Mir15a (microRNA 15a) - Rat Genome Database

Name: Mir15a
Creator: Rat Genome Database
License: Creative Commons CC BY 4.0
Keywords: Rat Gene RGD Genome

Gene: Mir15a (microRNA 15a) Mus musculus

Analyze

Symbol:

Mir15a

Name:

microRNA 15a

RGD ID:

1608317

MGI Page

MGI

Description:

Acts upstream of or within several processes, including cellular response to amino acid stimulus; cellular response to lipopolysaccharide; and long-term synaptic potentiation. Is expressed in alimentary system; cochlear ganglion; lung; and sensory organ. Orthologous to human MIR15A (microRNA 15a).

Type:

ncrna (Ensembl: miRNA)

RefSeq Status:

PROVISIONAL

Previously known as:

Mir; mir-15a; Mirn15a; mmu-mir-; mmu-mir-15a

RGD Orthologs

Human

Dog

Pig

Alliance Orthologs

More Info

more info ...

Latest Assembly:

GRCm39 - Mouse Genome Assembly GRCm39

Position:

Mouse Assembly	Chr	Position (strand)	Source	Genome Browsers
Mouse Assembly	Chr	Position (strand)	Source	JBrowse	NCBI	UCSC	Ensembl
GRCm39	14	61,869,476 - 61,869,559 (-)	NCBI	GRCm39	GRCm39	mm39
GRCm39 Ensembl	14	61,869,476 - 61,869,559 (-)	Ensembl		GRCm39 Ensembl
GRCm38	14	61,632,027 - 61,632,110 (-)	NCBI	GRCm38	GRCm38	mm10	GRCm38
GRCm38.p6 Ensembl	14	61,632,027 - 61,632,110 (-)	Ensembl	GRCm38		mm10	GRCm38
MGSCv37	14	62,250,864 - 62,250,947 (-)	NCBI	GRCm37	MGSCv37	mm9	NCBIm37
Celera	14	59,399,465 - 59,399,548 (-)	NCBI		Celera
Cytogenetic Map	14	D1	NCBI
cM Map	14	33.16	NCBI

JBrowse:

View Region in Genome Browser (JBrowse)

Model

Annotation Click to see Annotation Detail View

Disease Annotations Click to see Annotation Detail View

acute promyelocytic leukemia (ISO)

chromosome 13q14 deletion syndrome (ISO)

congestive heart failure (ISO)

intellectual disability (ISO)

Myocardial Reperfusion Injury (ISO)

pancreatitis (ISO)

proliferative diabetic retinopathy (ISO)

Gene-Chemical Interaction Annotations Click to see Annotation Detail View

1,3,5-trinitro-1,3,5-triazinane (EXP)

17beta-hydroxy-5alpha-androstan-3-one (ISO)

2,3,7,8-tetrachlorodibenzodioxine (EXP,ISO)

3-methylcholanthrene (EXP)

5-chloro-7-iodoquinolin-8-ol (ISO)

arsenite(3-) (ISO)

arsenous acid (ISO)

biphenyl-4-amine (ISO)

cadmium dichloride (ISO)

camptothecin (ISO)

carbon nanotube (EXP)

choline (EXP)

dexamethasone (EXP)

diarsenic trioxide (ISO)

doxorubicin (ISO)

folic acid (EXP)

formaldehyde (ISO)

hydrogen peroxide (ISO)

hydroquinone (ISO)

L-methionine (EXP)

lipopolysaccharide (EXP)

manganese(II) chloride (ISO)

N-methyl-4-phenylpyridinium (EXP)

paracetamol (EXP)

phenols (ISO)

progesterone (ISO)

resveratrol (ISO)

silver atom (ISO)

silver(0) (ISO)

sodium arsenite (EXP,ISO)

urethane (EXP)

valproic acid (EXP)

zinc dichloride (ISO)

Gene Ontology Annotations Click to see Annotation Detail View

Biological Process

cellular response to amino acid stimulus (IDA)

cellular response to glucose stimulus (ISO)

cellular response to lipopolysaccharide (IDA)

long-term synaptic potentiation (IEP)

miRNA-mediated gene silencing by inhibition of translation (ISO)

miRNA-mediated post-transcriptional gene silencing (ISO)

negative regulation of angiogenesis (ISO)

negative regulation of blood vessel endothelial cell proliferation involved in sprouting angiogenesis (ISO)

negative regulation of canonical NF-kappaB signal transduction (ISO)

negative regulation of cell chemotaxis to fibroblast growth factor (ISO)

negative regulation of cell migration involved in sprouting angiogenesis (ISO)

negative regulation of cell population proliferation (ISO)

negative regulation of G1/S transition of mitotic cell cycle (ISO)

negative regulation of gene expression (IDA)

negative regulation of inflammatory response (ISO)

negative regulation of peptidyl-threonine phosphorylation (ISO)

negative regulation of vascular associated smooth muscle cell migration (ISO)

negative regulation of vascular associated smooth muscle cell proliferation (ISO)

negative regulation of vascular endothelial growth factor production (ISO)

ossification (IDA)

positive regulation of apoptotic process (ISO)

positive regulation of intrinsic apoptotic signaling pathway (ISO)

response to bacterium (IEP)

response to oxygen levels (IDA)

Wnt signaling pathway (IDA)

Cellular Component

extracellular exosome (ISO)

Molecular Function

mRNA 3'-UTR binding (ISO)

mRNA base-pairing translational repressor activity (ISO)

References

References - curated

#	Reference Title	Reference Citation
1.	Mouse MP Annotation Import Pipeline	RGD automated import pipeline
2.	Data Import for Chemical-Gene Interactions	RGD automated import pipeline for gene-chemical interactions

Additional References at PubMed

PMID:12007417	PMID:12919684	PMID:15538371	PMID:16381832	PMID:16682203	PMID:16766679	PMID:16882971	PMID:17369397	PMID:17604727	PMID:17936263	PMID:18452032	PMID:18762567
PMID:19188439	PMID:19416898	PMID:19559694	PMID:20060366	PMID:20215419	PMID:20385127	PMID:20413612	PMID:20548288	PMID:20558326	PMID:20863894	PMID:21037258	PMID:21146880
PMID:21267068	PMID:21371421	PMID:21740905	PMID:22052914	PMID:22144232	PMID:22578383	PMID:22692216	PMID:23867820	PMID:24205035	PMID:24427314	PMID:25103110	PMID:25190143
PMID:25261473	PMID:25692136	PMID:25751060	PMID:25858512	PMID:26268657	PMID:26845678	PMID:27471470	PMID:27531575	PMID:27533467	PMID:27829158	PMID:27931222	PMID:28289072
PMID:28705801	PMID:28758198	PMID:28941704	PMID:28944834	PMID:29023933	PMID:29031499	PMID:29339083	PMID:29981343	PMID:30047999	PMID:30092342	PMID:30119242	PMID:30467955
PMID:30478046	PMID:30616426	PMID:31273058	PMID:31433990	PMID:31658856	PMID:31712603	PMID:31773669	PMID:32131693	PMID:32296071	PMID:32705746	PMID:33371810	PMID:33665188
PMID:33751108	PMID:33784506	PMID:33910400	PMID:34068160	PMID:34339707	PMID:34678217	PMID:35079920	PMID:35085550	PMID:35403823	PMID:35611752	PMID:35873003	PMID:35907132
PMID:35915338	PMID:37478628	PMID:37605307	PMID:37715390	PMID:37862171	PMID:38191655	PMID:38506035

Genomics

Comparative Map Data

Mir15a
(Mus musculus - house mouse)

Mouse Assembly	Chr	Position (strand)	Source	Genome Browsers
Mouse Assembly	Chr	Position (strand)	Source	JBrowse	NCBI	UCSC	Ensembl
GRCm39	14	61,869,476 - 61,869,559 (-)	NCBI	GRCm39	GRCm39	mm39
GRCm39 Ensembl	14	61,869,476 - 61,869,559 (-)	Ensembl		GRCm39 Ensembl
GRCm38	14	61,632,027 - 61,632,110 (-)	NCBI	GRCm38	GRCm38	mm10	GRCm38
GRCm38.p6 Ensembl	14	61,632,027 - 61,632,110 (-)	Ensembl	GRCm38		mm10	GRCm38
MGSCv37	14	62,250,864 - 62,250,947 (-)	NCBI	GRCm37	MGSCv37	mm9	NCBIm37
Celera	14	59,399,465 - 59,399,548 (-)	NCBI		Celera
Cytogenetic Map	14	D1	NCBI
cM Map	14	33.16	NCBI

MIR15A
(Homo sapiens - human)

Human Assembly	Chr	Position (strand)	Source	Genome Browsers
Human Assembly	Chr	Position (strand)	Source	JBrowse	NCBI	UCSC	Ensembl
GRCh38	13	50,049,119 - 50,049,201 (-)	NCBI	GRCh38	GRCh38	hg38	GRCh38
GRCh38.p14 Ensembl	13	50,049,119 - 50,049,201 (-)	Ensembl	GRCh38		hg38	GRCh38
GRCh37	13	50,623,255 - 50,623,337 (-)	NCBI	GRCh37	GRCh37	hg19	GRCh37
Build 36	13	49,521,255 - 49,521,337 (-)	NCBI	NCBI36	Build 36	hg18	NCBI36
Celera	13	31,677,820 - 31,677,902 (-)	NCBI		Celera
Cytogenetic Map	13	q14.2	NCBI
HuRef	13	31,418,250 - 31,418,332 (-)	NCBI		HuRef
CHM1_1	13	50,591,043 - 50,591,125 (-)	NCBI		CHM1_1
T2T-CHM13v2.0	13	49,269,708 - 49,269,790 (-)	NCBI		T2T-CHM13v2.0

MIR15A
(Canis lupus familiaris - dog)

Dog Assembly	Chr	Position (strand)	Source	Genome Browsers
Dog Assembly	Chr	Position (strand)	Source	JBrowse	NCBI	UCSC	Ensembl
CanFam3.1	22	1,846,880 - 1,846,938 (+)	NCBI	CanFam3.1	CanFam3.1	canFam3	CanFam3.1
CanFam3.1 Ensembl	22	1,846,866 - 1,846,960 (+)	Ensembl	CanFam3.1		canFam3	CanFam3.1
Dog10K_Boxer_Tasha	22	1,876,038 - 1,876,096 (+)	NCBI		Dog10K_Boxer_Tasha
ROS_Cfam_1.0	22	1,834,523 - 1,834,581 (+)	NCBI		ROS_Cfam_1.0
UMICH_Zoey_3.1	22	1,746,565 - 1,746,623 (+)	NCBI		UMICH_Zoey_3.1
UNSW_CanFamBas_1.0	22	1,795,710 - 1,795,768 (+)	NCBI		UNSW_CanFamBas_1.0
UU_Cfam_GSD_1.0	22	1,814,155 - 1,814,213 (+)	NCBI		UU_Cfam_GSD_1.0

MIR15A
(Sus scrofa - pig)

Pig Assembly	Chr	Position (strand)	Source	Genome Browsers
Pig Assembly	Chr	Position (strand)	Source	JBrowse	NCBI	UCSC	Ensembl
Sscrofa11.1 Ensembl	11	17,757,460 - 17,757,554 (+)	Ensembl	Sscrofa11.1		susScr11	Sscrofa11.1
Sscrofa11.1	11	17,757,463 - 17,757,541 (+)	NCBI	Sscrofa11.1	Sscrofa11.1	susScr11	Sscrofa11.1

Variants

Variants in Mir15a
3 total Variants

miRNA Target Status

Predicted Targets

	Summary Value
Count of predictions:	33576
Count of gene targets:	13334
Count of transcripts:	24366
Interacting mature miRNAs:	mmu-miR-15a-3p, mmu-miR-15a-5p
Prediction methods:	Microtar, Miranda, Pita, Rnahybrid, Targetscan
Result types:	miRGate_prediction

The detailed report is available here: Full Report CSV TAB Printer

miRNA Target Status data imported from miRGate (http://mirgate.bioinfo.cnio.es/).
For more information about miRGate, see PMID:25858286 or access the full paper here.

QTLs in Region (GRCm39)

The following QTLs overlap with this region.

RGD ID	Symbol	Name	LOD	P Value	Trait	Sub Trait	Chr	Start	Stop	Species
1357589	Kdnw2_m	kidney weight 2 (mouse)			Not determined		14	20887473	121269804	Mouse
1357527	Epfpq1_m	epididymal fat percentage QTL 1 (mouse)			Not determined		14	21062450	71885801	Mouse
10043886	Cia49_m	collagen induced arthritis QTL 49 (mouse)			Not determined		14	29996994	63997133	Mouse
27226774	Tibl15_m	tibia length 15, 10 week (mouse)					14	30321957	87937436	Mouse
1300909	Ath13_m	atherosclerosis 13 (mouse)			Not determined		14	30335250	64335381	Mouse
1300998	Cia17_m	collagen induced arthritis 17 (mouse)			Not determined		14	30335250	64335381	Mouse
1300625	Cosz2_m	cocaine seizure 2 (mouse)			Not determined		14	35045797	68785736	Mouse
10043887	Cia50_m	collagen induced arthritis QTL 50 (mouse)			Not determined		14	37430185	71430320	Mouse
4142419	Tgq26_m	triglyceride QTL 26 (mouse)			Not determined			40337319	74337319	Mouse
1301777	Bglq15_m	body growth late QTL 15 (mouse)			Not determined		14	42962416	76962593	Mouse
1301424	Skull21_m	skull morphology 21 (mouse)			Not determined		14	42962416	76962593	Mouse
1300805	Mors3_m	modifier of obesity related sterility 3 (mouse)			Not determined		14	43037270	77037418	Mouse
1301091	Bbaa21_m	B.burgdorferi-associated arthritis 21 (mouse)			Not determined		14	43065847	77066045	Mouse
4141400	Nilac8_m	nicotine induced locomotor activity 8 (mouse)			Not determined		14	43065847	77066045	Mouse
1300605	El5_m	epilepsy 5 (mouse)			Not determined		14	49455425	83455556	Mouse
4142364	Pbwg18_m	postnatal body weight growth 18 (mouse)			Not determined		14	52281984	86282125	Mouse
1301489	Lbm10_m	lean body mass 10 (mouse)			Not determined		14	53761296	87761529	Mouse
12880432	Fgf23lq3_m	FGF23 serum level QTL 3 (mouse)					14	53937440	87937440	Mouse
10043889	Cia52_m	collagen induced arthritis QTL 52 (mouse)			Not determined		14	56082381	90082509	Mouse
1301562	Hwq1_m	heart weight quantitative locus 1 (mouse)			Not determined		14	56546745	90546941	Mouse
1357565	wrmod1_m	wobbler modifier 1 (mouse)			Not determined		14	58179640	101859473	Mouse
11039527	Ccc2_m	colitis susceptibility in the Collaborative Cross 2 (mouse)					14	59918612	94138217	Mouse
14695040	Ifbl5_m	interfrontal bone length 5 (mouse)					14	60960823	62006713	Mouse
14695043	Ifbw4_m	interfrontal bone width 4 (mouse)					14	60960823	62006713	Mouse

Markers in Region

RH135955

Mouse Assembly	Chr	Position (strand)	Source	JBrowse
GRCm38	14	61,633,169 - 61,633,358	UniSTS	GRCm38
MGSCv37	14	62,252,006 - 62,252,195	UniSTS	GRCm37
Celera	14	59,400,607 - 59,400,796	UniSTS
Cytogenetic Map	14	C3	UniSTS
cM Map	14	27.6	UniSTS

Mirn16-1

Mouse Assembly	Chr	Position (strand)	Source	JBrowse
GRCm38	14	61,632,026 - 61,632,110	UniSTS	GRCm38
MGSCv37	14	62,250,863 - 62,250,947	UniSTS	GRCm37
Celera	14	59,399,464 - 59,399,548	UniSTS
Cytogenetic Map	14	C3	UniSTS
cM Map	14		UniSTS

Expression

Sequence

Nucleotide Sequences


RefSeq Transcripts	NR_029733	(Get FASTA)	NCBI Sequence Viewer	Search GEO for Microarray Profiles
GenBank Nucleotide	AC154660	(Get FASTA)	NCBI Sequence Viewer	Search GEO for Microarray Profiles
	AJ459705	(Get FASTA)	NCBI Sequence Viewer	Search GEO for Microarray Profiles
	LM608562	(Get FASTA)	NCBI Sequence Viewer	Search GEO for Microarray Profiles

RefSeq Acc Id:

ENSMUST00000175266

Type:

CODING

Position:

Mouse Assembly	Chr	Position (strand)	Source
GRCm39 Ensembl	14	61,869,476 - 61,869,559 (-)	Ensembl
GRCm38.p6 Ensembl	14	61,632,027 - 61,632,110 (-)	Ensembl

RefSeq Acc Id:

NR_029733

RefSeq Status:

PROVISIONAL

Type:

NON-CODING

Position:

Mouse Assembly	Chr	Position (strand)	Source
GRCm39	14	61,869,476 - 61,869,559 (-)	NCBI
GRCm38	14	61,632,027 - 61,632,110 (-)	ENTREZGENE
MGSCv37	14	62,250,864 - 62,250,947 (-)	RGD
Celera	14	59,399,465 - 59,399,548 (-)	RGD
cM Map	14		ENTREZGENE

Sequence:

show sequence

CCCTTGGAGTAAAGTAGCAGCACATAATGGTTTGTGGATGTTGAAAAGGTGCAGGCCATACTGT
GCTGCCTCAAAATACAAGGA

hide sequence

Additional Information

External Database Links

Database	Acc Id	Source(s)
AGR Gene	MGI:2676841	AgrOrtholog
Ensembl Genes	ENSMUSG00000093007	Ensembl, ENTREZGENE
Ensembl Transcript	ENSMUST00000175266	ENTREZGENE
MGD	MGI:2676841	ENTREZGENE
miRBase	MI0000564	ENTREZGENE
NCBI Gene	387174	ENTREZGENE
PhenoGen	Mir15a	PhenoGen
RNAcentral	URS00001989EA	RNACentral
	URS00003D1AE3	RNACentral
	URS000065726F	RNACentral

Gene Annotator (Functional Annotation) unavailable	Gene Annotator (Annotation Distribution) unavailable	Variant Visualizer (Genomic Variants) unavailble Variant Visualizer (Genomic Variants) unavailable
Gene Annotator (Functional Annotation)	Gene Annotator (Annotation Distribution)	Variant Visualizer (Genomic Variants)

InterViewer (Protein-Protein Interactions) unavailable	Gviewer (Genome Viewer) unavailable	Variant Visualizer (Damaging Variants) unavailble Variant Visualizer (Damaging Variants) unavailable
InterViewer (Protein-Protein Interactions)	GViewer (Genome Viewer)	Variant Visualizer (Damaging Variants)

Gene Annotator (Annotation Comparison) unavailable	OLGA (Gene List Generator) unavailable
Gene Annotator (Annotation Comparison)	OLGA (Gene List Generator)	Excel (Download)

MOET (Multi-Ontology Enrichement) unavailable	GOLF (Gene-Ortholog Location Finder) unavailable
MOET (Multi-Ontology Enrichement)	GOLF (Gene-Ortholog Location Finder)

Imported Disease Annotations - ClinVar

Imported Disease Annotations - CTD

Send us a Message

Imported Disease Annotations - ClinVar

Imported Disease Annotations - CTD