MIR15A (microRNA mir-15a) - Rat Genome Database

Name: MIR15A
Creator: Rat Genome Database
License: Creative Commons CC BY 4.0
Keywords: Rat Gene RGD Genome

Gene: MIR15A (microRNA mir-15a) Canis lupus familiaris

Analyze

Symbol:

MIR15A

Name:

microRNA mir-15a (Ensembl:microRNA 15a)

RGD ID:

12339868

Description:

microRNAs (miRNAs) are short (20-24 nt) non-coding RNAs that are involved in post-transcriptional regulation of gene expression in multicellular organisms by affecting both the stability and translation of mRNAs. miRNAs are transcribed by RNA polymerase II as part of capped and polyadenylated primary transcripts (pri-miRNAs) that can be either protein-coding or non-coding. The primary transcript is cleaved by the Drosha ribonuclease III enzyme to produce an approximately 70-nt stem-loop precursor miRNA (pre-miRNA), which is further cleaved by the cytoplasmic Dicer ribonuclease to generate the mature miRNA and antisense miRNA star (miRNA*) products. The mature miRNA is incorporated into a RNA-induced silencing complex (RISC), which recognizes target mRNAs through imperfect base pairing with the miRNA and most commonly results in translational inhibition or destabilization of the target mRNA. The RefSeq represents the predicted microRNA stem-loop. [provided by RefSeq, Sep 2009]

Type:

ncrna (Ensembl: miRNA)

RefSeq Status:

PROVISIONAL

Previously known as:

cfa-mir-15a; microRNA 15a

RGD Orthologs

Human

Mouse

Pig

Alliance Orthologs

More Info

more info ...

Latest Assembly:

CanFam3.1 - Dog CanFam3.1 Assembly

Position:

Dog Assembly	Chr	Position (strand)	Source	Genome Browsers
Dog Assembly	Chr	Position (strand)	Source	JBrowse	NCBI	UCSC	Ensembl
CanFam3.1	22	1,846,880 - 1,846,938 (+)	NCBI	CanFam3.1	CanFam3.1	canFam3	CanFam3.1
CanFam3.1 Ensembl	22	1,846,866 - 1,846,960 (+)	Ensembl	CanFam3.1		canFam3	CanFam3.1
Dog10K_Boxer_Tasha	22	1,876,038 - 1,876,096 (+)	NCBI		Dog10K_Boxer_Tasha
ROS_Cfam_1.0	22	1,834,523 - 1,834,581 (+)	NCBI		ROS_Cfam_1.0
UMICH_Zoey_3.1	22	1,746,565 - 1,746,623 (+)	NCBI		UMICH_Zoey_3.1
UNSW_CanFamBas_1.0	22	1,795,710 - 1,795,768 (+)	NCBI		UNSW_CanFamBas_1.0
UU_Cfam_GSD_1.0	22	1,814,155 - 1,814,213 (+)	NCBI		UU_Cfam_GSD_1.0

JBrowse:

View Region in Genome Browser (JBrowse)

Model

Annotation Click to see Annotation Detail View

Disease Annotations Click to see Annotation Detail View

acute promyelocytic leukemia (ISO)

chromosome 13q14 deletion syndrome (ISO)

congestive heart failure (ISO)

intellectual disability (ISO)

Myocardial Reperfusion Injury (ISO)

pancreatitis (ISO)

proliferative diabetic retinopathy (ISO)

Gene Ontology Annotations Click to see Annotation Detail View

Biological Process

cellular response to amino acid stimulus (ISO)

cellular response to glucose stimulus (ISO)

cellular response to lipopolysaccharide (ISO)

long-term synaptic potentiation (ISO)

miRNA-mediated gene silencing by inhibition of translation (ISO)

miRNA-mediated post-transcriptional gene silencing (ISO)

negative regulation of angiogenesis (ISO)

negative regulation of blood vessel endothelial cell proliferation involved in sprouting angiogenesis (ISO)

negative regulation of canonical NF-kappaB signal transduction (ISO)

negative regulation of cell chemotaxis to fibroblast growth factor (ISO)

negative regulation of cell migration involved in sprouting angiogenesis (ISO)

negative regulation of cell population proliferation (ISO)

negative regulation of G1/S transition of mitotic cell cycle (ISO)

negative regulation of gene expression (ISO)

negative regulation of inflammatory response (ISO)

negative regulation of peptidyl-threonine phosphorylation (ISO)

negative regulation of vascular associated smooth muscle cell migration (ISO)

negative regulation of vascular associated smooth muscle cell proliferation (ISO)

negative regulation of vascular endothelial growth factor production (ISO)

ossification (ISO)

positive regulation of apoptotic process (ISO)

positive regulation of intrinsic apoptotic signaling pathway (ISO)

response to bacterium (ISO)

response to oxygen levels (ISO)

Wnt signaling pathway (ISO)

Cellular Component

extracellular exosome (ISO)

Molecular Function

mRNA 3'-UTR binding (ISO)

mRNA base-pairing translational repressor activity (ISO)

References

Additional References at PubMed

PMID:16381832	PMID:18392026

Genomics

Comparative Map Data

MIR15A
(Canis lupus familiaris - dog)

Dog Assembly	Chr	Position (strand)	Source	Genome Browsers
Dog Assembly	Chr	Position (strand)	Source	JBrowse	NCBI	UCSC	Ensembl
CanFam3.1	22	1,846,880 - 1,846,938 (+)	NCBI	CanFam3.1	CanFam3.1	canFam3	CanFam3.1
CanFam3.1 Ensembl	22	1,846,866 - 1,846,960 (+)	Ensembl	CanFam3.1		canFam3	CanFam3.1
Dog10K_Boxer_Tasha	22	1,876,038 - 1,876,096 (+)	NCBI		Dog10K_Boxer_Tasha
ROS_Cfam_1.0	22	1,834,523 - 1,834,581 (+)	NCBI		ROS_Cfam_1.0
UMICH_Zoey_3.1	22	1,746,565 - 1,746,623 (+)	NCBI		UMICH_Zoey_3.1
UNSW_CanFamBas_1.0	22	1,795,710 - 1,795,768 (+)	NCBI		UNSW_CanFamBas_1.0
UU_Cfam_GSD_1.0	22	1,814,155 - 1,814,213 (+)	NCBI		UU_Cfam_GSD_1.0

MIR15A
(Homo sapiens - human)

Human Assembly	Chr	Position (strand)	Source	Genome Browsers
Human Assembly	Chr	Position (strand)	Source	JBrowse	NCBI	UCSC	Ensembl
GRCh38	13	50,049,119 - 50,049,201 (-)	NCBI	GRCh38	GRCh38	hg38	GRCh38
GRCh38.p14 Ensembl	13	50,049,119 - 50,049,201 (-)	Ensembl	GRCh38		hg38	GRCh38
GRCh37	13	50,623,255 - 50,623,337 (-)	NCBI	GRCh37	GRCh37	hg19	GRCh37
Build 36	13	49,521,255 - 49,521,337 (-)	NCBI	NCBI36	Build 36	hg18	NCBI36
Celera	13	31,677,820 - 31,677,902 (-)	NCBI		Celera
Cytogenetic Map	13	q14.2	NCBI
HuRef	13	31,418,250 - 31,418,332 (-)	NCBI		HuRef
CHM1_1	13	50,591,043 - 50,591,125 (-)	NCBI		CHM1_1
T2T-CHM13v2.0	13	49,269,708 - 49,269,790 (-)	NCBI		T2T-CHM13v2.0

Mir15a
(Mus musculus - house mouse)

Mouse Assembly	Chr	Position (strand)	Source	Genome Browsers
Mouse Assembly	Chr	Position (strand)	Source	JBrowse	NCBI	UCSC	Ensembl
GRCm39	14	61,869,476 - 61,869,559 (-)	NCBI	GRCm39	GRCm39	mm39
GRCm39 Ensembl	14	61,869,476 - 61,869,559 (-)	Ensembl		GRCm39 Ensembl
GRCm38	14	61,632,027 - 61,632,110 (-)	NCBI	GRCm38	GRCm38	mm10	GRCm38
GRCm38.p6 Ensembl	14	61,632,027 - 61,632,110 (-)	Ensembl	GRCm38		mm10	GRCm38
MGSCv37	14	62,250,864 - 62,250,947 (-)	NCBI	GRCm37	MGSCv37	mm9	NCBIm37
Celera	14	59,399,465 - 59,399,548 (-)	NCBI		Celera
Cytogenetic Map	14	D1	NCBI
cM Map	14	33.16	NCBI

MIR15A
(Sus scrofa - pig)

Pig Assembly	Chr	Position (strand)	Source	Genome Browsers
Pig Assembly	Chr	Position (strand)	Source	JBrowse	NCBI	UCSC	Ensembl
Sscrofa11.1 Ensembl	11	17,757,460 - 17,757,554 (+)	Ensembl	Sscrofa11.1		susScr11	Sscrofa11.1
Sscrofa11.1	11	17,757,463 - 17,757,541 (+)	NCBI	Sscrofa11.1	Sscrofa11.1	susScr11	Sscrofa11.1

Expression

Sequence

Nucleotide Sequences


RefSeq Transcripts	NR_049277	(Get FASTA)	NCBI Sequence Viewer	Search GEO for Microarray Profiles
GenBank Nucleotide	AAEX04000022	(Get FASTA)	NCBI Sequence Viewer	Search GEO for Microarray Profiles
	JAAHUQ010000251	(Get FASTA)	NCBI Sequence Viewer	Search GEO for Microarray Profiles
	JAAQRD010000060	(Get FASTA)	NCBI Sequence Viewer	Search GEO for Microarray Profiles
	JAAUVH010000360	(Get FASTA)	NCBI Sequence Viewer	Search GEO for Microarray Profiles
	REHQ01000022	(Get FASTA)	NCBI Sequence Viewer	Search GEO for Microarray Profiles

RefSeq Acc Id:

ENSCAFT00000032594

Type:

CODING

Position:

Dog Assembly	Chr	Position (strand)	Source
CanFam3.1 Ensembl	22	1,846,866 - 1,846,960 (+)	Ensembl

RefSeq Acc Id:

NR_049277

RefSeq Status:

PROVISIONAL

Type:

NON-CODING

Position:

Dog Assembly	Chr	Position (strand)	Source
CanFam3.1	22	1,846,880 - 1,846,938 (+)	NCBI
Dog10K_Boxer_Tasha	22	1,876,038 - 1,876,096 (+)	NCBI
ROS_Cfam_1.0	22	1,834,523 - 1,834,581 (+)	NCBI
UMICH_Zoey_3.1	22	1,746,565 - 1,746,623 (+)	NCBI
UNSW_CanFamBas_1.0	22	1,795,710 - 1,795,768 (+)	NCBI
UU_Cfam_GSD_1.0	22	1,814,155 - 1,814,213 (+)	NCBI

Sequence:

show sequence

TAGCAGCACATAATGGTTTGTGGATTTTGAAAAGGTGCAGGCCATATTGTGCTGCCTCA

hide sequence

Additional Information

External Database Links

Database	Acc Id	Source(s)
Ensembl Genes	ENSCAFG00000020487	Ensembl
	ENSCAFG00845022587	ENTREZGENE
Ensembl Transcript	ENSCAFT00845039872	ENTREZGENE
miRBase	MI0008048	ENTREZGENE
NCBI Gene	MIR15A	ENTREZGENE
RNAcentral	URS00001BACF3	RNACentral
	URS00007E37E4	RNACentral

Nomenclature History

Date	Current Symbol	Current Name	Previous Symbol	Previous Name	Description	Reference	Status
2019-04-02	MIR15A	microRNA mir-15a		microRNA 15a	Symbol and/or name change	5135510	APPROVED

Gene Annotator (Functional Annotation) unavailable	Gene Annotator (Annotation Distribution) unavailable	Variant Visualizer (Genomic Variants) unavailble Variant Visualizer (Genomic Variants) unavailable
Gene Annotator (Functional Annotation)	Gene Annotator (Annotation Distribution)	Variant Visualizer (Genomic Variants)

InterViewer (Protein-Protein Interactions) unavailable	Gviewer (Genome Viewer) unavailable	Variant Visualizer (Damaging Variants) unavailble Variant Visualizer (Damaging Variants) unavailable
InterViewer (Protein-Protein Interactions)	GViewer (Genome Viewer)	Variant Visualizer (Damaging Variants)

Gene Annotator (Annotation Comparison) unavailable	OLGA (Gene List Generator) unavailable
Gene Annotator (Annotation Comparison)	OLGA (Gene List Generator)	Excel (Download)

MOET (Multi-Ontology Enrichement) unavailable	GOLF (Gene-Ortholog Location Finder) unavailable
MOET (Multi-Ontology Enrichement)	GOLF (Gene-Ortholog Location Finder)

Imported Disease Annotations - ClinVar

Imported Disease Annotations - CTD

Send us a Message

Imported Disease Annotations - ClinVar

Imported Disease Annotations - CTD