010548) joint inflammation composite score (CMO:0000919) 10 23444813 104060283 Rat 2292617 Ept18 Estrogen-induced pituitary tumorigenesis QTL 18 3.9 pituitary gland mass (VT:0010496) pituitary gland wet weight (CMO:0000853) 10 73453136 96120911 Rat 2301967 Cm73 Cardiac mass QTL 73 4.55 heart left ventricle mass (VT:0007031) heart left ventricle weight to body weight ratio (CMO:0000530) 10 14487011 89062041 Rat 2313103 Bss80 Bone structure and strength QTL 80 2 0.0001 tibia strength trait (VT:1000284) tibia midshaft endosteal cross-sectional area (CMO:0001716) 10 62057807 107057807 Rat 2293646 Bss25 Bone structure and strength QTL 25 10.96 0.0001 femur morphology trait (VT:0000559) femur cross-sectional area (CMO:0001661) 10 69738412 107211142 Rat 2303118 Mamtr7 Mammary tumor resistance QTL 7 0.003 mammary gland integrity trait (VT:0010552) mammary tumor growth rate (CMO:0000344) 10 9658275 104670812 Rat 70188 BpQTLcluster1 Blood pressure QTL cluster 1 4.864 arterial blood pressure trait (VT:2000000) pulse pressure (CMO:0000292) 1 42323132 87323132 Rat 2300172 Bmd57 Bone mineral density QTL 57 9.8 0.0001 femur mineral mass (VT:0010011) volumetric bone mineral density (CMO:0001553) 10 69738412 107211142 Rat 724516 Uae17 Urinary albumin excretion QTL 17 3.6 urine albumin amount (VT:0002871) urine albumin excretion rate (CMO:0000757) 10 78210622 85220348 Rat 70193 Mcs7 Mammary carcinoma susceptibility QTL 7 2.38 mammary gland integrity trait (VT:0010552) mammary tumor number (CMO:0000343) 10 72224939 107211142 Rat 2313105 Bss79 Bone structure and strength QTL 79 1.8 0.0001 tibia size trait (VT:0100001) tibia midshaft cross-sectional area (CMO:0001717) 10 62057807 107057807 Rat 9589030 Epfw9 Epididymal fat weight QTL 9 19.24 0.001 epididymal fat pad mass (VT:0010421) epididymal fat pad weight to body weight ratio (CMO:0000658) 10 44441699 89441699 Rat 1357344 Bp249 Blood pressure QTL 249 0.0001 arterial blood pressure trait (VT:2000000) systolic blood pressure (CMO:0000004) 10 66743655 98003205 Rat 2316949 Gluco60 Glucose level QTL 60 3.7 blood glucose amount (VT:0000188) blood glucose level (CMO:0000046) 10 14487011 107057807 Rat 70198 BpQTLcluster9 Blood pressure QTL cluster 9 2.94 arterial blood pressure trait (VT:2000000) mean arterial blood pressure (CMO:0000009) 10 42323132 87323132 Rat 2306970 Anxrr22 Anxiety related response QTL 22 5.95 fear/anxiety-related behavior trait (VT:1000241) number of periods of voluntary immobility (CMO:0001045) 10 61345276 98211570 Rat 1359017 Hrtrt21 Heart rate QTL 21 2.4 heart pumping trait (VT:2000009) heart rate (CMO:0000002) 10 51772940 96772940 Rat 2293663 Bss33 Bone structure and strength QTL 33 9.34 0.0001 femur strength trait (VT:0010010) femur midshaft polar moment of inertia (CMO:0001669) 10 69738412 107211142 Rat 7387312 Bw125 Body weight QTL 125 3 0.0047 retroperitoneal fat pad mass (VT:0010430) retroperitoneal fat pad weight (CMO:0000356) 10 64890616 107211142 Rat 2312672 Insul15 Insulin level QTL 15 0.01 blood insulin amount (VT:0001560) serum insulin level (CMO:0000358) 10 57134272 102134272 Rat 6893357 Bw102 Body weight QTL 102 0.5 0.36 body mass (VT:0001259) body weight (CMO:0000012) 10 80515287 101325465 Rat 2317029 Aia19 Adjuvant induced arthritis QTL 19 2.98 joint integrity trait (VT:0010548) left rear ankle joint diameter (CMO:0002149) 10 66978955 107211142 Rat 2303589 Bw87 Body weight QTL 87 2 body mass (VT:0001259) body weight (CMO:0000012) 10 81285008 107211142 Rat 724556 Pur2 Proteinuria QTL 2 5.5 urine protein amount (VT:0005160) urine protein level (CMO:0000591) 10 22427500 90627625 Rat 2306793 Ean5 Experimental allergic neuritis QTL 5 4.7 nervous system integrity trait (VT:0010566) IFNG-secreting splenocyte count (CMO:0002122) 10 72552416 93995749 Rat 61387 Bp1 Blood pressure QTL 1 5.1 arterial blood pressure trait (VT:2000000) diastolic blood pressure (CMO:0000005) 10 51770177 107211142 Rat 2317039 Aia6 Adjuvant induced arthritis QTL 6 4.31 joint integrity trait (VT:0010548) right rear ankle joint diameter (CMO:0002150) 10 66978955 107211142 Rat 2317043 Aia7 Adjuvant induced arthritis QTL 7 3.82 joint integrity trait (VT:0010548) left rear ankle joint diameter (CMO:0002149) 10 37565079 82565079 Rat 2317042 Aia20 Adjuvant induced arthritis QTL 20 3.38 joint integrity trait (VT:0010548) right rear ankle joint diameter (CMO:0002150) 10 37565079 82565079 Rat 2298481 Eau9 Experimental allergic uveoretinitis QTL 9 0.0169 uvea integrity trait (VT:0010551) experimental autoimmune uveitis score (CMO:0001504) 10 65927233 82565079 Rat 61396 Bp9 Blood pressure QTL 9 4.8 0.0001 arterial blood pressure trait (VT:2000000) systolic blood pressure (CMO:0000004) 10 68420376 107211142 Rat 1358915 Stresp7 Stress response QTL 7 3.52 blood norepinephrine amount (VT:0005663) plasma norepinephrine level (CMO:0001010) 10 78899655 87307728 Rat 61402 Niddm3 Non-insulin dependent diabetes mellitus QTL 3 4.58 blood glucose amount (VT:0000188) blood glucose level (CMO:0000046) 10 61345413 82564856 Rat 1331791 Cm31 Cardiac mass QTL 31 3.84606 heart mass (VT:0007028) heart wet weight (CMO:0000069) 10 29299504 107211142 Rat 70364 Bp72 Blood pressure QTL 72 arterial blood pressure trait (VT:2000000) mean arterial blood pressure (CMO:0000009) 10 51121100 96121100 Rat 10450498 Bp384 Blood pressure QTL 384 0.002 arterial blood pressure trait (VT:2000000) mean arterial blood pressure (CMO:0000009) 10 67750049 107211142 Rat 4889492 Pancm2 Pancreatic morphology QTL 2 3.2 pancreatic beta cell morphology trait (VT:0005217) ratio of insulin-positive cell area to total area of splenic region of pancreas (CMO:0001814) 10 76748906 107211142 Rat 6893366 Bw106 Body weight QTL 106 0.3 0.47 body mass (VT:0001259) body weight (CMO:0000012) 10 70199100 107211142 Rat 2293698 Bss43 Bone structure and strength QTL 43 5.33 0.0001 lumbar vertebra size trait (VT:0010518) lumbar vertebra cross-sectional area (CMO:0001689) 10 59209888 104209888 Rat 631530 Tls3 T-lymphoma susceptibility QTL 3 0 0.0001 thymus integrity trait (VT:0010555) percentage of study population developing T-cell lymphomas during a period of time (CMO:0001911) 10 51774612 95600334 Rat 1354608 Cm33 Cardiac mass QTL 33 2.8 heart left ventricle mass (VT:0007031) heart left ventricle wet weight (CMO:0000071) 10 54809292 99809292 Rat 1558643 Cm44 Cardiac mass QTL 44 4.8 0.0000368 heart mass (VT:0007028) heart wet weight (CMO:0000069) 10 61345276 99703528 Rat 631535 Cm51 Cardiac mass QTL 51 3 heart mass (VT:0007028) calculated heart weight (CMO:0000073) 10 51786282 91669536 Rat 631267 Cia20 Collagen induced arthritis QTL 20 3.2 joint integrity trait (VT:0010548) joint inflammation composite score (CMO:0000919) 10 23444813 104060283 Rat 1576308 Schws1 Schwannoma susceptibility QTL 1 0.0041 nervous system integrity trait (VT:0010566) percentage of study population developing trigeminal nerve neurilemmomas during a period of time (CMO:0002017) 10 40035094 102359817 Rat 631269 Cia22 Collagen induced arthritis QTL 22 8.9 joint integrity trait (VT:0010548) joint inflammation composite score (CMO:0000919) 10 40035094 104060283 Rat 631268 Cia21 Collagen induced arthritis QTL 21 3.1 joint integrity trait (VT:0010548) joint inflammation composite score (CMO:0000919) 10 14487011 104060283 Rat 631270 Cia23 Collagen induced arthritis QTL 23 3.9 joint integrity trait (VT:0010548) joint inflammation composite score (CMO:0000919) 10 40035094 104060283 Rat 7411614 Foco18 Food consumption QTL 18 0.001 eating behavior trait (VT:0001431) feed conversion ratio (CMO:0001312) 10 44441699 89441699 Rat 2325836 Bp346 Blood pressure QTL 346 0.001 arterial blood pressure trait (VT:2000000) mean arterial blood pressure (CMO:0000009) 10 76246085 84007272 Rat 6893336 Cm75 Cardiac mass QTL 75 0.1 0.87 heart mass (VT:0007028) heart weight to body weight ratio (CMO:0000074) 10 61345276 99703528 Rat 12880053 Cm104 Cardiac mass QTL 104 0.009 heart right ventricle mass (VT:0007033) heart right ventricle weight to body weight ratio (CMO:0000914) 10 73452992 83463334 Rat 631547 Bp87 Blood pressure QTL 87 4.5 arterial blood pressure trait (VT:2000000) systolic blood pressure (CMO:0000004) 10 47369470 92369470 Rat 61427 Cia16 Collagen induced arthritis QTL 16 3.2 joint integrity trait (VT:0010548) joint inflammation composite score (CMO:0000919) 10 6357896 96121100 Rat 2292438 Bp311 Blood pressure QTL 311 arterial blood pressure trait (VT:2000000) mean arterial blood pressure (CMO:0000009) 10 76246085 107211142 Rat 2312662 Slep8 Serum leptin concentration QTL 8 0.05 blood leptin amount (VT:0005667) serum leptin level (CMO:0000780) 10 57134272 102134272 Rat 12880050 Am10 Aortic mass QTL 10 0.016 aorta mass (VT:0002845) aorta weight to aorta length to body weight ratio (CMO:0002722) 10 74372084 84007272 Rat 1358188 Ept9 Estrogen-induced pituitary tumorigenesis QTL 9 3.9 pituitary gland mass (VT:0010496) pituitary gland wet weight (CMO:0000853) 10 73453136 96120911 Rat 631537 Oia4 Oil induced arthritis QTL 4 joint integrity trait (VT:0010548) joint inflammation composite score (CMO:0000919) 10 75631887 87055282 Rat 634354 Rends3 Renal damage susceptibility QTL 3 0.05 kidney blood vessel morphology trait (VT:0000530) organ lesion measurement (CMO:0000677) 10 79813789 85160854 Rat 1642980 Bp300 Blood pressure QTL 300 arterial blood pressure trait (VT:2000000) systolic blood pressure (CMO:0000004) 10 68383129 107211142 Rat 631542 Bp82 Blood pressure QTL 82 6.8 arterial blood pressure trait (VT:2000000) systolic blood pressure (CMO:0000004) 10 26521957 98952741 Rat 2312668 Scl65 Serum cholesterol level QTL 65 0.001 blood cholesterol amount (VT:0000180) serum total cholesterol level (CMO:0000363) 10 57134272 102134272 Rat
AW530944
Rat Assembly Chr Position (strand) Source JBrowse mRatBN7.2 10 82,082,371 - 82,082,537 (+) MAPPER mRatBN7.2 Rnor_6.0 10 85,032,849 - 85,033,014 NCBI Rnor6.0 Rnor_5.0 10 84,822,715 - 84,822,880 UniSTS Rnor5.0 RGSC_v3.4 10 85,817,793 - 85,817,958 UniSTS RGSC3.4 Celera 10 80,842,466 - 80,842,631 UniSTS RH 3.4 Map 10 782.7 UniSTS Cytogenetic Map 10 q31 UniSTS
PMC213492P1
Rat Assembly Chr Position (strand) Source JBrowse mRatBN7.2 10 82,083,555 - 82,083,858 (+) MAPPER mRatBN7.2 Rnor_6.0 10 85,034,033 - 85,034,335 NCBI Rnor6.0 Rnor_5.0 10 84,823,899 - 84,824,201 UniSTS Rnor5.0 RGSC_v3.4 10 85,818,977 - 85,819,279 UniSTS RGSC3.4 Celera 10 80,843,650 - 80,843,952 UniSTS Cytogenetic Map 10 q31 UniSTS
PMC122806P1
Rat Assembly Chr Position (strand) Source JBrowse mRatBN7.2 10 82,085,711 - 82,086,329 (+) MAPPER mRatBN7.2 Rnor_6.0 10 85,036,189 - 85,036,806 NCBI Rnor6.0 Rnor_5.0 10 84,826,055 - 84,826,672 UniSTS Rnor5.0 RGSC_v3.4 10 85,821,134 - 85,821,751 UniSTS RGSC3.4 Celera 10 80,845,786 - 80,846,403 UniSTS Cytogenetic Map 10 q31 UniSTS
Click on a value in the shaded box below the category label to view a detailed expression data table for that system.
alimentary part of gastrointestinal system
9
11
31
49
80
79
48
25
48
6
182
79
29
38
49
31
Too many to show, limit is 500. Download them if you would like to view them all.
Ensembl Acc Id:
ENSRNOT00000012538 ⟹ ENSRNOP00000012538
Type:
CODING
Position:
Rat Assembly Chr Position (strand) Source mRatBN7.2 Ensembl 10 82,082,322 - 82,098,831 (-) Ensembl Rnor_6.0 Ensembl 10 85,032,799 - 85,049,331 (-) Ensembl
RefSeq Acc Id:
NM_001107043 ⟹ NP_001100513
RefSeq Status:
PROVISIONAL
Type:
CODING
Position:
Rat Assembly Chr Position (strand) Source GRCr8 10 82,578,751 - 82,595,253 (-) NCBI mRatBN7.2 10 82,082,322 - 82,098,831 (-) NCBI Rnor_6.0 10 85,032,799 - 85,049,331 (-) NCBI Rnor_5.0 10 84,822,665 - 84,839,295 (-) NCBI RGSC_v3.4 10 85,817,743 - 85,834,178 (-) RGD Celera 10 80,842,416 - 80,858,935 (-) RGD
Sequence:
TCCAACGCGCGCTCAGGAGCTAGGCGTCCCGGCTCCGGCTCGGGTGGAGTTCCACTGGTCCCCGGACCCCGCCCCCCGTCGCCCTAGCCCCAAAGACCCTCGGGTCTCTTCGACGGCTGCGGGAAGGC
hide sequence
RefSeq Acc Id:
NP_001100513 ⟸ NM_001107043
- UniProtKB:
D3ZCM2 (UniProtKB/TrEMBL), A6HIJ2 (UniProtKB/TrEMBL)
- Sequence:
MGIVEPGCGDMLTGTEPIPSDEGRGTGADQQHRFFYPESGAQDPTDRRAVSSLGSSYSGSALVPAPPGRFLGAYAYPPRAQATGFPGPGESFPPPAGAEGYPPVDGYAAPDPRAGLYPGPREDYALPA
hide sequence
Ensembl Acc Id:
ENSRNOP00000012538 ⟸ ENSRNOT00000012538
RGD ID: 13697642 Promoter ID: EPDNEW_R8167 Type: single initiation site Name: Tbx21_1 Description: T-box 21 SO ACC ID: SO:0000170 Source: EPDNEW (Eukaryotic Promoter Database, http://epd.vital-it.ch/ ) Experiment Methods: Single-end sequencing. Position: Rat Assembly Chr Position (strand) Source Rnor_6.0 10 85,049,380 - 85,049,440 EPDNEW
Date
Current Symbol
Current Name
Previous Symbol
Previous Name
Description
Reference
Status
2019-08-05
Tbx21
T-box transcription factor 21
Tbx21
T-box 21
Nomenclature updated to reflect human and mouse nomenclature
1299863 APPROVED
2008-04-30
Tbx21
T-box 21
Tbx21_predicted
T-box 21 (predicted)
'predicted' is removed
2292626 APPROVED
2005-01-12
Tbx21_predicted
T-box 21 (predicted)
Symbol and Name status set to approved
70820 APPROVED
