| 15141971 | CV693655 | single nucleotide variant | NM_001036.6(RYR3):c.*839A>G | Epileptic encephalopathy [RCV001521929]|not provided [RCV004715348] | benign | 15 | 33866065 | 33866065 | Human | 2 | name |
| 15125448 | CV776112 | single nucleotide variant | NM_001036.6(RYR3):c.51+9C>T | Epileptic encephalopathy [RCV001399340] | likely benign | 15 | 33311105 | 33311105 | Human | 2 | name |
| 126750018 | CV1031913 | single nucleotide variant | NM_001036.6(RYR3):c.972+6G>C | Epileptic encephalopathy [RCV001337959] | uncertain significance | 15 | 33550322 | 33550322 | Human | 2 | name |
| 126918801 | CV1048855 | single nucleotide variant | NM_001036.6(RYR3):c.354+4A>G | Epileptic encephalopathy [RCV001361938] | uncertain significance | 15 | 33530670 | 33530670 | Human | 2 | name |
| 127236262 | CV1080956 | single nucleotide variant | NM_001036.6(RYR3):c.280-5C>T | Epileptic encephalopathy [RCV001414637] | likely benign | 15 | 33530587 | 33530587 | Human | 2 | name |
| 127251868 | CV1080960 | single nucleotide variant | NM_001036.6(RYR3):c.741-7C>A | Epileptic encephalopathy [RCV001400222] | likely benign | 15 | 33548123 | 33548123 | Human | 2 | name |
| 127254549 | CV1102782 | single nucleotide variant | NM_001036.6(RYR3):c.279+8C>G | Epileptic encephalopathy [RCV001437273] | likely benign | 15 | 33503746 | 33503746 | Human | 2 | name |
| 127299653 | CV1124199 | single nucleotide variant | NM_001036.6(RYR3):c.547-5T>C | Epileptic encephalopathy [RCV001460885] | likely benign | 15 | 33540786 | 33540786 | Human | 2 | name |
| 127318887 | CV1124201 | single nucleotide variant | NM_001036.6(RYR3):c.741-4A>C | Epileptic encephalopathy [RCV001466391] | likely benign | 15 | 33548126 | 33548126 | Human | 2 | name |
| 127319020 | CV1157408 | single nucleotide variant | NM_001036.6(RYR3):c.815+9A>G | Epileptic encephalopathy [RCV001521921]|not provided [RCV004716740] | benign | 15 | 33548213 | 33548213 | Human | 2 | name |
| 13485931 | CV464815 | single nucleotide variant | NM_001036.6(RYR3):c.280-7C>G | Epileptic encephalopathy [RCV000553450]|not provided [RCV004715271] | benign | 15 | 33530585 | 33530585 | Human | 2 | name |
| 13805530 | CV566904 | single nucleotide variant | NM_001036.6(RYR3):c.815+6G>A | Epileptic encephalopathy [RCV000700125] | uncertain significance | 15 | 33548210 | 33548210 | Human | 2 | name |
| 15147082 | CV695635 | single nucleotide variant | NM_001036.6(RYR3):c.434-5T>C | Epileptic encephalopathy [RCV000878676]|not provided [RCV004715353] | benign | 15 | 33539345 | 33539345 | Human | 2 | name |
| 15142937 | CV776326 | single nucleotide variant | NM_001036.6(RYR3):c.973-1G>C | Epileptic encephalopathy [RCV001430593] | likely benign | 15 | 33562836 | 33562836 | Human | 2 | name |
| 38496928 | CV960819 | single nucleotide variant | NM_001036.6(RYR3):c.354+5G>A | Epileptic encephalopathy [RCV001242869] | uncertain significance | 15 | 33530671 | 33530671 | Human | 2 | name |
| 126767711 | CV1011424 | single nucleotide variant | NM_001036.6(RYR3):c.7899+6G>A | Epileptic encephalopathy [RCV001320959] | uncertain significance | 15 | 33742450 | 33742450 | Human | 2 | name |
| 126728409 | CV1031935 | single nucleotide variant | NM_001036.6(RYR3):c.6913-7C>A | Epileptic encephalopathy [RCV001348915] | likely benign|uncertain significance | 15 | 33726379 | 33726379 | Human | 2 | name |
| 126915609 | CV1048879 | single nucleotide variant | NM_001036.6(RYR3):c.7990-3T>C | Epileptic encephalopathy [RCV001371016] | uncertain significance | 15 | 33748111 | 33748111 | Human | 2 | name |
| 127275791 | CV1080970 | single nucleotide variant | NM_001036.6(RYR3):c.4308+9G>A | Epileptic encephalopathy [RCV001406894] | likely benign | 15 | 33652892 | 33652892 | Human | 2 | name |
| 127234174 | CV1080973 | single nucleotide variant | NM_001036.6(RYR3):c.5419-4G>A | Epileptic encephalopathy [RCV001414156] | likely benign | 15 | 33663533 | 33663533 | Human | 2 | name |
| 127247035 | CV1080980 | single nucleotide variant | NM_001036.6(RYR3):c.7204-4C>T | Epileptic encephalopathy [RCV001416840] | likely benign | 15 | 33731470 | 33731470 | Human | 2 | name |
| 127239929 | CV1080986 | single nucleotide variant | NM_001036.6(RYR3):c.8584-9G>T | Epileptic encephalopathy [RCV001415462] | likely benign | 15 | 33757466 | 33757466 | Human | 2 | name |
| 127271462 | CV1102785 | single nucleotide variant | NM_001036.6(RYR3):c.1269-8G>C | Epileptic encephalopathy [RCV001441847] | likely benign | 15 | 33579968 | 33579968 | Human | 2 | name |
| 127271682 | CV1102790 | single nucleotide variant | NM_001036.6(RYR3):c.3176-9T>C | Epileptic encephalopathy [RCV001441916] | likely benign | 15 | 33635605 | 33635605 | Human | 2 | name |
| 127279971 | CV1102791 | single nucleotide variant | NM_001036.6(RYR3):c.3176-7A>G | Epileptic encephalopathy [RCV001446130] | likely benign | 15 | 33635607 | 33635607 | Human | 2 | name |
| 127240762 | CV1102800 | single nucleotide variant | NM_001036.6(RYR3):c.5723-9G>C | Epileptic encephalopathy [RCV001434287] | likely benign | 15 | 33670410 | 33670410 | Human | 2 | name |
| 127273210 | CV1102807 | single nucleotide variant | NM_001036.6(RYR3):c.8705+9A>G | Epileptic encephalopathy [RCV001442454] | likely benign | 15 | 33757605 | 33757605 | Human | 2 | name |
| 127309203 | CV1124218 | single nucleotide variant | NM_001036.6(RYR3):c.6135-5C>T | Epileptic encephalopathy [RCV001456244] | likely benign | 15 | 33697877 | 33697877 | Human | 2 | name |
| 127293825 | CV1124222 | single nucleotide variant | NM_001036.6(RYR3):c.7900-4A>G | Epileptic encephalopathy [RCV001452096] | likely benign | 15 | 33746064 | 33746064 | Human | 2 | name |
| 127326055 | CV1145072 | single nucleotide variant | NM_001036.6(RYR3):c.3381+7T>A | Epileptic encephalopathy [RCV001485941] | likely benign | 15 | 33635826 | 33635826 | Human | 2 | name |
| 127303007 | CV1145082 | single nucleotide variant | NM_001036.6(RYR3):c.5419-6T>C | Epileptic encephalopathy [RCV001499249] | likely benign | 15 | 33663531 | 33663531 | Human | 2 | name |
| 127312444 | CV1145093 | single nucleotide variant | NM_001036.6(RYR3):c.7989+9C>G | Epileptic encephalopathy [RCV001481682] | likely benign | 15 | 33746166 | 33746166 | Human | 2 | name |
| 127334458 | CV1145098 | single nucleotide variant | NM_001036.6(RYR3):c.9919-6A>G | Epileptic encephalopathy [RCV001490827] | likely benign | 15 | 33801863 | 33801863 | Human | 2 | name |
| 127312304 | CV1157419 | single nucleotide variant | NM_001036.6(RYR3):c.6619+7C>G | Epileptic encephalopathy [RCV001518908] | benign | 15 | 33707061 | 33707061 | Human | 2 | name |
| 127319034 | CV1157420 | single nucleotide variant | NM_001036.6(RYR3):c.6620-3C>T | Epileptic encephalopathy [RCV001521925]|not provided [RCV001647316] | benign | 15 | 33722712 | 33722712 | Human | 2 | name |
| 151869232 | CV1413557 | single nucleotide variant | NM_001036.6(RYR3):c.3556+5A>C | Epileptic encephalopathy [RCV002018721] | uncertain significance | 15 | 33636555 | 33636555 | Human | 2 | name |
| 152028139 | CV1655090 | single nucleotide variant | NM_001036.6(RYR3):c.279+11G>A | Epileptic encephalopathy [RCV002105133]|not provided [RCV004715593] | benign | 15 | 33503749 | 33503749 | Human | 2 | name |
| 155959271 | CV2133618 | single nucleotide variant | NM_001036.6(RYR3):c.4623-9T>C | Epileptic encephalopathy [RCV003015382] | benign | 15 | 33662144 | 33662144 | Human | 2 | name |
| 401919172 | CV2794784 | single nucleotide variant | NM_001036.6(RYR3):c.280-12T>C | not specified [RCV003388459] | likely benign | 15 | 33530580 | 33530580 | Human | | name |
| 401934274 | CV2817386 | single nucleotide variant | NM_001036.6(RYR3):c.7899+8T>C | not provided [RCV003411137] | uncertain significance | 15 | 33742452 | 33742452 | Human | | name |
| 401943594 | CV2840102 | single nucleotide variant | NM_001036.6(RYR3):c.4396-5C>T | not provided [RCV003456889] | uncertain significance | 15 | 33660192 | 33660192 | Human | | name |
| 407476354 | CV3494805 | single nucleotide variant | NM_001036.6(RYR3):c.7821-5C>G | not specified [RCV004690706] | uncertain significance | 15 | 33742361 | 33742361 | Human | | name |
| 13502062 | CV464004 | single nucleotide variant | NM_001036.6(RYR3):c.3028-9G>A | Epileptic encephalopathy [RCV000541603]|not provided [RCV004704064] | likely benign | 15 | 33634577 | 33634577 | Human | 2 | name |
| 13475672 | CV464566 | single nucleotide variant | NM_001036.6(RYR3):c.1437+8G>A | Epileptic encephalopathy [RCV000526390] | benign | 15 | 33580152 | 33580152 | Human | 2 | name |
| 13470322 | CV464593 | single nucleotide variant | NM_001036.6(RYR3):c.3557-7T>G | Epileptic encephalopathy [RCV000546065] | benign | 15 | 33644304 | 33644304 | Human | 2 | name |
| 13494833 | CV464619 | single nucleotide variant | NM_001036.6(RYR3):c.7516-8C>T | Epileptic encephalopathy [RCV000536691]|not provided [RCV004715276] | benign | 15 | 33738442 | 33738442 | Human | 2 | name |
| 13470059 | CV464631 | single nucleotide variant | NM_001036.6(RYR3):c.8136+9C>G | Epileptic encephalopathy [RCV000545852]|not provided [RCV001672831] | benign | 15 | 33748269 | 33748269 | Human | 2 | name |
| 13490442 | CV464632 | single nucleotide variant | NM_001036.6(RYR3):c.8400-5C>T | Epileptic encephalopathy [RCV000555977]|RYR3-related disorder [RCV003905367] | benign | 15 | 33755060 | 33755060 | Human | 3 | name , alternate_id |
| 13494182 | CV464656 | single nucleotide variant | NM_001036.6(RYR3):c.9831-8G>C | Epileptic encephalopathy [RCV000558707]|RYR3-related disorder [RCV003935439] | benign|likely benign | 15 | 33800762 | 33800762 | Human | 3 | name , alternate_id |
| 13494110 | CV464829 | single nucleotide variant | NM_001036.6(RYR3):c.2164+8C>T | Epileptic encephalopathy [RCV000536153]|not provided [RCV004716532] | benign | 15 | 33603372 | 33603372 | Human | 2 | name |
| 13493147 | CV464831 | single nucleotide variant | NM_001036.6(RYR3):c.2574+3A>C | Epileptic encephalopathy [RCV000535468] | benign | 15 | 33624026 | 33624026 | Human | 2 | name |
| 13491373 | CV464852 | single nucleotide variant | NM_001036.6(RYR3):c.5620-5C>G | Epileptic encephalopathy [RCV000534177]|RYR3-related disorder [RCV003915530] | benign | 15 | 33669349 | 33669349 | Human | 3 | name , alternate_id |
| 13476765 | CV464854 | single nucleotide variant | NM_001036.6(RYR3):c.6134+9T>C | Epileptic encephalopathy [RCV000549301]|not provided [RCV004716534] | benign | 15 | 33696500 | 33696500 | Human | 2 | name |
| 13471859 | CV464890 | single nucleotide variant | NM_001036.6(RYR3):c.8755+9A>G | Epileptic encephalopathy [RCV000524625] | likely benign | 15 | 33768716 | 33768716 | Human | 2 | name |
| 13468434 | CV464893 | single nucleotide variant | NM_001036.6(RYR3):c.8516-8C>T | Epileptic encephalopathy [RCV000544508] | likely benign | 15 | 33756298 | 33756298 | Human | 2 | name |
| 13605802 | CV528687 | single nucleotide variant | NM_001036.6(RYR3):c.8137-3T>C | Epileptic encephalopathy [RCV000637212]|not specified [RCV005418260] | likely benign|uncertain significance | 15 | 33748465 | 33748465 | Human | 2 | name |
| 13605895 | CV528693 | single nucleotide variant | NM_001036.6(RYR3):c.8516-5C>T | Epileptic encephalopathy [RCV000637277]|not provided [RCV005411515] | likely benign|uncertain significance | 15 | 33756301 | 33756301 | Human | 2 | name |
| 13605801 | CV528702 | single nucleotide variant | NM_001036.6(RYR3):c.9268+8T>C | Epileptic encephalopathy [RCV000637188] | likely benign | 15 | 33780349 | 33780349 | Human | 2 | name |
| 13605774 | CV528705 | single nucleotide variant | NM_001036.6(RYR3):c.9589+5C>T | Epileptic encephalopathy [RCV000637184] | likely benign | 15 | 33785987 | 33785987 | Human | 2 | name |
| 13605825 | CV528716 | single nucleotide variant | NM_001036.6(RYR3):c.9590-4G>A | Epileptic encephalopathy [RCV000637237] | likely benign | 15 | 33788214 | 33788214 | Human | 2 | name |
| 13605853 | CV529019 | single nucleotide variant | NM_001036.6(RYR3):c.5419-8C>G | Epileptic encephalopathy [RCV000637264] | benign | 15 | 33663529 | 33663529 | Human | 2 | name |
| 13605771 | CV529092 | single nucleotide variant | NM_001036.6(RYR3):c.1922+9A>T | Epileptic encephalopathy [RCV000637181] | likely benign | 15 | 33601561 | 33601561 | Human | 2 | name |
| 13605794 | CV529195 | single nucleotide variant | NM_001036.6(RYR3):c.9589+6G>A | Epileptic encephalopathy [RCV000637195] | likely benign | 15 | 33785988 | 33785988 | Human | 2 | name |
| 13815843 | CV569256 | single nucleotide variant | NM_001036.6(RYR3):c.2574+5G>T | Epileptic encephalopathy [RCV000705966] | uncertain significance | 15 | 33624028 | 33624028 | Human | 2 | name |
| 13808282 | CV569257 | single nucleotide variant | NM_001036.6(RYR3):c.2679+3A>G | Epileptic encephalopathy [RCV000701561] | uncertain significance | 15 | 33628578 | 33628578 | Human | 2 | name |
| 14711886 | CV652403 | single nucleotide variant | NM_001036.6(RYR3):c.9830+5G>A | Epileptic encephalopathy [RCV000819176]|RYR3-related disorder [RCV003908107] | likely benign|uncertain significance | 15 | 33788463 | 33788463 | Human | 3 | name , alternate_id |
| 14706028 | CV652549 | single nucleotide variant | NM_001036.6(RYR3):c.4309-3C>G | Epileptic encephalopathy [RCV000802840] | uncertain significance | 15 | 33659717 | 33659717 | Human | 2 | name |
| 15135396 | CV744740 | single nucleotide variant | NM_001036.6(RYR3):c.4308+7G>A | Epileptic encephalopathy [RCV000898450] | likely benign | 15 | 33652890 | 33652890 | Human | 2 | name |
| 15182766 | CV744864 | single nucleotide variant | NM_001036.6(RYR3):c.6484-8T>A | Epileptic encephalopathy [RCV000907904] | benign | 15 | 33706911 | 33706911 | Human | 2 | name |
| 15126898 | CV745073 | single nucleotide variant | NM_001036.6(RYR3):c.3942-5C>G | Epileptic encephalopathy [RCV000897011] | likely benign | 15 | 33647419 | 33647419 | Human | 2 | name |
| 15118753 | CV745081 | single nucleotide variant | NM_001036.6(RYR3):c.4308+8C>T | Epileptic encephalopathy [RCV000895599] | benign | 15 | 33652891 | 33652891 | Human | 2 | name |
| 15145547 | CV760315 | single nucleotide variant | NM_001036.6(RYR3):c.1437+7C>T | not provided [RCV000922561] | likely benign | 15 | 33580151 | 33580151 | Human | | name |
| 15164559 | CV760318 | single nucleotide variant | NM_001036.6(RYR3):c.3176-5A>T | not provided [RCV000926411] | likely benign | 15 | 33635609 | 33635609 | Human | | name |
| 15167441 | CV760321 | single nucleotide variant | NM_001036.6(RYR3):c.6135-4C>G | Epileptic encephalopathy [RCV001462643] | likely benign | 15 | 33697878 | 33697878 | Human | 2 | name |
| 15168499 | CV760329 | single nucleotide variant | NM_001036.6(RYR3):c.6483+7G>A | Epileptic encephalopathy [RCV001412209] | likely benign | 15 | 33701087 | 33701087 | Human | 2 | name |
| 15105015 | CV775989 | single nucleotide variant | NM_001036.6(RYR3):c.7820+7C>A | RYR3-related disorder [RCV003978104]|not provided [RCV000937503] | likely benign | 15 | 33740002 | 33740002 | Human | 1 | name , alternate_id |
| 15126240 | CV776044 | deletion | NM_001036.6(RYR3):c.8200-7del | Epileptic encephalopathy [RCV001432827] | likely benign | 15 | 33749970 | 33749970 | Human | 2 | name |
| 15121127 | CV776116 | single nucleotide variant | NM_001036.6(RYR3):c.6250-4A>G | Epileptic encephalopathy [RCV000940462] | likely benign | 15 | 33699700 | 33699700 | Human | 2 | name |
| 15115531 | CV776120 | single nucleotide variant | NM_001036.6(RYR3):c.6800+9A>T | Epileptic encephalopathy [RCV001394064] | likely benign | 15 | 33722904 | 33722904 | Human | 2 | name |
| 15120996 | CV776121 | single nucleotide variant | NM_001036.6(RYR3):c.8756-8T>A | not provided [RCV000940440] | likely benign | 15 | 33769104 | 33769104 | Human | | name |
| 15098353 | CV776125 | single nucleotide variant | NM_001036.6(RYR3):c.9056-7G>A | Epileptic encephalopathy [RCV001428298] | likely benign | 15 | 33773527 | 33773527 | Human | 2 | name |
| 15150173 | CV778110 | single nucleotide variant | NM_001036.6(RYR3):c.1146+3G>T | Epileptic encephalopathy [RCV000945444] | benign | 15 | 33563013 | 33563013 | Human | 2 | name |
| 15192463 | CV778137 | single nucleotide variant | NM_001036.6(RYR3):c.2574+7T>A | Epileptic encephalopathy [RCV000955078] | likely benign | 15 | 33624030 | 33624030 | Human | 2 | name |
| 15180439 | CV778141 | single nucleotide variant | NM_001036.6(RYR3):c.3028-8T>A | Epileptic encephalopathy [RCV000951749] | likely benign | 15 | 33634578 | 33634578 | Human | 2 | name |
| 15153041 | CV778151 | single nucleotide variant | NM_001036.6(RYR3):c.4143-7C>T | Epileptic encephalopathy [RCV000946002] | likely benign | 15 | 33652711 | 33652711 | Human | 2 | name |
| 15179842 | CV778235 | single nucleotide variant | NM_001036.6(RYR3):c.9590-5C>T | Epileptic encephalopathy [RCV000951611] | likely benign | 15 | 33788213 | 33788213 | Human | 2 | name |
| 15179943 | CV778326 | single nucleotide variant | NM_001036.6(RYR3):c.4396-9G>A | Epileptic encephalopathy [RCV000951636] | likely benign | 15 | 33660188 | 33660188 | Human | 2 | name |
| 15137160 | CV788147 | single nucleotide variant | NM_001036.6(RYR3):c.5419-9T>A | Epileptic encephalopathy [RCV001406073] | likely benign | 15 | 33663528 | 33663528 | Human | 2 | name |
| 26921694 | CV851599 | single nucleotide variant | NM_001036.6(RYR3):c.8816+5G>A | Epileptic encephalopathy [RCV001050518] | uncertain significance | 15 | 33769177 | 33769177 | Human | 2 | name |
| 26884869 | CV851601 | single nucleotide variant | NM_001036.6(RYR3):c.9056-2A>G | Epileptic encephalopathy [RCV001052741] | uncertain significance | 15 | 33773532 | 33773532 | Human | 2 | name |
| 26891869 | CV852029 | single nucleotide variant | NM_001036.6(RYR3):c.1146+3G>A | Epileptic encephalopathy [RCV001061012] | uncertain significance | 15 | 33563013 | 33563013 | Human | 2 | name |
| 26921124 | CV852031 | single nucleotide variant | NM_001036.6(RYR3):c.1573+4A>G | Epileptic encephalopathy [RCV001049248] | uncertain significance | 15 | 33581647 | 33581647 | Human | 2 | name |
| 26921541 | CV852579 | single nucleotide variant | NM_001036.6(RYR3):c.1438-3C>T | Epileptic encephalopathy [RCV001050172] | uncertain significance | 15 | 33581505 | 33581505 | Human | 2 | name |
| 26905544 | CV852580 | single nucleotide variant | NM_001036.6(RYR3):c.1788+4G>A | Epileptic encephalopathy [RCV001072010] | uncertain significance | 15 | 33586120 | 33586120 | Human | 2 | name |
| 26904513 | CV852582 | single nucleotide variant | NM_001036.6(RYR3):c.5861-3C>T | Epileptic encephalopathy [RCV001070791] | uncertain significance | 15 | 33696215 | 33696215 | Human | 2 | name |
| 26886717 | CV852758 | single nucleotide variant | NM_001036.6(RYR3):c.2679+1G>T | Epileptic encephalopathy [RCV001055330] | uncertain significance | 15 | 33628576 | 33628576 | Human | 2 | name |
| 38482160 | CV960102 | single nucleotide variant | NM_001036.6(RYR3):c.5723-6T>G | Epileptic encephalopathy [RCV001235429] | likely benign|uncertain significance | 15 | 33670413 | 33670413 | Human | 2 | name |
| 38480027 | CV960103 | single nucleotide variant | NM_001036.6(RYR3):c.9830+4C>T | Epileptic encephalopathy [RCV001234547] | uncertain significance | 15 | 33788462 | 33788462 | Human | 2 | name |
| 126744834 | CV996178 | single nucleotide variant | NM_001036.6(RYR3):c.2867+3A>T | Epileptic encephalopathy [RCV001296386] | uncertain significance | 15 | 33631296 | 33631296 | Human | 2 | name |
| 126749439 | CV996183 | single nucleotide variant | NM_001036.6(RYR3):c.3556+7C>G | Epileptic encephalopathy [RCV001306636] | likely benign|uncertain significance | 15 | 33636557 | 33636557 | Human | 2 | name |
| 126729456 | CV1031951 | single nucleotide variant | NM_001036.6(RYR3):c.11568+5T>C | Epileptic encephalopathy [RCV001349105] | uncertain significance | 15 | 33835077 | 33835077 | Human | 2 | name |
| 126908048 | CV1048889 | single nucleotide variant | NM_001036.6(RYR3):c.13671+4T>C | Epileptic encephalopathy [RCV001367527] | uncertain significance | 15 | 33853091 | 33853091 | Human | 2 | name |
| 126921540 | CV1048892 | single nucleotide variant | NM_001036.6(RYR3):c.14142+4A>G | Epileptic encephalopathy [RCV001363612] | uncertain significance | 15 | 33857918 | 33857918 | Human | 2 | name |
| 127244951 | CV1080977 | single nucleotide variant | NM_001036.6(RYR3):c.6619+10A>C | Epileptic encephalopathy [RCV001393794] | likely benign | 15 | 33707064 | 33707064 | Human | 2 | name |
| 127275263 | CV1080987 | single nucleotide variant | NM_001036.6(RYR3):c.9590-10G>T | Epileptic encephalopathy [RCV001406665] | likely benign | 15 | 33788208 | 33788208 | Human | 2 | name |
| 127239324 | CV1080995 | single nucleotide variant | NM_001036.6(RYR3):c.13498-8A>G | Epileptic encephalopathy [RCV001397521] | likely benign | 15 | 33848283 | 33848283 | Human | 2 | name |
| 127233211 | CV1081000 | single nucleotide variant | NM_001036.6(RYR3):c.14008-9C>T | Epileptic encephalopathy [RCV001396035] | likely benign | 15 | 33857771 | 33857771 | Human | 2 | name |
| 127249569 | CV1102813 | single nucleotide variant | NM_001036.6(RYR3):c.10706+8C>T | Epileptic encephalopathy [RCV001425162] | likely benign | 15 | 33818692 | 33818692 | Human | 2 | name |
| 127251918 | CV1102827 | single nucleotide variant | NM_001036.6(RYR3):c.14466-8C>T | Epileptic encephalopathy [RCV001425725] | likely benign | 15 | 33864130 | 33864130 | Human | 2 | name |
| 127309106 | CV1124220 | single nucleotide variant | NM_001036.6(RYR3):c.6801-10G>A | Epileptic encephalopathy [RCV001463495] | likely benign | 15 | 33724055 | 33724055 | Human | 2 | name |
| 127328128 | CV1124239 | duplication | NM_001036.6(RYR3):c.10257+6dup | Epileptic encephalopathy [RCV001469442] | likely benign | 15 | 33811042 | 33811043 | Human | 2 | name |
| 127293540 | CV1124251 | single nucleotide variant | NM_001036.6(RYR3):c.14518-7A>G | Epileptic encephalopathy [RCV001452023] | likely benign | 15 | 33865124 | 33865124 | Human | 2 | name |
| 127298863 | CV1145084 | single nucleotide variant | NM_001036.6(RYR3):c.5722+10C>T | Epileptic encephalopathy [RCV001498171] | likely benign | 15 | 33669466 | 33669466 | Human | 2 | name |
| 127330851 | CV1145109 | single nucleotide variant | NM_001036.6(RYR3):c.13671+9T>C | Epileptic encephalopathy [RCV001488405] | likely benign | 15 | 33853096 | 33853096 | Human | 2 | name |
| 127319028 | CV1157416 | single nucleotide variant | NM_001036.6(RYR3):c.2575-10T>C | Epileptic encephalopathy [RCV001521923]|not provided [RCV004715468] | benign | 15 | 33628461 | 33628461 | Human | 2 | name |
| 127312621 | CV1157417 | duplication | NM_001036.6(RYR3):c.2867+18dup | Epileptic encephalopathy [RCV001519007] | benign | 15 | 33631301 | 33631302 | Human | 2 | name |
| 127319041 | CV1157426 | single nucleotide variant | NM_001036.6(RYR3):c.11072+8C>T | Epileptic encephalopathy [RCV001521928]|not provided [RCV004715469] | benign | 15 | 33823080 | 33823080 | Human | 2 | name |
| 8584352 | CV118925 | single nucleotide variant | NM_001036.4(RYR3):c.741-426T>G | Lung cancer [RCV000099445] | uncertain significance | 15 | 33547704 | 33547704 | Human | | name |
| 8584358 | CV118931 | single nucleotide variant | NM_001036.4(RYR3):c.8755+90C>A | Lung cancer [RCV000099451] | uncertain significance | 15 | 33768797 | 33768797 | Human | | name |
| 150436231 | CV1249661 | deletion | NM_001036.6(RYR3):c.10816-9del | Epileptic encephalopathy [RCV002073122]|not provided [RCV001665575] | benign | 15 | 33821254 | 33821254 | Human | 2 | name |
| 152103674 | CV1544575 | single nucleotide variant | NM_001036.6(RYR3):c.6380-15C>G | Epileptic encephalopathy [RCV002115672]|not provided [RCV004715597] | benign | 15 | 33700962 | 33700962 | Human | 2 | name |
| 152031842 | CV1546152 | single nucleotide variant | NM_001036.6(RYR3):c.1922+16C>T | Epileptic encephalopathy [RCV002124643]|not provided [RCV004716876] | benign | 15 | 33601568 | 33601568 | Human | 2 | name |
| 152059988 | CV1650380 | single nucleotide variant | NM_001036.6(RYR3):c.7516-10C>T | Epileptic encephalopathy [RCV002128228] | likely benign | 15 | 33738440 | 33738440 | Human | 2 | name |
| 152079313 | CV1663377 | single nucleotide variant | NM_001036.6(RYR3):c.4309-11T>C | Epileptic encephalopathy [RCV002149093]|not provided [RCV004715622] | benign | 15 | 33659709 | 33659709 | Human | 2 | name |
| 155954872 | CV2014230 | single nucleotide variant | NM_001036.6(RYR3):c.1574-12C>T | Epileptic encephalopathy [RCV002686212] | benign | 15 | 33584383 | 33584383 | Human | 2 | name |
| 156135753 | CV2032711 | deletion | NM_001036.6(RYR3):c.2867+18del | Epileptic encephalopathy [RCV002740723] | benign | 15 | 33631302 | 33631302 | Human | 2 | name |
| 405239993 | CV3165991 | single nucleotide variant | NM_001036.6(RYR3):c.8756-19A>G | Epileptic encephalopathy [RCV003867003] | benign | 15 | 33769093 | 33769093 | Human | 2 | name |
| 13462820 | CV439095 | single nucleotide variant | NM_001036.6(RYR3):c.4622+14C>T | Epileptic encephalopathy [RCV002060211]|not provided [RCV000514882] | benign | 15 | 33660437 | 33660437 | Human | 2 | name |
| 13462452 | CV439128 | single nucleotide variant | NM_001036.6(RYR3):c.8705+17A>C | not provided [RCV000514190] | likely benign | 15 | 33757613 | 33757613 | Human | | name |
| 13495293 | CV464089 | single nucleotide variant | NM_001036.6(RYR3):c.10503-6G>A | Epileptic encephalopathy [RCV000559521] | likely benign | 15 | 33816856 | 33816856 | Human | 2 | name |
| 13473153 | CV464106 | single nucleotide variant | NM_001036.6(RYR3):c.10816-9T>C | Epileptic encephalopathy [RCV000525248]|not provided [RCV004715265] | benign | 15 | 33821261 | 33821261 | Human | 2 | name |
| 13490634 | CV464129 | single nucleotide variant | NM_001036.6(RYR3):c.12978+3A>G | Epileptic encephalopathy [RCV000556116]|not specified [RCV003403276] | uncertain significance | 15 | 33838961 | 33838961 | Human | 2 | name |
| 13488782 | CV464580 | single nucleotide variant | NM_001036.6(RYR3):c.1788+10G>C | Epileptic encephalopathy [RCV000532569]|RYR3-related disorder [RCV003905364]|not provided [RCV004704063] | benign|likely benign | 15 | 33586126 | 33586126 | Human | 3 | name , alternate_id |
| 13499171 | CV464663 | single nucleotide variant | NM_001036.6(RYR3):c.10816-9T>G | Epileptic encephalopathy [RCV001475509] | likely benign | 15 | 33821261 | 33821261 | Human | 2 | name |
| 13495779 | CV464693 | single nucleotide variant | NM_001036.6(RYR3):c.13861-4C>G | Epileptic encephalopathy [RCV000559875] | likely benign | 15 | 33854762 | 33854762 | Human | 2 | name |
| 13472902 | CV464843 | single nucleotide variant | NM_001036.6(RYR3):c.4396-10C>T | Epileptic encephalopathy [RCV000547556]|RYR3-related disorder [RCV003983110]|not provided [RCV004715272] | benign | 15 | 33660187 | 33660187 | Human | 3 | name , alternate_id |
| 13503824 | CV464917 | single nucleotide variant | NM_001036.6(RYR3):c.11464-8C>A | Epileptic encephalopathy [RCV000547163]|RYR3-related disorder [RCV003915526]|not provided [RCV003311836] | benign|likely benign | 15 | 33834960 | 33834960 | Human | 3 | name , alternate_id |
| 13466435 | CV464942 | single nucleotide variant | NM_001036.6(RYR3):c.13497+6C>T | Epileptic encephalopathy [RCV000543432] | benign | 15 | 33845068 | 33845068 | Human | 2 | name |
| 13605793 | CV528624 | single nucleotide variant | NM_001036.6(RYR3):c.3381+10T>C | Epileptic encephalopathy [RCV000637196] | likely benign | 15 | 33635829 | 33635829 | Human | 2 | name |
| 13605827 | CV528675 | single nucleotide variant | NM_001036.6(RYR3):c.10503-7C>T | Epileptic encephalopathy [RCV000637239] | likely benign | 15 | 33816855 | 33816855 | Human | 2 | name |
| 13605810 | CV528711 | single nucleotide variant | NM_001036.6(RYR3):c.14466-7G>C | Epileptic encephalopathy [RCV000637220] | likely benign | 15 | 33864131 | 33864131 | Human | 2 | name |
| 13605845 | CV529005 | single nucleotide variant | NM_001036.6(RYR3):c.2784-10T>G | Epileptic encephalopathy [RCV000637256] | benign | 15 | 33631200 | 33631200 | Human | 2 | name |
| 13605788 | CV529074 | single nucleotide variant | NM_001036.6(RYR3):c.11073-8A>G | Epileptic encephalopathy [RCV000637201] | benign | 15 | 33825595 | 33825595 | Human | 2 | name |
| 13605805 | CV529230 | single nucleotide variant | NM_001036.6(RYR3):c.14517+7A>C | Epileptic encephalopathy [RCV001470608] | likely benign | 15 | 33864196 | 33864196 | Human | 2 | name |
| 13815181 | CV569293 | single nucleotide variant | NM_001036.6(RYR3):c.10816-6C>G | Epileptic encephalopathy [RCV000691414] | likely benign|uncertain significance | 15 | 33821264 | 33821264 | Human | 2 | name |
| 14712399 | CV652404 | single nucleotide variant | NM_001036.6(RYR3):c.10758+6C>G | Epileptic encephalopathy [RCV000820535]|not provided [RCV004693388] | uncertain significance | 15 | 33819813 | 33819813 | Human | 2 | name |
| 14713051 | CV652721 | single nucleotide variant | NM_001036.6(RYR3):c.10258-3C>A | Epileptic encephalopathy [RCV000822673] | uncertain significance | 15 | 33812860 | 33812860 | Human | 2 | name |
| 14708347 | CV652723 | single nucleotide variant | NM_001036.6(RYR3):c.11164+1G>A | Congenital myopathy 20 [RCV003166284]|Epileptic encephalopathy [RCV000809355]|Flexion contracture [RCV001007854] | pathogenic|uncertain significance | 15 | 33826270 | 33826270 | Human | 5 | name |
| 14708761 | CV653022 | single nucleotide variant | NM_001036.6(RYR3):c.10995+5C>T | Epileptic encephalopathy [RCV000810252]|not provided [RCV004693339] | uncertain significance | 15 | 33821607 | 33821607 | Human | 2 | name |
| 14705003 | CV653027 | single nucleotide variant | NM_001036.6(RYR3):c.13628+3G>A | Epileptic encephalopathy [RCV000799406] | uncertain significance | 15 | 33848424 | 33848424 | Human | 2 | name |
| 15194484 | CV730978 | single nucleotide variant | NM_001036.6(RYR3):c.10759-8A>G | Epileptic encephalopathy [RCV000889236] | benign | 15 | 33820748 | 33820748 | Human | 2 | name |
| 15180351 | CV730979 | single nucleotide variant | NM_001036.6(RYR3):c.12979-6G>T | not provided [RCV000885506] | likely benign | 15 | 33840819 | 33840819 | Human | | name |
| 15200808 | CV730981 | single nucleotide variant | NM_001036.6(RYR3):c.14466-7G>A | Epileptic encephalopathy [RCV000891013]|not provided [RCV001532254] | likely benign | 15 | 33864131 | 33864131 | Human | 2 | name |
| 15150614 | CV744854 | single nucleotide variant | NM_001036.6(RYR3):c.3176-10C>T | not provided [RCV000901192] | likely benign | 15 | 33635604 | 33635604 | Human | | name |
| 15122174 | CV760149 | single nucleotide variant | NM_001036.6(RYR3):c.1268+10C>T | Epileptic encephalopathy [RCV000918606] | likely benign | 15 | 33566809 | 33566809 | Human | 2 | name |
| 15166702 | CV760377 | single nucleotide variant | NM_001036.6(RYR3):c.11147-8A>G | Epileptic encephalopathy [RCV001484268] | likely benign | 15 | 33826244 | 33826244 | Human | 2 | name |
| 15108279 | CV779789 | single nucleotide variant | NM_001036.6(RYR3):c.3028-10C>T | Epileptic encephalopathy [RCV001409921] | likely benign | 15 | 33634576 | 33634576 | Human | 2 | name |
| 15111709 | CV787891 | single nucleotide variant | NM_001036.6(RYR3):c.11147-7T>C | Epileptic encephalopathy [RCV001407445] | likely benign | 15 | 33826245 | 33826245 | Human | 2 | name |
| 15108832 | CV787892 | deletion | NM_001036.6(RYR3):c.13672-8del | Epileptic encephalopathy [RCV001423901] | likely benign | 15 | 33853545 | 33853545 | Human | 2 | name |
| 15135115 | CV787991 | single nucleotide variant | NM_001036.6(RYR3):c.10815+8C>T | Epileptic encephalopathy [RCV000981868] | likely benign | 15 | 33820820 | 33820820 | Human | 2 | name |
| 26901702 | CV852033 | single nucleotide variant | NM_001036.6(RYR3):c.11569-3T>C | Epileptic encephalopathy [RCV001068829] | uncertain significance | 15 | 33836903 | 33836903 | Human | 2 | name |
| 26905604 | CV852586 | single nucleotide variant | NM_001036.6(RYR3):c.10995+6G>A | Epileptic encephalopathy [RCV001072089] | uncertain significance | 15 | 33821608 | 33821608 | Human | 2 | name |
| 38494353 | CV941082 | single nucleotide variant | NM_001036.6(RYR3):c.13860+1G>A | Epileptic encephalopathy [RCV001224911] | uncertain significance | 15 | 33854450 | 33854450 | Human | 2 | name |
| 38491716 | CV941083 | single nucleotide variant | NM_001036.6(RYR3):c.14299+4T>C | Epileptic encephalopathy [RCV001223031] | uncertain significance | 15 | 33859735 | 33859735 | Human | 2 | name |
| 38496514 | CV960104 | deletion | NM_001036.6(RYR3):c.10816-3del | Epileptic encephalopathy [RCV001226440] | uncertain significance | 15 | 33821262 | 33821262 | Human | 2 | name |
| 38457330 | CV960105 | single nucleotide variant | NM_001036.6(RYR3):c.11165-1G>A | Epileptic encephalopathy [RCV001228637] | uncertain significance | 15 | 33826671 | 33826671 | Human | 2 | name |
| 38476584 | CV960106 | single nucleotide variant | NM_001036.6(RYR3):c.14007+4T>C | Epileptic encephalopathy [RCV001233143] | uncertain significance | 15 | 33854916 | 33854916 | Human | 2 | name |
| 126747359 | CV1011433 | single nucleotide variant | NM_001036.6(RYR3):c.10759-10T>C | Epileptic encephalopathy [RCV001326142] | likely benign|uncertain significance | 15 | 33820746 | 33820746 | Human | 2 | name |
| 8649155 | CV118924 | single nucleotide variant | NM_001036.4(RYR3):c.51+76750T>A | Lung cancer [RCV000099444] | uncertain significance | 15 | 33387846 | 33387846 | Human | | name |
| 8584353 | CV118926 | single nucleotide variant | NM_001036.4(RYR3):c.973-5937C>A | Lung cancer [RCV000099446] | uncertain significance | 15 | 33556900 | 33556900 | Human | | name |
| 8584354 | CV118927 | single nucleotide variant | NM_001036.4(RYR3):c.2165-146A>C | Lung cancer [RCV000099447] | uncertain significance | 15 | 33613037 | 33613037 | Human | | name |
| 150455722 | CV1246955 | single nucleotide variant | NM_001036.6(RYR3):c.14300-19T>A | Epileptic encephalopathy [RCV002073119]|not provided [RCV001668723] | benign | 15 | 33860576 | 33860576 | Human | 2 | name |
| 8654349 | CV130924 | single nucleotide variant | NM_001036.4(RYR3):c.973-2848G>C | Lung cancer [RCV000111411] | uncertain significance | 15 | 33559989 | 33559989 | Human | | name |
| 152155854 | CV1549874 | single nucleotide variant | NM_001036.6(RYR3):c.13498-13C>T | Epileptic encephalopathy [RCV002158829]|not provided [RCV004715625] | benign | 15 | 33848278 | 33848278 | Human | 2 | name |
| 152046593 | CV1561472 | single nucleotide variant | NM_001036.6(RYR3):c.14518-19G>A | Epileptic encephalopathy [RCV002108412] | likely benign | 15 | 33865112 | 33865112 | Human | 2 | name |
| 152123001 | CV1613644 | single nucleotide variant | NM_001036.6(RYR3):c.13210-13C>G | Epileptic encephalopathy [RCV002081817]|not provided [RCV004715614] | benign | 15 | 33843475 | 33843475 | Human | 2 | name |
| 152068740 | CV1613718 | single nucleotide variant | NM_001036.6(RYR3):c.10995+19G>A | Epileptic encephalopathy [RCV002074806]|not provided [RCV004715615] | benign | 15 | 33821621 | 33821621 | Human | 2 | name |
| 152157622 | CV1630592 | single nucleotide variant | NM_001036.6(RYR3):c.10600-20A>G | Epileptic encephalopathy [RCV002122644]|not provided [RCV004715595] | benign | 15 | 33818558 | 33818558 | Human | 2 | name |
| 152105135 | CV1634003 | single nucleotide variant | NM_001036.6(RYR3):c.10995+18C>T | Epileptic encephalopathy [RCV002196049]|not provided [RCV004715626] | benign | 15 | 33821620 | 33821620 | Human | 2 | name |
| 155985934 | CV2030429 | single nucleotide variant | NM_001036.6(RYR3):c.14364+14A>G | Epileptic encephalopathy [RCV002755537] | benign | 15 | 33860673 | 33860673 | Human | 2 | name |
| 597860970 | CV3826079 | single nucleotide variant | NM_001036.6(RYR3):c.13297-20G>A | Epileptic encephalopathy [RCV005174978] | benign | 15 | 33844842 | 33844842 | Human | 2 | name |
| 15101508 | CV730980 | single nucleotide variant | NM_001036.6(RYR3):c.14364+10C>T | Epileptic encephalopathy [RCV000892296] | likely benign | 15 | 33860669 | 33860669 | Human | 2 | name |
| 15133902 | CV775991 | single nucleotide variant | NM_001036.6(RYR3):c.10389+10A>G | Epileptic encephalopathy [RCV001488072] | likely benign | 15 | 33813004 | 33813004 | Human | 2 | name |
| 15152413 | CV778328 | single nucleotide variant | NM_001036.6(RYR3):c.10197+10C>T | Epileptic encephalopathy [RCV000945877] | benign | 15 | 33810659 | 33810659 | Human | 2 | name |
| 8584355 | CV118928 | single nucleotide variant | NM_001036.4(RYR3):c.4308+1224G>T | Lung cancer [RCV000099448] | uncertain significance | 15 | 33654107 | 33654107 | Human | | name |
| 8584356 | CV118929 | single nucleotide variant | NM_001036.4(RYR3):c.4309-2434A>T | Lung cancer [RCV000099449] | uncertain significance | 15 | 33657286 | 33657286 | Human | | name |
| 8584357 | CV118930 | single nucleotide variant | NM_001036.4(RYR3):c.8705+4030A>T | Lung cancer [RCV000099450] | uncertain significance | 15 | 33761626 | 33761626 | Human | | name |
| 13487023 | CV464552 | deletion | NM_001036.6(RYR3):c.52-8_52-6del | Epileptic encephalopathy [RCV000554066]|RYR3-related disorder [RCV003935436] | benign | 15 | 33473409 | 33473411 | Human | 3 | name , alternate_id |
| 15153996 | CV754364 | single nucleotide variant | NM_001036.6(RYR3):c.15A>G (p.Gly5=) | not provided [RCV000924170] | likely benign | 15 | 33311060 | 33311060 | Human | | name |
| 127334352 | CV1145058 | single nucleotide variant | NM_001036.6(RYR3):c.57T>C (p.Asp19=) | Epileptic encephalopathy [RCV001490774] | likely benign | 15 | 33473424 | 33473424 | Human | 2 | name |
| 127338071 | CV1145059 | single nucleotide variant | NM_001036.6(RYR3):c.78C>T (p.Ile26=) | Epileptic encephalopathy [RCV001493489]|not specified [RCV004857803] | likely benign | 15 | 33473445 | 33473445 | Human | 2 | name |
| 13501273 | CV464807 | single nucleotide variant | NM_001036.6(RYR3):c.78C>A (p.Ile26=) | Epileptic encephalopathy [RCV000540909] | benign | 15 | 33473445 | 33473445 | Human | 2 | name |
| 13605736 | CV529095 | duplication | NM_001036.6(RYR3):c.13670_13671+3dup | Epileptic encephalopathy [RCV000637146] | uncertain significance | 15 | 33853084 | 33853085 | Human | 2 | name |
| 15125442 | CV770073 | single nucleotide variant | NM_001036.6(RYR3):c.46A>C (p.Arg16=) | Epileptic encephalopathy [RCV001481423] | likely benign | 15 | 33311091 | 33311091 | Human | 2 | name |
| 127233977 | CV1080957 | single nucleotide variant | NM_001036.6(RYR3):c.297C>T (p.Gly99=) | Epileptic encephalopathy [RCV001396333] | likely benign | 15 | 33530609 | 33530609 | Human | 2 | name |
| 127243487 | CV1102781 | single nucleotide variant | NM_001036.6(RYR3):c.192C>T (p.Cys64=) | Epileptic encephalopathy [RCV001423962] | likely benign | 15 | 33503651 | 33503651 | Human | 2 | name |
| 127291163 | CV1124198 | single nucleotide variant | NM_001036.6(RYR3):c.222A>G (p.Leu74=) | Epileptic encephalopathy [RCV001458636] | likely benign | 15 | 33503681 | 33503681 | Human | 2 | name |
| 127297913 | CV1124205 | deletion | NM_001036.6(RYR3):c.1574-11_1574-9del | Epileptic encephalopathy [RCV001477750]|RYR3-related disorder [RCV003921009] | likely benign | 15 | 33584384 | 33584386 | Human | 3 | name , alternate_id |
| 405270674 | CV3219671 | single nucleotide variant | NM_001036.6(RYR3):c.273C>T (p.Gly91=) | RYR3-related disorder [RCV003971431] | likely benign | 15 | 33503732 | 33503732 | Human | | name , trait , alternate_id |
| 405701818 | CV3310125 | single nucleotide variant | NM_001036.6(RYR3):c.23G>A (p.Gly8Asp) | not specified [RCV004447203] | uncertain significance | 15 | 33311068 | 33311068 | Human | | name |
| 13501744 | CV464554 | single nucleotide variant | NM_001036.6(RYR3):c.147C>T (p.Phe49=) | Epileptic encephalopathy [RCV000541249] | likely benign | 15 | 33473514 | 33473514 | Human | 2 | name |
| 13605723 | CV528998 | single nucleotide variant | NM_001036.6(RYR3):c.13G>A (p.Gly5Arg) | Epileptic encephalopathy [RCV000637133] | uncertain significance | 15 | 33311058 | 33311058 | Human | 2 | name |
| 13605901 | CV529001 | single nucleotide variant | NM_001036.6(RYR3):c.270C>T (p.Gly90=) | Epileptic encephalopathy [RCV000637259] | likely benign | 15 | 33503729 | 33503729 | Human | 2 | name |
| 13605842 | CV529072 | single nucleotide variant | NM_001036.6(RYR3):c.17A>G (p.Glu6Gly) | Epileptic encephalopathy [RCV001429156]|not specified [RCV004025506] | likely benign|uncertain significance | 15 | 33311062 | 33311062 | Human | 2 | name |
| 15182209 | CV703118 | single nucleotide variant | NM_001036.6(RYR3):c.282A>G (p.Ala94=) | not provided [RCV000952162] | likely benign | 15 | 33530594 | 33530594 | Human | | name |
| 15102027 | CV703119 | single nucleotide variant | NM_001036.6(RYR3):c.288A>G (p.Gln96=) | Epileptic encephalopathy [RCV000959211]|not provided [RCV003396560] | likely benign | 15 | 33530600 | 33530600 | Human | 2 | name |
| 15169774 | CV739542 | single nucleotide variant | NM_001036.6(RYR3):c.120C>T (p.Ala40=) | Epileptic encephalopathy [RCV000905129] | likely benign | 15 | 33473487 | 33473487 | Human | 2 | name |
| 15142699 | CV770074 | single nucleotide variant | NM_001036.6(RYR3):c.234C>A (p.Ala78=) | not provided [RCV000944120] | likely benign | 15 | 33503693 | 33503693 | Human | | name |
| 26894019 | CV842135 | single nucleotide variant | NM_001036.6(RYR3):c.11G>C (p.Gly4Ala) | Congenital myopathy 20 [RCV003492216]|Epileptic encephalopathy [RCV001063110]|not specified [RCV004030481] | likely benign|uncertain significance | 15 | 33311056 | 33311056 | Human | 3 | name |
| 126729755 | CV996168 | single nucleotide variant | NM_001036.6(RYR3):c.14G>A (p.Gly5Glu) | Epileptic encephalopathy [RCV001303620] | uncertain significance | 15 | 33311059 | 33311059 | Human | 2 | name |
| 126916461 | CV1048852 | single nucleotide variant | NM_001036.6(RYR3):c.79G>A (p.Ala27Thr) | Epileptic encephalopathy [RCV001360593] | uncertain significance | 15 | 33473446 | 33473446 | Human | 2 | name |
| 127243925 | CV1080958 | single nucleotide variant | NM_001036.6(RYR3):c.498A>C (p.Arg166=) | Epileptic encephalopathy [RCV001416269] | likely benign | 15 | 33539414 | 33539414 | Human | 2 | name |
| 127270994 | CV1080959 | single nucleotide variant | NM_001036.6(RYR3):c.561A>C (p.Ser187=) | Epileptic encephalopathy [RCV001405224] | likely benign | 15 | 33540805 | 33540805 | Human | 2 | name |
| 127234494 | CV1080961 | single nucleotide variant | NM_001036.6(RYR3):c.762G>A (p.Gly254=) | Epileptic encephalopathy [RCV001396439] | likely benign | 15 | 33548151 | 33548151 | Human | 2 | name |
| 127230475 | CV1080962 | single nucleotide variant | NM_001036.6(RYR3):c.993C>T (p.Asp331=) | Epileptic encephalopathy [RCV001412471] | likely benign | 15 | 33562857 | 33562857 | Human | 2 | name |
| 127282036 | CV1102783 | single nucleotide variant | NM_001036.6(RYR3):c.519C>T (p.Leu173=) | Epileptic encephalopathy [RCV001447581] | likely benign | 15 | 33539435 | 33539435 | Human | 2 | name |
| 127270342 | CV1102784 | single nucleotide variant | NM_001036.6(RYR3):c.825C>T (p.Gly275=) | Epileptic encephalopathy [RCV001441423] | likely benign | 15 | 33550169 | 33550169 | Human | 2 | name |
| 127244974 | CV1102829 | duplication | NM_001036.6(RYR3):c.14518-7_14518-4dup | Epileptic encephalopathy [RCV001435137] | likely benign | 15 | 33865121 | 33865122 | Human | 2 | name |
| 127311026 | CV1124200 | single nucleotide variant | NM_001036.6(RYR3):c.663G>A (p.Gly221=) | Epileptic encephalopathy [RCV001464059] | likely benign | 15 | 33543638 | 33543638 | Human | 2 | name |
| 127315718 | CV1145060 | single nucleotide variant | NM_001036.6(RYR3):c.339C>T (p.His113=) | Epileptic encephalopathy [RCV001482590] | likely benign | 15 | 33530651 | 33530651 | Human | 2 | name |
| 127309200 | CV1145061 | single nucleotide variant | NM_001036.6(RYR3):c.831C>T (p.Asn277=) | Epileptic encephalopathy [RCV001500984] | likely benign | 15 | 33550175 | 33550175 | Human | 2 | name |
| 127299103 | CV1157407 | single nucleotide variant | NM_001036.6(RYR3):c.621G>A (p.Thr207=) | Epileptic encephalopathy [RCV001513554]|not provided [RCV003399277] | benign|likely benign | 15 | 33540865 | 33540865 | Human | 2 | name |
| 13497177 | CV463964 | single nucleotide variant | NM_001036.6(RYR3):c.363A>G (p.Thr121=) | Epileptic encephalopathy [RCV000560871] | likely benign | 15 | 33533319 | 33533319 | Human | 2 | name |
| 13475248 | CV463969 | single nucleotide variant | NM_001036.6(RYR3):c.789T>G (p.Leu263=) | Epileptic encephalopathy [RCV001442591] | likely benign | 15 | 33548178 | 33548178 | Human | 2 | name |
| 13466878 | CV464559 | single nucleotide variant | NM_001036.6(RYR3):c.855A>T (p.Arg285=) | Epileptic encephalopathy [RCV000543694]|not provided [RCV004715278] | benign | 15 | 33550199 | 33550199 | Human | 2 | name |
| 13484390 | CV464813 | single nucleotide variant | NM_001036.6(RYR3):c.348C>T (p.Ser116=) | Epileptic encephalopathy [RCV000552741]|not provided [RCV003409785] | likely benign | 15 | 33530660 | 33530660 | Human | 2 | name |
| 13806614 | CV566898 | single nucleotide variant | NM_001036.6(RYR3):c.648A>G (p.Gly216=) | Epileptic encephalopathy [RCV000686330] | likely benign|uncertain significance | 15 | 33543623 | 33543623 | Human | 2 | name |
| 14729354 | CV643011 | single nucleotide variant | NM_001036.6(RYR3):c.30C>A (p.Asp10Glu) | Epileptic encephalopathy [RCV000800449]|not provided [RCV002067392] | uncertain significance | 15 | 33311075 | 33311075 | Human | 2 | name |
| 15173006 | CV770075 | single nucleotide variant | NM_001036.6(RYR3):c.315C>T (p.Tyr105=) | Epileptic encephalopathy [RCV001461790] | likely benign | 15 | 33530627 | 33530627 | Human | 2 | name |
| 15119501 | CV784871 | single nucleotide variant | NM_001036.6(RYR3):c.552C>G (p.Leu184=) | Epileptic encephalopathy [RCV001410513] | likely benign | 15 | 33540796 | 33540796 | Human | 2 | name |
| 15111115 | CV787890 | deletion | NM_001036.6(RYR3):c.10816-9_10816-8del | Epileptic encephalopathy [RCV001430150] | likely benign | 15 | 33821261 | 33821262 | Human | 2 | name |
| 38485696 | CV948809 | single nucleotide variant | NM_001036.6(RYR3):c.80C>A (p.Ala27Asp) | Epileptic encephalopathy [RCV001236865] | uncertain significance | 15 | 33473447 | 33473447 | Human | 2 | name |
| 126763235 | CV1011404 | single nucleotide variant | NM_001036.6(RYR3):c.1128G>A (p.Leu376=) | Epileptic encephalopathy [RCV001319168] | likely benign|uncertain significance | 15 | 33562992 | 33562992 | Human | 2 | name |
| 126918610 | CV1048853 | single nucleotide variant | NM_001036.6(RYR3):c.161C>T (p.Ser54Leu) | Congenital myopathy 20 [RCV003761205]|Epileptic encephalopathy [RCV001361822] | uncertain significance | 15 | 33473528 | 33473528 | Human | 3 | name |
| 126917260 | CV1048854 | single nucleotide variant | NM_001036.6(RYR3):c.178C>G (p.Pro60Ala) | Epileptic encephalopathy [RCV001371975] | uncertain significance | 15 | 33503637 | 33503637 | Human | 2 | name |
| 127230505 | CV1080963 | single nucleotide variant | NM_001036.6(RYR3):c.1215C>G (p.Ser405=) | Epileptic encephalopathy [RCV001394710] | likely benign | 15 | 33566746 | 33566746 | Human | 2 | name |
| 127252025 | CV1080964 | single nucleotide variant | NM_001036.6(RYR3):c.1344C>T (p.Ala448=) | Epileptic encephalopathy [RCV001417956] | likely benign | 15 | 33580051 | 33580051 | Human | 2 | name |
| 127259290 | CV1080965 | single nucleotide variant | NM_001036.6(RYR3):c.1743C>T (p.Ile581=) | Epileptic encephalopathy [RCV001401900] | likely benign | 15 | 33586071 | 33586071 | Human | 2 | name |
| 127283976 | CV1080966 | single nucleotide variant | NM_001036.6(RYR3):c.1953G>A (p.Ala651=) | Epileptic encephalopathy [RCV001412139] | likely benign | 15 | 33603153 | 33603153 | Human | 2 | name |
| 127278569 | CV1080967 | single nucleotide variant | NM_001036.6(RYR3):c.2043G>T (p.Arg681=) | Epileptic encephalopathy [RCV001408536] | likely benign | 15 | 33603243 | 33603243 | Human | 2 | name |
| 127252955 | CV1080968 | single nucleotide variant | NM_001036.6(RYR3):c.2829T>C (p.Ala943=) | Epileptic encephalopathy [RCV001418185] | likely benign | 15 | 33631255 | 33631255 | Human | 2 | name |
| 127278134 | CV1102786 | single nucleotide variant | NM_001036.6(RYR3):c.1341C>T (p.Ile447=) | Epileptic encephalopathy [RCV001444831] | likely benign | 15 | 33580048 | 33580048 | Human | 2 | name |
| 127233298 | CV1102787 | single nucleotide variant | NM_001036.6(RYR3):c.1416A>G (p.Arg472=) | Epileptic encephalopathy [RCV001421715] | likely benign | 15 | 33580123 | 33580123 | Human | 2 | name |
| 127282515 | CV1102788 | single nucleotide variant | NM_001036.6(RYR3):c.1605C>T (p.Cys535=) | Epileptic encephalopathy [RCV001447892] | likely benign | 15 | 33584426 | 33584426 | Human | 2 | name |
| 127243737 | CV1102789 | single nucleotide variant | NM_001036.6(RYR3):c.1734G>A (p.Glu578=) | Epileptic encephalopathy [RCV001424007] | likely benign | 15 | 33586062 | 33586062 | Human | 2 | name |
| 127304136 | CV1124202 | single nucleotide variant | NM_001036.6(RYR3):c.1041G>A (p.Lys347=) | Epileptic encephalopathy [RCV001462129] | likely benign | 15 | 33562905 | 33562905 | Human | 2 | name |
| 127330020 | CV1124203 | single nucleotide variant | NM_001036.6(RYR3):c.1092G>A (p.Val364=) | Epileptic encephalopathy [RCV001470580]|not provided [RCV004704593] | likely benign | 15 | 33562956 | 33562956 | Human | 2 | name |
| 127309039 | CV1124204 | single nucleotide variant | NM_001036.6(RYR3):c.1290C>T (p.Ala430=) | Epileptic encephalopathy [RCV001456210] | likely benign | 15 | 33579997 | 33579997 | Human | 2 | name |
| 127326000 | CV1124206 | single nucleotide variant | NM_001036.6(RYR3):c.1656A>G (p.Leu552=) | Epileptic encephalopathy [RCV001468647] | likely benign | 15 | 33584477 | 33584477 | Human | 2 | name |
| 127313424 | CV1124207 | single nucleotide variant | NM_001036.6(RYR3):c.2286G>T (p.Val762=) | Epileptic encephalopathy [RCV001457455] | likely benign | 15 | 33613304 | 33613304 | Human | 2 | name |
| 127302631 | CV1124208 | single nucleotide variant | NM_001036.6(RYR3):c.2757C>T (p.Asn919=) | Epileptic encephalopathy [RCV001454485] | likely benign | 15 | 33630017 | 33630017 | Human | 2 | name |
| 127320916 | CV1145062 | single nucleotide variant | NM_001036.6(RYR3):c.1059C>T (p.Cys353=) | Epileptic encephalopathy [RCV001484383] | likely benign | 15 | 33562923 | 33562923 | Human | 2 | name |
| 127317464 | CV1145063 | single nucleotide variant | NM_001036.6(RYR3):c.1128G>T (p.Leu376=) | Epileptic encephalopathy [RCV001503395] | likely benign | 15 | 33562992 | 33562992 | Human | 2 | name |
| 127333673 | CV1145064 | single nucleotide variant | NM_001036.6(RYR3):c.1317C>T (p.Val439=) | Epileptic encephalopathy [RCV001490321] | likely benign | 15 | 33580024 | 33580024 | Human | 2 | name |
| 127289133 | CV1145065 | single nucleotide variant | NM_001036.6(RYR3):c.1524G>A (p.Glu508=) | Epileptic encephalopathy [RCV001495532] | likely benign | 15 | 33581594 | 33581594 | Human | 2 | name |
| 127316044 | CV1145066 | single nucleotide variant | NM_001036.6(RYR3):c.1914T>C (p.Asp638=) | Epileptic encephalopathy [RCV001502906] | likely benign | 15 | 33601544 | 33601544 | Human | 2 | name |
| 127315243 | CV1145067 | single nucleotide variant | NM_001036.6(RYR3):c.2133C>A (p.Ser711=) | Epileptic encephalopathy [RCV001482478] | likely benign | 15 | 33603333 | 33603333 | Human | 2 | name |
| 127315722 | CV1145068 | single nucleotide variant | NM_001036.6(RYR3):c.2409C>T (p.Pro803=) | Epileptic encephalopathy [RCV001482591] | likely benign | 15 | 33623858 | 33623858 | Human | 2 | name |
| 127289418 | CV1145069 | single nucleotide variant | NM_001036.6(RYR3):c.2517T>C (p.Gly839=) | Epileptic encephalopathy [RCV001495623] | likely benign | 15 | 33623966 | 33623966 | Human | 2 | name |
| 127336621 | CV1145070 | single nucleotide variant | NM_001036.6(RYR3):c.2787C>G (p.Thr929=) | Epileptic encephalopathy [RCV001492299] | likely benign | 15 | 33631213 | 33631213 | Human | 2 | name |
| 127302138 | CV1157409 | single nucleotide variant | NM_001036.6(RYR3):c.1104A>G (p.Ala368=) | Epileptic encephalopathy [RCV001514950]|not provided [RCV004715445] | benign | 15 | 33562968 | 33562968 | Human | 2 | name |
| 127303366 | CV1157410 | single nucleotide variant | NM_001036.6(RYR3):c.1203G>A (p.Gln401=) | Epileptic encephalopathy [RCV001515455]|not provided [RCV004715448] | benign | 15 | 33566734 | 33566734 | Human | 2 | name |
| 127319024 | CV1157411 | single nucleotide variant | NM_001036.6(RYR3):c.1269C>T (p.Ser423=) | Epileptic encephalopathy [RCV001521922]|not provided [RCV004715467] | benign | 15 | 33579976 | 33579976 | Human | 2 | name |
| 127318901 | CV1157413 | single nucleotide variant | NM_001036.6(RYR3):c.1773C>T (p.His591=) | Epileptic encephalopathy [RCV001521870] | benign | 15 | 33586101 | 33586101 | Human | 2 | name |
| 127320259 | CV1157415 | single nucleotide variant | NM_001036.6(RYR3):c.2403G>C (p.Leu801=) | Epileptic encephalopathy [RCV001522545]|not provided [RCV004715472] | benign | 15 | 33623852 | 33623852 | Human | 2 | name |
| 151782688 | CV1369869 | single nucleotide variant | NM_001036.6(RYR3):c.287A>G (p.Gln96Arg) | Epileptic encephalopathy [RCV001930589] | uncertain significance | 15 | 33530599 | 33530599 | Human | 2 | name |
| 151823849 | CV1412332 | single nucleotide variant | NM_001036.6(RYR3):c.137G>A (p.Arg46His) | Epileptic encephalopathy [RCV001901148]|not specified [RCV003994350] | uncertain significance | 15 | 33473504 | 33473504 | Human | 2 | name |
| 152148653 | CV1566339 | single nucleotide variant | NM_001036.6(RYR3):c.2835G>A (p.Glu945=) | Epileptic encephalopathy [RCV002139187] | likely benign | 15 | 33631261 | 33631261 | Human | 2 | name |
| 156156325 | CV2266207 | single nucleotide variant | NM_001036.6(RYR3):c.271G>A (p.Gly91Ser) | not specified [RCV004128780] | uncertain significance | 15 | 33503730 | 33503730 | Human | | name |
| 329368716 | CV2428115 | single nucleotide variant | NM_001036.6(RYR3):c.136C>T (p.Arg46Cys) | not specified [RCV004254487] | uncertain significance | 15 | 33473503 | 33473503 | Human | | name |
| 401934273 | CV2817380 | single nucleotide variant | NM_001036.6(RYR3):c.2790C>T (p.Leu930=) | not provided [RCV003411136] | likely benign | 15 | 33631216 | 33631216 | Human | | name |
| 401916036 | CV2817381 | single nucleotide variant | NM_001036.6(RYR3):c.2883C>T (p.Asn961=) | not provided [RCV003400843] | likely benign | 15 | 33632964 | 33632964 | Human | | name |
| 405268206 | CV3186993 | single nucleotide variant | NM_001036.6(RYR3):c.1812C>T (p.Leu604=) | not provided [RCV003887076] | likely benign | 15 | 33601442 | 33601442 | Human | | name |
| 405259971 | CV3195297 | single nucleotide variant | NM_001036.6(RYR3):c.1791T>A (p.Val597=) | RYR3-related disorder [RCV003894491] | likely benign | 15 | 33601421 | 33601421 | Human | | name , trait , alternate_id |
| 405270672 | CV3212018 | single nucleotide variant | NM_001036.6(RYR3):c.1095C>G (p.Thr365=) | RYR3-related disorder [RCV003949410] | likely benign | 15 | 33562959 | 33562959 | Human | | name , trait , alternate_id |
| 13492823 | CV463984 | single nucleotide variant | NM_001036.6(RYR3):c.1953G>C (p.Ala651=) | Epileptic encephalopathy [RCV001498855] | likely benign | 15 | 33603153 | 33603153 | Human | 2 | name |
| 13466794 | CV463987 | single nucleotide variant | NM_001036.6(RYR3):c.2214G>A (p.Ser738=) | Epileptic encephalopathy [RCV000543655]|not provided [RCV001310742] | benign|likely benign | 15 | 33613232 | 33613232 | Human | 2 | name |
| 13482443 | CV463991 | single nucleotide variant | NM_001036.6(RYR3):c.2502T>A (p.Ile834=) | Epileptic encephalopathy [RCV000551858]|not provided [RCV004715270] | benign | 15 | 33623951 | 33623951 | Human | 2 | name |
| 13497627 | CV464817 | single nucleotide variant | NM_001036.6(RYR3):c.1110C>T (p.Asp370=) | Epileptic encephalopathy [RCV000538729]|not provided [RCV004716529] | benign | 15 | 33562974 | 33562974 | Human | 2 | name |
| 13482622 | CV464824 | single nucleotide variant | NM_001036.6(RYR3):c.1491C>T (p.Ser497=) | Epileptic encephalopathy [RCV000529498] | likely benign | 15 | 33581561 | 33581561 | Human | 2 | name |
| 13472959 | CV464830 | single nucleotide variant | NM_001036.6(RYR3):c.2532C>T (p.Leu844=) | Epileptic encephalopathy [RCV000525161] | likely benign | 15 | 33623981 | 33623981 | Human | 2 | name |
| 13605744 | CV528608 | single nucleotide variant | NM_001036.6(RYR3):c.1146G>A (p.Lys382=) | Epileptic encephalopathy [RCV000637154] | benign|uncertain significance | 15 | 33563010 | 33563010 | Human | 2 | name |
| 13605829 | CV529100 | single nucleotide variant | NM_001036.6(RYR3):c.2559C>T (p.Pro853=) | Epileptic encephalopathy [RCV000637241] | likely benign | 15 | 33624008 | 33624008 | Human | 2 | name |
| 13807678 | CV566895 | single nucleotide variant | NM_001036.6(RYR3):c.160T>G (p.Ser54Ala) | Epileptic encephalopathy [RCV000686918]|not specified [RCV005268710] | uncertain significance | 15 | 33473527 | 33473527 | Human | 2 | name |
| 13816440 | CV569236 | single nucleotide variant | NM_001036.6(RYR3):c.264A>C (p.Glu88Asp) | Epileptic encephalopathy [RCV000706366] | uncertain significance | 15 | 33503723 | 33503723 | Human | 2 | name |
| 14723644 | CV643012 | single nucleotide variant | NM_001036.6(RYR3):c.274G>A (p.Glu92Lys) | Epileptic encephalopathy [RCV000814442] | likely benign|uncertain significance | 15 | 33503733 | 33503733 | Human | 2 | name |
| 15174388 | CV703121 | single nucleotide variant | NM_001036.6(RYR3):c.1587C>T (p.Arg529=) | Epileptic encephalopathy [RCV000950336] | likely benign | 15 | 33584408 | 33584408 | Human | 2 | name |
| 15181780 | CV703123 | single nucleotide variant | NM_001036.6(RYR3):c.2301G>A (p.Glu767=) | Epileptic encephalopathy [RCV000952060] | benign | 15 | 33613319 | 33613319 | Human | 2 | name |
| 15176873 | CV703124 | single nucleotide variant | NM_001036.6(RYR3):c.2595A>G (p.Leu865=) | Epileptic encephalopathy [RCV000950922] | likely benign | 15 | 33628491 | 33628491 | Human | 2 | name |
| 15152798 | CV703125 | single nucleotide variant | NM_001036.6(RYR3):c.2598A>G (p.Glu866=) | Epileptic encephalopathy [RCV000945951] | likely benign | 15 | 33628494 | 33628494 | Human | 2 | name |
| 15132337 | CV714390 | single nucleotide variant | NM_001036.6(RYR3):c.2910G>A (p.Leu970=) | Epileptic encephalopathy [RCV001475496] | likely benign | 15 | 33632991 | 33632991 | Human | 2 | name |
| 15201782 | CV726002 | single nucleotide variant | NM_001036.6(RYR3):c.1911C>T (p.Asn637=) | not provided [RCV000891290] | likely benign | 15 | 33601541 | 33601541 | Human | | name |
| 15149982 | CV726003 | single nucleotide variant | NM_001036.6(RYR3):c.1950C>T (p.Val650=) | Epileptic encephalopathy [RCV001397522] | likely benign | 15 | 33603150 | 33603150 | Human | 2 | name |
| 15114287 | CV739543 | single nucleotide variant | NM_001036.6(RYR3):c.1737C>T (p.Gly579=) | Epileptic encephalopathy [RCV002065611] | likely benign | 15 | 33586065 | 33586065 | Human | 2 | name |
| 15166800 | CV739544 | single nucleotide variant | NM_001036.6(RYR3):c.1998C>T (p.Ile666=) | Epileptic encephalopathy [RCV000904520] | likely benign | 15 | 33603198 | 33603198 | Human | 2 | name |
| 15132641 | CV739545 | single nucleotide variant | NM_001036.6(RYR3):c.2094A>G (p.Glu698=) | Epileptic encephalopathy [RCV001439038] | likely benign | 15 | 33603294 | 33603294 | Human | 2 | name |
| 15117163 | CV739546 | single nucleotide variant | NM_001036.6(RYR3):c.2220C>T (p.Asp740=) | Epileptic encephalopathy [RCV000895329] | likely benign | 15 | 33613238 | 33613238 | Human | 2 | name |
| 15166440 | CV754365 | single nucleotide variant | NM_001036.6(RYR3):c.1329A>G (p.Leu443=) | Epileptic encephalopathy [RCV001484260] | likely benign | 15 | 33580036 | 33580036 | Human | 2 | name |
| 15166721 | CV754366 | single nucleotide variant | NM_001036.6(RYR3):c.2964A>G (p.Glu988=) | Epileptic encephalopathy [RCV001439997] | likely benign | 15 | 33633045 | 33633045 | Human | 2 | name |
| 15133961 | CV770076 | single nucleotide variant | NM_001036.6(RYR3):c.2433A>G (p.Glu811=) | not provided [RCV000942661] | likely benign | 15 | 33623882 | 33623882 | Human | | name |
| 15101685 | CV784872 | single nucleotide variant | NM_001036.6(RYR3):c.1209G>A (p.Glu403=) | not provided [RCV000975640] | likely benign | 15 | 33566740 | 33566740 | Human | | name |
| 15118281 | CV784873 | single nucleotide variant | NM_001036.6(RYR3):c.2637T>C (p.Leu879=) | Epileptic encephalopathy [RCV000978923] | likely benign | 15 | 33628533 | 33628533 | Human | 2 | name |
| 15103957 | CV784874 | single nucleotide variant | NM_001036.6(RYR3):c.2931T>A (p.Pro977=) | Epileptic encephalopathy [RCV001472917] | likely benign | 15 | 33633012 | 33633012 | Human | 2 | name |
| 26904804 | CV842136 | single nucleotide variant | NM_001036.6(RYR3):c.191G>A (p.Cys64Tyr) | Epileptic encephalopathy [RCV001071177] | uncertain significance | 15 | 33503650 | 33503650 | Human | 2 | name |
| 38479920 | CV927268 | single nucleotide variant | NM_001036.6(RYR3):c.251C>T (p.Ala84Val) | Epileptic encephalopathy [RCV001217309] | uncertain significance | 15 | 33503710 | 33503710 | Human | 2 | name |
| 126755997 | CV996169 | single nucleotide variant | NM_001036.6(RYR3):c.193G>A (p.Val65Ile) | Epileptic encephalopathy [RCV001298476]|not specified [RCV004036107] | uncertain significance | 15 | 33503652 | 33503652 | Human | 2 | name |
| 126769824 | CV1011403 | single nucleotide variant | NM_001036.6(RYR3):c.859C>T (p.Arg287Trp) | Epileptic encephalopathy [RCV001322199] | uncertain significance | 15 | 33550203 | 33550203 | Human | 2 | name |
| 126730399 | CV1011416 | single nucleotide variant | NM_001036.6(RYR3):c.4128C>T (p.Gly1376=) | Epileptic encephalopathy [RCV001312857] | likely benign|uncertain significance | 15 | 33649221 | 33649221 | Human | 2 | name |
| 126734884 | CV1031911 | single nucleotide variant | NM_001036.6(RYR3):c.454A>T (p.Ile152Leu) | Epileptic encephalopathy [RCV001350012] | uncertain significance | 15 | 33539370 | 33539370 | Human | 2 | name |
| 126774055 | CV1031912 | single nucleotide variant | NM_001036.6(RYR3):c.821G>T (p.Ser274Ile) | Epileptic encephalopathy [RCV001346783] | uncertain significance | 15 | 33550165 | 33550165 | Human | 2 | name |
| 126758012 | CV1031938 | single nucleotide variant | NM_001036.6(RYR3):c.8058G>A (p.Val2686=) | Epileptic encephalopathy [RCV001339733] | likely benign|uncertain significance | 15 | 33748182 | 33748182 | Human | 2 | name |
| 126922485 | CV1048856 | single nucleotide variant | NM_001036.6(RYR3):c.454A>G (p.Ile152Val) | Epileptic encephalopathy [RCV001364728]|not specified [RCV005271210] | uncertain significance | 15 | 33539370 | 33539370 | Human | 2 | name |
| 126920352 | CV1048857 | single nucleotide variant | NM_001036.6(RYR3):c.571A>G (p.Ile191Val) | Epileptic encephalopathy [RCV001362826] | uncertain significance | 15 | 33540815 | 33540815 | Human | 2 | name |
| 126924082 | CV1048858 | single nucleotide variant | NM_001036.6(RYR3):c.578T>G (p.Val193Gly) | Epileptic encephalopathy [RCV001366610] | uncertain significance | 15 | 33540822 | 33540822 | Human | 2 | name |
| 126920386 | CV1048859 | single nucleotide variant | NM_001036.6(RYR3):c.625T>C (p.Ser209Pro) | Epileptic encephalopathy [RCV001362847]|not specified [RCV004036850] | uncertain significance | 15 | 33540869 | 33540869 | Human | 2 | name |
| 126912668 | CV1048860 | single nucleotide variant | NM_001036.6(RYR3):c.688C>G (p.His230Asp) | Epileptic encephalopathy [RCV001358901] | uncertain significance | 15 | 33543663 | 33543663 | Human | 2 | name |
| 126921955 | CV1048861 | single nucleotide variant | NM_001036.6(RYR3):c.703A>G (p.Thr235Ala) | Epileptic encephalopathy [RCV001364097] | uncertain significance | 15 | 33543678 | 33543678 | Human | 2 | name |
| 126913391 | CV1048876 | single nucleotide variant | NM_001036.6(RYR3):c.6699G>A (p.Arg2233=) | Epileptic encephalopathy [RCV001370085] | uncertain significance | 15 | 33722794 | 33722794 | Human | 2 | name |
| 127281637 | CV1080969 | single nucleotide variant | NM_001036.6(RYR3):c.4287G>A (p.Lys1429=) | Epileptic encephalopathy [RCV001410612] | likely benign | 15 | 33652862 | 33652862 | Human | 2 | name |
| 127248726 | CV1080971 | single nucleotide variant | NM_001036.6(RYR3):c.5232G>C (p.Arg1744=) | Epileptic encephalopathy [RCV001417201] | likely benign | 15 | 33662762 | 33662762 | Human | 2 | name |
| 127252399 | CV1080972 | single nucleotide variant | NM_001036.6(RYR3):c.5256C>T (p.Pro1752=) | Epileptic encephalopathy [RCV001400347] | likely benign | 15 | 33662786 | 33662786 | Human | 2 | name |
| 127242855 | CV1080974 | single nucleotide variant | NM_001036.6(RYR3):c.6003G>A (p.Arg2001=) | Epileptic encephalopathy [RCV001393411] | likely benign | 15 | 33696360 | 33696360 | Human | 2 | name |
| 127280244 | CV1080975 | single nucleotide variant | NM_001036.6(RYR3):c.6090C>G (p.Val2030=) | Epileptic encephalopathy [RCV001409673] | likely benign | 15 | 33696447 | 33696447 | Human | 2 | name |
| 127251962 | CV1080976 | single nucleotide variant | NM_001036.6(RYR3):c.6477C>T (p.Leu2159=) | Epileptic encephalopathy [RCV001417931] | likely benign | 15 | 33701074 | 33701074 | Human | 2 | name |
| 127272062 | CV1080978 | single nucleotide variant | NM_001036.6(RYR3):c.6697C>A (p.Arg2233=) | Epileptic encephalopathy [RCV001405582] | likely benign | 15 | 33722792 | 33722792 | Human | 2 | name |
| 127281317 | CV1080979 | single nucleotide variant | NM_001036.6(RYR3):c.6958C>T (p.Leu2320=) | Epileptic encephalopathy [RCV001410380] | likely benign | 15 | 33726431 | 33726431 | Human | 2 | name |
| 127232852 | CV1080981 | single nucleotide variant | NM_001036.6(RYR3):c.7287C>G (p.Ala2429=) | Epileptic encephalopathy [RCV001413653] | likely benign | 15 | 33731557 | 33731557 | Human | 2 | name |
| 127235921 | CV1080982 | single nucleotide variant | NM_001036.6(RYR3):c.7930C>T (p.Leu2644=) | Epileptic encephalopathy [RCV001391979] | likely benign | 15 | 33746098 | 33746098 | Human | 2 | name |
| 127232618 | CV1080983 | single nucleotide variant | NM_001036.6(RYR3):c.8043T>C (p.Ala2681=) | Epileptic encephalopathy [RCV001413540] | likely benign | 15 | 33748167 | 33748167 | Human | 2 | name |
| 127230657 | CV1080984 | single nucleotide variant | NM_001036.6(RYR3):c.8394T>G (p.Val2798=) | Epileptic encephalopathy [RCV001412593] | likely benign | 15 | 33750281 | 33750281 | Human | 2 | name |
| 127275793 | CV1080985 | single nucleotide variant | NM_001036.6(RYR3):c.8439G>A (p.Glu2813=) | Epileptic encephalopathy [RCV001406896] | likely benign | 15 | 33755104 | 33755104 | Human | 2 | name |
| 127239986 | CV1102792 | single nucleotide variant | NM_001036.6(RYR3):c.4233C>T (p.Ile1411=) | Epileptic encephalopathy [RCV001434110] | likely benign | 15 | 33652808 | 33652808 | Human | 2 | name |
| 127242007 | CV1102793 | single nucleotide variant | NM_001036.6(RYR3):c.4365T>G (p.Ser1455=) | Epileptic encephalopathy [RCV001434532] | likely benign | 15 | 33659776 | 33659776 | Human | 2 | name |
| 127263932 | CV1102794 | single nucleotide variant | NM_001036.6(RYR3):c.4398C>T (p.Asn1466=) | Epileptic encephalopathy [RCV001439463]|RYR3-related disorder [RCV003973294] | likely benign | 15 | 33660199 | 33660199 | Human | 3 | name , alternate_id |
| 127269134 | CV1102795 | single nucleotide variant | NM_001036.6(RYR3):c.4434A>G (p.Glu1478=) | Epileptic encephalopathy [RCV001440988] | likely benign | 15 | 33660235 | 33660235 | Human | 2 | name |
| 127280450 | CV1102796 | single nucleotide variant | NM_001036.6(RYR3):c.4701G>C (p.Ala1567=) | Epileptic encephalopathy [RCV001446446] | likely benign | 15 | 33662231 | 33662231 | Human | 2 | name |
| 127268834 | CV1102797 | single nucleotide variant | NM_001036.6(RYR3):c.5079G>A (p.Thr1693=) | Epileptic encephalopathy [RCV001430108] | likely benign | 15 | 33662609 | 33662609 | Human | 2 | name |
| 127280439 | CV1102798 | single nucleotide variant | NM_001036.6(RYR3):c.5637C>T (p.Asn1879=) | Epileptic encephalopathy [RCV001446440] | likely benign | 15 | 33669371 | 33669371 | Human | 2 | name |
| 127276267 | CV1102799 | single nucleotide variant | NM_001036.6(RYR3):c.5706C>T (p.Asp1902=) | Epileptic encephalopathy [RCV001443738] | likely benign | 15 | 33669440 | 33669440 | Human | 2 | name |
| 127256386 | CV1102801 | single nucleotide variant | NM_001036.6(RYR3):c.6612C>T (p.Phe2204=) | Epileptic encephalopathy [RCV001437679] | likely benign | 15 | 33707047 | 33707047 | Human | 2 | name |
| 127261492 | CV1102802 | single nucleotide variant | NM_001036.6(RYR3):c.7269G>C (p.Pro2423=) | Epileptic encephalopathy [RCV001428068] | likely benign | 15 | 33731539 | 33731539 | Human | 2 | name |
| 127248231 | CV1102803 | single nucleotide variant | NM_001036.6(RYR3):c.7602G>A (p.Glu2534=) | Epileptic encephalopathy [RCV001424889] | likely benign | 15 | 33738536 | 33738536 | Human | 2 | name |
| 127236812 | CV1102804 | single nucleotide variant | NM_001036.6(RYR3):c.7665C>T (p.Asp2555=) | Epileptic encephalopathy [RCV001422600]|not provided [RCV004706129] | likely benign | 15 | 33739840 | 33739840 | Human | 2 | name |
| 127273925 | CV1102805 | single nucleotide variant | NM_001036.6(RYR3):c.7782G>A (p.Ala2594=) | Epileptic encephalopathy [RCV001442747] | likely benign | 15 | 33739957 | 33739957 | Human | 2 | name |
| 127283143 | CV1102806 | single nucleotide variant | NM_001036.6(RYR3):c.7941T>C (p.Asn2647=) | Epileptic encephalopathy [RCV001448315] | likely benign | 15 | 33746109 | 33746109 | Human | 2 | name |
| 127240502 | CV1102809 | single nucleotide variant | NM_001036.6(RYR3):c.9468C>T (p.Ser3156=) | Epileptic encephalopathy [RCV001423354] | likely benign | 15 | 33785861 | 33785861 | Human | 2 | name |
| 127243914 | CV1102810 | single nucleotide variant | NM_001036.6(RYR3):c.9516C>T (p.Ile3172=) | Epileptic encephalopathy [RCV001434928] | likely benign | 15 | 33785909 | 33785909 | Human | 2 | name |
| 127280039 | CV1102811 | single nucleotide variant | NM_001036.6(RYR3):c.9630G>A (p.Leu3210=) | Epileptic encephalopathy [RCV001446180] | likely benign | 15 | 33788258 | 33788258 | Human | 2 | name |
| 127289434 | CV1124209 | single nucleotide variant | NM_001036.6(RYR3):c.3507C>T (p.Ile1169=) | Epileptic encephalopathy [RCV001450903] | likely benign | 15 | 33636501 | 33636501 | Human | 2 | name |
| 127310313 | CV1124210 | single nucleotide variant | NM_001036.6(RYR3):c.3516A>G (p.Lys1172=) | Epileptic encephalopathy [RCV001456585] | likely benign | 15 | 33636510 | 33636510 | Human | 2 | name |
| 127315010 | CV1124211 | single nucleotide variant | NM_001036.6(RYR3):c.3636T>C (p.Phe1212=) | Epileptic encephalopathy [RCV001457882] | likely benign | 15 | 33644390 | 33644390 | Human | 2 | name |
| 127327410 | CV1124212 | single nucleotide variant | NM_001036.6(RYR3):c.3966T>C (p.Ser1322=) | Epileptic encephalopathy [RCV001469072] | likely benign | 15 | 33647448 | 33647448 | Human | 2 | name |
| 127306564 | CV1124213 | single nucleotide variant | NM_001036.6(RYR3):c.4242C>T (p.Leu1414=) | Epileptic encephalopathy [RCV001455560] | likely benign | 15 | 33652817 | 33652817 | Human | 2 | name |
| 127306579 | CV1124214 | single nucleotide variant | NM_001036.6(RYR3):c.4674T>C (p.His1558=) | Epileptic encephalopathy [RCV001462811] | likely benign | 15 | 33662204 | 33662204 | Human | 2 | name |
| 127315386 | CV1124215 | single nucleotide variant | NM_001036.6(RYR3):c.4711C>T (p.Leu1571=) | Epileptic encephalopathy [RCV001465200] | likely benign | 15 | 33662241 | 33662241 | Human | 2 | name |
| 127314143 | CV1124216 | single nucleotide variant | NM_001036.6(RYR3):c.5859C>T (p.Pro1953=) | Epileptic encephalopathy [RCV001464871] | likely benign | 15 | 33670555 | 33670555 | Human | 2 | name |
| 127307042 | CV1124217 | single nucleotide variant | NM_001036.6(RYR3):c.5988G>T (p.Leu1996=) | Epileptic encephalopathy [RCV001462910] | likely benign | 15 | 33696345 | 33696345 | Human | 2 | name |
| 127307073 | CV1124219 | single nucleotide variant | NM_001036.6(RYR3):c.6261A>G (p.Pro2087=) | Epileptic encephalopathy [RCV001462918] | likely benign | 15 | 33699715 | 33699715 | Human | 2 | name |
| 127298490 | CV1124221 | single nucleotide variant | NM_001036.6(RYR3):c.7266C>A (p.Leu2422=) | Epileptic encephalopathy [RCV001453332] | likely benign | 15 | 33731536 | 33731536 | Human | 2 | name |
| 127334161 | CV1124223 | single nucleotide variant | NM_001036.6(RYR3):c.7905G>A (p.Gln2635=) | Epileptic encephalopathy [RCV001473422] | likely benign | 15 | 33746073 | 33746073 | Human | 2 | name |
| 127329712 | CV1124224 | single nucleotide variant | NM_001036.6(RYR3):c.8034C>G (p.Thr2678=) | Epileptic encephalopathy [RCV001470384] | likely benign | 15 | 33748158 | 33748158 | Human | 2 | name |
| 127335935 | CV1124225 | single nucleotide variant | NM_001036.6(RYR3):c.8067C>G (p.Thr2689=) | Epileptic encephalopathy [RCV001474621] | likely benign | 15 | 33748191 | 33748191 | Human | 2 | name |
| 127296909 | CV1124226 | single nucleotide variant | NM_001036.6(RYR3):c.8160C>T (p.Pro2720=) | Epileptic encephalopathy [RCV001460132] | likely benign | 15 | 33748491 | 33748491 | Human | 2 | name |
| 127332694 | CV1124227 | single nucleotide variant | NM_001036.6(RYR3):c.8265G>A (p.Leu2755=) | Epileptic encephalopathy [RCV001472402] | likely benign | 15 | 33750044 | 33750044 | Human | 2 | name |
| 127328125 | CV1124228 | single nucleotide variant | NM_001036.6(RYR3):c.8352A>C (p.Ala2784=) | Epileptic encephalopathy [RCV001469440] | likely benign | 15 | 33750239 | 33750239 | Human | 2 | name |
| 127314379 | CV1124229 | single nucleotide variant | NM_001036.6(RYR3):c.8658T>C (p.Leu2886=) | Epileptic encephalopathy [RCV001464941] | likely benign | 15 | 33757549 | 33757549 | Human | 2 | name |
| 127294081 | CV1124230 | single nucleotide variant | NM_001036.6(RYR3):c.8961T>G (p.Ser2987=) | Epileptic encephalopathy [RCV001476717] | likely benign | 15 | 33772064 | 33772064 | Human | 2 | name |
| 127291453 | CV1124231 | single nucleotide variant | NM_001036.6(RYR3):c.9021C>T (p.His3007=) | Epileptic encephalopathy [RCV001458741] | likely benign | 15 | 33772124 | 33772124 | Human | 2 | name |
| 127298256 | CV1124232 | single nucleotide variant | NM_001036.6(RYR3):c.9111G>A (p.Gly3037=) | Epileptic encephalopathy [RCV001477862] | likely benign | 15 | 33773589 | 33773589 | Human | 2 | name |
| 127306450 | CV1124233 | single nucleotide variant | NM_001036.6(RYR3):c.9345C>T (p.Asn3115=) | Epileptic encephalopathy [RCV001455524] | likely benign | 15 | 33785738 | 33785738 | Human | 2 | name |
| 127289124 | CV1124234 | single nucleotide variant | NM_001036.6(RYR3):c.9393C>T (p.Ile3131=) | Epileptic encephalopathy [RCV001450795] | likely benign | 15 | 33785786 | 33785786 | Human | 2 | name |
| 127289170 | CV1124235 | single nucleotide variant | NM_001036.6(RYR3):c.9714C>T (p.Ala3238=) | Epileptic encephalopathy [RCV001450811] | likely benign | 15 | 33788342 | 33788342 | Human | 2 | name |
| 127318925 | CV1124236 | single nucleotide variant | NM_001036.6(RYR3):c.9810C>T (p.Ile3270=) | Epileptic encephalopathy [RCV001466402] | likely benign | 15 | 33788438 | 33788438 | Human | 2 | name |
| 127295565 | CV1124237 | single nucleotide variant | NM_001036.6(RYR3):c.9969T>C (p.Asn3323=) | Epileptic encephalopathy [RCV001477122]|not provided [RCV004704601] | likely benign | 15 | 33801919 | 33801919 | Human | 2 | name |
| 127295032 | CV1145071 | single nucleotide variant | NM_001036.6(RYR3):c.3312G>A (p.Ala1104=) | Epileptic encephalopathy [RCV001497150] | likely benign | 15 | 33635750 | 33635750 | Human | 2 | name |
| 127312732 | CV1145073 | single nucleotide variant | NM_001036.6(RYR3):c.4242C>G (p.Leu1414=) | Epileptic encephalopathy [RCV001501999] | likely benign | 15 | 33652817 | 33652817 | Human | 2 | name |
| 127308101 | CV1145074 | single nucleotide variant | NM_001036.6(RYR3):c.4245G>T (p.Val1415=) | Epileptic encephalopathy [RCV001480509] | likely benign | 15 | 33652820 | 33652820 | Human | 2 | name |
| 127320215 | CV1145075 | single nucleotide variant | NM_001036.6(RYR3):c.4413A>T (p.Ser1471=) | Epileptic encephalopathy [RCV001484097] | likely benign | 15 | 33660214 | 33660214 | Human | 2 | name |
| 127333169 | CV1145076 | single nucleotide variant | NM_001036.6(RYR3):c.4452A>G (p.Pro1484=) | Epileptic encephalopathy [RCV001489978] | likely benign | 15 | 33660253 | 33660253 | Human | 2 | name |
| 127315926 | CV1145077 | single nucleotide variant | NM_001036.6(RYR3):c.4707C>T (p.Cys1569=) | Epileptic encephalopathy [RCV001502871] | likely benign | 15 | 33662237 | 33662237 | Human | 2 | name |
| 127318155 | CV1145078 | single nucleotide variant | NM_001036.6(RYR3):c.4941C>G (p.Ser1647=) | Epileptic encephalopathy [RCV001483424] | likely benign | 15 | 33662471 | 33662471 | Human | 2 | name |
| 127322741 | CV1145079 | single nucleotide variant | NM_001036.6(RYR3):c.5184C>T (p.Leu1728=) | Epileptic encephalopathy [RCV001505209] | likely benign | 15 | 33662714 | 33662714 | Human | 2 | name |
| 127310862 | CV1145080 | single nucleotide variant | NM_001036.6(RYR3):c.5355C>A (p.Ala1785=) | Epileptic encephalopathy [RCV001501476]|not provided [RCV003399259] | likely benign | 15 | 33662885 | 33662885 | Human | 2 | name |
| 127334354 | CV1145081 | single nucleotide variant | NM_001036.6(RYR3):c.5364G>A (p.Glu1788=) | Epileptic encephalopathy [RCV001490775] | likely benign | 15 | 33662894 | 33662894 | Human | 2 | name |
| 127289925 | CV1145083 | single nucleotide variant | NM_001036.6(RYR3):c.5445C>T (p.Cys1815=) | Epileptic encephalopathy [RCV001495823] | likely benign | 15 | 33663563 | 33663563 | Human | 2 | name |
| 127338085 | CV1145085 | single nucleotide variant | NM_001036.6(RYR3):c.5907G>A (p.Gln1969=) | Epileptic encephalopathy [RCV001493518] | likely benign | 15 | 33696264 | 33696264 | Human | 2 | name |
| 127293464 | CV1145086 | single nucleotide variant | NM_001036.6(RYR3):c.6129G>T (p.Gly2043=) | Epileptic encephalopathy [RCV001496791] | likely benign | 15 | 33696486 | 33696486 | Human | 2 | name |
| 127331654 | CV1145087 | single nucleotide variant | NM_001036.6(RYR3):c.6387G>A (p.Pro2129=) | Epileptic encephalopathy [RCV001488979] | likely benign | 15 | 33700984 | 33700984 | Human | 2 | name |
| 127303287 | CV1145088 | single nucleotide variant | NM_001036.6(RYR3):c.6765G>A (p.Ala2255=) | Epileptic encephalopathy [RCV001479214] | likely benign | 15 | 33722860 | 33722860 | Human | 2 | name |
| 127337780 | CV1145089 | single nucleotide variant | NM_001036.6(RYR3):c.6972C>A (p.Val2324=) | Epileptic encephalopathy [RCV001493068] | likely benign | 15 | 33726445 | 33726445 | Human | 2 | name |
| 127327065 | CV1145090 | single nucleotide variant | NM_001036.6(RYR3):c.7008C>T (p.Pro2336=) | Epileptic encephalopathy [RCV001486210] | likely benign | 15 | 33726481 | 33726481 | Human | 2 | name |
| 127309814 | CV1145092 | single nucleotide variant | NM_001036.6(RYR3):c.7245G>A (p.Arg2415=) | Epileptic encephalopathy [RCV001480992] | likely benign | 15 | 33731515 | 33731515 | Human | 2 | name |
| 127331029 | CV1145094 | single nucleotide variant | NM_001036.6(RYR3):c.8640A>G (p.Ser2880=) | Epileptic encephalopathy [RCV001488557] | likely benign | 15 | 33757531 | 33757531 | Human | 2 | name |
| 127301712 | CV1145095 | single nucleotide variant | NM_001036.6(RYR3):c.8928C>T (p.Phe2976=) | Epileptic encephalopathy [RCV001498925] | likely benign | 15 | 33772031 | 33772031 | Human | 2 | name |
| 127304538 | CV1145096 | single nucleotide variant | NM_001036.6(RYR3):c.9558C>T (p.Ile3186=) | Epileptic encephalopathy [RCV001479526] | likely benign | 15 | 33785951 | 33785951 | Human | 2 | name |
| 127330888 | CV1145097 | single nucleotide variant | NM_001036.6(RYR3):c.9708G>A (p.Leu3236=) | Epileptic encephalopathy [RCV001488437] | likely benign | 15 | 33788336 | 33788336 | Human | 2 | name |
| 127304755 | CV1157421 | single nucleotide variant | NM_001036.6(RYR3):c.6717G>A (p.Gly2239=) | Epileptic encephalopathy [RCV001516025]|not provided [RCV001655754] | benign | 15 | 33722812 | 33722812 | Human | 2 | name |
| 127319674 | CV1157423 | single nucleotide variant | NM_001036.6(RYR3):c.7755G>A (p.Thr2585=) | Epileptic encephalopathy [RCV001522234]|not provided [RCV004715471] | benign | 15 | 33739930 | 33739930 | Human | 2 | name |
| 127304003 | CV1157429 | microsatellite | NM_001036.6(RYR3):c.14142+27_14142+46del | Epileptic encephalopathy [RCV001515702] | benign | 15 | 33857920 | 33857939 | Human | | name |
| 151663642 | CV1334108 | single nucleotide variant | NM_001036.6(RYR3):c.949G>A (p.Ala317Thr) | RYR3-related Epileptic encephalopathy [RCV001839282]|not specified [RCV004041042] | uncertain significance | 15 | 33550293 | 33550293 | Human | 1 | name |
| 151761114 | CV1349538 | single nucleotide variant | NM_001036.6(RYR3):c.809G>A (p.Arg270Gln) | Epileptic encephalopathy [RCV001949152] | uncertain significance | 15 | 33548198 | 33548198 | Human | 2 | name |
| 152126049 | CV1532432 | single nucleotide variant | NM_001036.6(RYR3):c.9288G>A (p.Thr3096=) | Epileptic encephalopathy [RCV002118466] | likely benign | 15 | 33785681 | 33785681 | Human | 2 | name |
| 152026804 | CV1540316 | single nucleotide variant | NM_001036.6(RYR3):c.8142C>T (p.Asn2714=) | Epileptic encephalopathy [RCV002104679] | likely benign | 15 | 33748473 | 33748473 | Human | 2 | name |
| 152137232 | CV1563358 | single nucleotide variant | NM_001036.6(RYR3):c.3141C>T (p.Tyr1047=) | Epileptic encephalopathy [RCV002200107] | likely benign | 15 | 33634699 | 33634699 | Human | 2 | name |
| 152058837 | CV1569406 | single nucleotide variant | NM_001036.6(RYR3):c.5118C>T (p.Ser1706=) | Epileptic encephalopathy [RCV002109870] | likely benign | 15 | 33662648 | 33662648 | Human | 2 | name |
| 152107850 | CV1579624 | single nucleotide variant | NM_001036.6(RYR3):c.8997C>A (p.Pro2999=) | Epileptic encephalopathy [RCV002173952] | likely benign | 15 | 33772100 | 33772100 | Human | 2 | name |
| 152175941 | CV1580209 | single nucleotide variant | NM_001036.6(RYR3):c.6552T>C (p.Asp2184=) | Epileptic encephalopathy [RCV002164079] | likely benign | 15 | 33706987 | 33706987 | Human | 2 | name |
| 152068134 | CV1588977 | single nucleotide variant | NM_001036.6(RYR3):c.3702T>C (p.Ala1234=) | Epileptic encephalopathy [RCV002209623] | likely benign | 15 | 33644456 | 33644456 | Human | 2 | name |
| 152040153 | CV1608867 | single nucleotide variant | NM_001036.6(RYR3):c.4992G>C (p.Gly1664=) | Epileptic encephalopathy [RCV002107619] | likely benign | 15 | 33662522 | 33662522 | Human | 2 | name |
| 152040217 | CV1640026 | single nucleotide variant | NM_001036.6(RYR3):c.3291A>G (p.Gly1097=) | Epileptic encephalopathy [RCV002087849] | likely benign | 15 | 33635729 | 33635729 | Human | 2 | name |
| 156096496 | CV2106518 | single nucleotide variant | NM_001036.6(RYR3):c.4734C>T (p.Tyr1578=) | Epileptic encephalopathy [RCV002952570] | likely benign | 15 | 33662264 | 33662264 | Human | 2 | name |
| 156048700 | CV2304448 | single nucleotide variant | NM_001036.6(RYR3):c.835A>G (p.Arg279Gly) | not specified [RCV004164543] | uncertain significance | 15 | 33550179 | 33550179 | Human | | name |
| 401863178 | CV2771981 | single nucleotide variant | NM_001036.6(RYR3):c.910A>G (p.Ile304Val) | not specified [RCV004344667] | uncertain significance | 15 | 33550254 | 33550254 | Human | | name |
| 401916044 | CV2817383 | single nucleotide variant | NM_001036.6(RYR3):c.5076G>A (p.Arg1692=) | not provided [RCV003400845] | likely benign | 15 | 33662606 | 33662606 | Human | | name |
| 401916047 | CV2817384 | single nucleotide variant | NM_001036.6(RYR3):c.7272C>T (p.Leu2424=) | not provided [RCV003400846] | likely benign | 15 | 33731542 | 33731542 | Human | | name |
| 405049276 | CV2856965 | single nucleotide variant | NM_001036.6(RYR3):c.7839A>G (p.Lys2613=) | Epileptic encephalopathy [RCV003592596]|RYR3-related disorder [RCV003966460] | likely benign | 15 | 33742384 | 33742384 | Human | 3 | name , alternate_id |
| 405269827 | CV3187503 | single nucleotide variant | NM_001036.6(RYR3):c.773C>T (p.Thr258Ile) | not provided [RCV003887587] | uncertain significance | 15 | 33548162 | 33548162 | Human | | name |
| 405286609 | CV3192249 | single nucleotide variant | NM_001036.6(RYR3):c.4491C>T (p.Pro1497=) | RYR3-related disorder [RCV003924151] | likely benign | 15 | 33660292 | 33660292 | Human | | name , trait , alternate_id |
| 405271555 | CV3202901 | single nucleotide variant | NM_001036.6(RYR3):c.4986G>A (p.Lys1662=) | RYR3-related disorder [RCV003913962] | likely benign | 15 | 33662516 | 33662516 | Human | | name , trait , alternate_id |
| 405271828 | CV3206296 | single nucleotide variant | NM_001036.6(RYR3):c.4626T>C (p.Cys1542=) | RYR3-related disorder [RCV003971928] | likely benign | 15 | 33662156 | 33662156 | Human | | name , trait , alternate_id |
| 405266163 | CV3215810 | single nucleotide variant | NM_001036.6(RYR3):c.3561C>T (p.Phe1187=) | RYR3-related disorder [RCV003946958] | likely benign | 15 | 33644315 | 33644315 | Human | | name , trait , alternate_id |
| 405701845 | CV3310129 | single nucleotide variant | NM_001036.6(RYR3):c.392A>G (p.Asp131Gly) | not specified [RCV004447207] | uncertain significance | 15 | 33533348 | 33533348 | Human | | name |
| 405701951 | CV3310145 | single nucleotide variant | NM_001036.6(RYR3):c.981G>C (p.Lys327Asn) | not specified [RCV004447223] | uncertain significance | 15 | 33562845 | 33562845 | Human | | name |
| 407514362 | CV3473312 | single nucleotide variant | NM_001036.6(RYR3):c.425A>G (p.His142Arg) | not specified [RCV004674406] | uncertain significance | 15 | 33533381 | 33533381 | Human | | name |
| 407514348 | CV3473332 | single nucleotide variant | NM_001036.6(RYR3):c.754G>A (p.Glu252Lys) | not specified [RCV004674413] | uncertain significance | 15 | 33548143 | 33548143 | Human | | name |
| 407476011 | CV3494827 | single nucleotide variant | NM_001036.6(RYR3):c.8154T>G (p.Pro2718=) | not specified [RCV004690728] | likely benign | 15 | 33748485 | 33748485 | Human | | name |
| 597734462 | CV3597842 | single nucleotide variant | NM_001036.6(RYR3):c.751T>G (p.Tyr251Asp) | not specified [RCV004863484] | uncertain significance | 15 | 33548140 | 33548140 | Human | | name |
| 12834021 | CV373366 | single nucleotide variant | NM_001036.6(RYR3):c.4296C>T (p.Gly1432=) | Epileptic encephalopathy [RCV000951367]|RYR3-related disorder [RCV003902509]|not provided [RCV004705544]|not specified [RCV000419607] | benign|likely benign | 15 | 33652871 | 33652871 | Human | 3 | name , alternate_id |
| 598207405 | CV3910203 | single nucleotide variant | NM_001036.6(RYR3):c.501T>G (p.Ile167Met) | not specified [RCV005270038] | uncertain significance | 15 | 33539417 | 33539417 | Human | | name |
| 598207438 | CV3910207 | single nucleotide variant | NM_001036.6(RYR3):c.764G>A (p.Gly255Glu) | not specified [RCV005270042] | uncertain significance | 15 | 33548153 | 33548153 | Human | | name |
| 13492779 | CV464012 | single nucleotide variant | NM_001036.6(RYR3):c.4473C>T (p.Asp1491=) | Epileptic encephalopathy [RCV000557697]|not provided [RCV003403278] | benign|likely benign | 15 | 33660274 | 33660274 | Human | 2 | name |
| 13499339 | CV464029 | single nucleotide variant | NM_001036.6(RYR3):c.4701G>A (p.Ala1567=) | Epileptic encephalopathy [RCV000539774]|RYR3-related disorder [RCV003935435]|not provided [RCV003403279] | benign|likely benign | 15 | 33662231 | 33662231 | Human | 3 | name , alternate_id |
| 13475947 | CV464040 | single nucleotide variant | NM_001036.6(RYR3):c.5959C>A (p.Arg1987=) | Epileptic encephalopathy [RCV000548951] | benign | 15 | 33696316 | 33696316 | Human | 2 | name |
| 13503868 | CV464045 | single nucleotide variant | NM_001036.6(RYR3):c.6624G>A (p.Glu2208=) | Epileptic encephalopathy [RCV000547947] | likely benign | 15 | 33722719 | 33722719 | Human | 2 | name |
| 13502006 | CV464050 | single nucleotide variant | NM_001036.6(RYR3):c.6708G>A (p.Gly2236=) | Epileptic encephalopathy [RCV000541534] | likely benign | 15 | 33722803 | 33722803 | Human | 2 | name |
| 13488916 | CV464052 | single nucleotide variant | NM_001036.6(RYR3):c.7062G>A (p.Ala2354=) | Epileptic encephalopathy [RCV000532635]|not provided [RCV004715275] | benign | 15 | 33728885 | 33728885 | Human | 2 | name |
| 13470959 | CV464064 | single nucleotide variant | NM_001036.6(RYR3):c.7467C>T (p.Leu2489=) | Epileptic encephalopathy [RCV000546540] | likely benign | 15 | 33736277 | 33736277 | Human | 2 | name |
| 13491964 | CV464066 | single nucleotide variant | NM_001036.6(RYR3):c.7749A>G (p.Thr2583=) | Epileptic encephalopathy [RCV000534593] | likely benign | 15 | 33739924 | 33739924 | Human | 2 | name |
| 13496006 | CV464076 | single nucleotide variant | NM_001036.6(RYR3):c.9759C>T (p.Asp3253=) | Epileptic encephalopathy [RCV000560049]|not provided [RCV002275067] | benign|likely benign | 15 | 33788387 | 33788387 | Human | 2 | name |
| 13467664 | CV464081 | single nucleotide variant | NM_001036.6(RYR3):c.9816C>T (p.Tyr3272=) | Epileptic encephalopathy [RCV000544048]|RYR3-related disorder [RCV003915533]|not provided [RCV004715280] | benign | 15 | 33788444 | 33788444 | Human | 3 | name , alternate_id |
| 13486352 | CV464564 | single nucleotide variant | NM_001036.6(RYR3):c.923G>A (p.Arg308Gln) | Epileptic encephalopathy [RCV000553691]|not specified [RCV004023880] | conflicting interpretations of pathogenicity|uncertain significance | 15 | 33550267 | 33550267 | Human | 2 | name |
| 13469338 | CV464609 | single nucleotide variant | NM_001036.6(RYR3):c.5484A>G (p.Ala1828=) | Epileptic encephalopathy [RCV000545200]|not provided [RCV003403280] | benign|likely benign | 15 | 33663602 | 33663602 | Human | 2 | name |
| 13499042 | CV464616 | single nucleotide variant | NM_001036.6(RYR3):c.6960G>C (p.Leu2320=) | Epileptic encephalopathy [RCV000539576]|RYR3-related disorder [RCV003905365] | benign | 15 | 33726433 | 33726433 | Human | 3 | name , alternate_id |
| 13471496 | CV464621 | single nucleotide variant | NM_001036.6(RYR3):c.7581C>T (p.Tyr2527=) | Epileptic encephalopathy [RCV000546889]|RYR3-related disorder [RCV003905366]|not provided [RCV004716535] | benign | 15 | 33738515 | 33738515 | Human | 3 | name , alternate_id |
| 13481475 | CV464623 | single nucleotide variant | NM_001036.6(RYR3):c.7719G>A (p.Leu2573=) | Epileptic encephalopathy [RCV000528985] | likely benign | 15 | 33739894 | 33739894 | Human | 2 | name |
| 13502223 | CV464629 | single nucleotide variant | NM_001036.6(RYR3):c.7848C>T (p.Tyr2616=) | Epileptic encephalopathy [RCV000541775]|not provided [RCV004704065] | likely benign | 15 | 33742393 | 33742393 | Human | 2 | name |
| 13497384 | CV464640 | single nucleotide variant | NM_001036.6(RYR3):c.9006G>A (p.Thr3002=) | Epileptic encephalopathy [RCV000538572] | likely benign | 15 | 33772109 | 33772109 | Human | 2 | name |
| 13495901 | CV464657 | single nucleotide variant | NM_001036.6(RYR3):c.9873C>G (p.Leu3291=) | Epileptic encephalopathy [RCV000537467]|RYR3-related disorder [RCV003925625]|not provided [RCV003403282] | benign|likely benign | 15 | 33800812 | 33800812 | Human | 3 | name , alternate_id |
| 13486255 | CV464816 | single nucleotide variant | NM_001036.6(RYR3):c.349G>A (p.Gly117Arg) | Epileptic encephalopathy [RCV000531164] | uncertain significance | 15 | 33530661 | 33530661 | Human | 2 | name |
| 13486354 | CV464821 | single nucleotide variant | NM_001036.6(RYR3):c.938C>A (p.Thr313Asn) | Epileptic encephalopathy [RCV000531223] | uncertain significance | 15 | 33550282 | 33550282 | Human | 2 | name |
| 13479790 | CV464845 | single nucleotide variant | NM_001036.6(RYR3):c.4821T>C (p.Tyr1607=) | Epileptic encephalopathy [RCV000528253]|not provided [RCV003409786] | benign|likely benign | 15 | 33662351 | 33662351 | Human | 2 | name |
| 13492186 | CV464850 | single nucleotide variant | NM_001036.6(RYR3):c.5406C>T (p.Ser1802=) | Epileptic encephalopathy [RCV000557249] | likely benign | 15 | 33662936 | 33662936 | Human | 2 | name |
| 13494661 | CV464855 | single nucleotide variant | NM_001036.6(RYR3):c.5982G>A (p.Gly1994=) | Epileptic encephalopathy [RCV000559069]|RYR3-related disorder [RCV003960292] | likely benign | 15 | 33696339 | 33696339 | Human | 3 | name , alternate_id |
| 13478239 | CV464859 | single nucleotide variant | NM_001036.6(RYR3):c.6444T>C (p.Asn2148=) | Epileptic encephalopathy [RCV000527538]|not provided [RCV004715274] | benign | 15 | 33701041 | 33701041 | Human | 2 | name |
| 13491897 | CV464864 | single nucleotide variant | NM_001036.6(RYR3):c.7632G>T (p.Gly2544=) | Epileptic encephalopathy [RCV000557053]|not provided [RCV004715277] | benign | 15 | 33738566 | 33738566 | Human | 2 | name |
| 13465329 | CV464873 | single nucleotide variant | NM_001036.6(RYR3):c.7089A>T (p.Ala2363=) | Epileptic encephalopathy [RCV000542759] | likely benign | 15 | 33728912 | 33728912 | Human | 2 | name |
| 13504311 | CV464878 | single nucleotide variant | NM_001036.6(RYR3):c.7827C>G (p.Ser2609=) | Epileptic encephalopathy [RCV000527039]|RYR3-related disorder [RCV003925622]|not provided [RCV003409787] | benign|likely benign | 15 | 33742372 | 33742372 | Human | 3 | name , alternate_id |
| 13494073 | CV464888 | single nucleotide variant | NM_001036.6(RYR3):c.8703C>T (p.Ala2901=) | Epileptic encephalopathy [RCV000536127]|not provided [RCV003884606] | likely benign | 15 | 33757594 | 33757594 | Human | 2 | name |
| 13483199 | CV464889 | single nucleotide variant | NM_001036.6(RYR3):c.8481C>T (p.Tyr2827=) | Epileptic encephalopathy [RCV000529748]|RYR3-related disorder [RCV003962494]|not provided [RCV002263764] | benign|likely benign | 15 | 33755146 | 33755146 | Human | 3 | name , alternate_id |
| 13480179 | CV464891 | single nucleotide variant | NM_001036.6(RYR3):c.8997C>T (p.Pro2999=) | Epileptic encephalopathy [RCV000528415]|not provided [RCV001675916] | benign | 15 | 33772100 | 33772100 | Human | 2 | name |
| 13480212 | CV464897 | single nucleotide variant | NM_001036.6(RYR3):c.8724C>T (p.Ala2908=) | Epileptic encephalopathy [RCV000550866]|RYR3-related disorder [RCV003925623] | likely benign | 15 | 33768676 | 33768676 | Human | 3 | name , alternate_id |
| 13497922 | CV464898 | single nucleotide variant | NM_001036.6(RYR3):c.9225T>C (p.Asn3075=) | Epileptic encephalopathy [RCV001409496] | likely benign | 15 | 33780298 | 33780298 | Human | 2 | name |
| 13611222 | CV514668 | single nucleotide variant | NM_001036.6(RYR3):c.775C>T (p.Arg259Ter) | not provided [RCV000627383] | uncertain significance | 15 | 33548164 | 33548164 | Human | | name |
| 13605697 | CV528626 | single nucleotide variant | NM_001036.6(RYR3):c.766G>A (p.Ala256Thr) | Epileptic encephalopathy [RCV000637107] | uncertain significance | 15 | 33548155 | 33548155 | Human | 2 | name |
| 13605822 | CV528630 | single nucleotide variant | NM_001036.6(RYR3):c.3609C>T (p.Leu1203=) | Epileptic encephalopathy [RCV000637233]|RYR3-related disorder [RCV003937918] | likely benign | 15 | 33644363 | 33644363 | Human | 3 | name , alternate_id |
| 13605782 | CV528636 | single nucleotide variant | NM_001036.6(RYR3):c.5355C>T (p.Ala1785=) | Epileptic encephalopathy [RCV001396194] | likely benign | 15 | 33662885 | 33662885 | Human | 2 | name |
| 13605850 | CV528641 | single nucleotide variant | NM_001036.6(RYR3):c.4611C>T (p.Pro1537=) | Epileptic encephalopathy [RCV000637261]|not provided [RCV004715321] | benign | 15 | 33660412 | 33660412 | Human | 2 | name |
| 13605785 | CV528649 | single nucleotide variant | NM_001036.6(RYR3):c.7689G>A (p.Leu2563=) | Epileptic encephalopathy [RCV000637204]|not provided [RCV004716597] | benign | 15 | 33739864 | 33739864 | Human | 2 | name |
| 13605823 | CV528655 | single nucleotide variant | NM_001036.6(RYR3):c.6684C>T (p.Phe2228=) | Epileptic encephalopathy [RCV000637234] | likely benign | 15 | 33722779 | 33722779 | Human | 2 | name |
| 13605860 | CV528657 | single nucleotide variant | NM_001036.6(RYR3):c.8667C>T (p.Ser2889=) | Epileptic encephalopathy [RCV001495308] | likely benign | 15 | 33757558 | 33757558 | Human | 2 | name |
| 13605838 | CV528676 | single nucleotide variant | NM_001036.6(RYR3):c.8016G>A (p.Ala2672=) | Epileptic encephalopathy [RCV000637249]|not provided [RCV003403466] | likely benign | 15 | 33748140 | 33748140 | Human | 2 | name |
| 13605789 | CV528697 | single nucleotide variant | NM_001036.6(RYR3):c.8748C>T (p.Ser2916=) | Epileptic encephalopathy [RCV000637200] | likely benign | 15 | 33768700 | 33768700 | Human | 2 | name |
| 13605703 | CV529002 | single nucleotide variant | NM_001036.6(RYR3):c.418C>T (p.Arg140Trp) | Epileptic encephalopathy [RCV000637113] | uncertain significance | 15 | 33533374 | 33533374 | Human | 2 | name |
| 13605830 | CV529006 | single nucleotide variant | NM_001036.6(RYR3):c.4380A>G (p.Glu1460=) | Epileptic encephalopathy [RCV000637242] | likely benign | 15 | 33659791 | 33659791 | Human | 2 | name |
| 13605834 | CV529010 | single nucleotide variant | NM_001036.6(RYR3):c.4468C>T (p.Leu1490=) | Epileptic encephalopathy [RCV000637246]|not provided [RCV004716598] | benign | 15 | 33660269 | 33660269 | Human | 2 | name |
| 13605780 | CV529017 | single nucleotide variant | NM_001036.6(RYR3):c.5256C>G (p.Pro1752=) | Epileptic encephalopathy [RCV000637209] | likely benign | 15 | 33662786 | 33662786 | Human | 2 | name |
| 13605724 | CV529029 | single nucleotide variant | NM_001036.6(RYR3):c.5568G>A (p.Ala1856=) | Epileptic encephalopathy [RCV000637134]|RYR3-related disorder [RCV003980234] | likely benign|uncertain significance | 15 | 33663686 | 33663686 | Human | 3 | name , alternate_id |
| 13605770 | CV529031 | single nucleotide variant | NM_001036.6(RYR3):c.5802C>A (p.Ile1934=) | Epileptic encephalopathy [RCV001443557] | likely benign | 15 | 33670498 | 33670498 | Human | 2 | name |
| 13605797 | CV529034 | single nucleotide variant | NM_001036.6(RYR3):c.5997G>A (p.Ala1999=) | Epileptic encephalopathy [RCV000637192] | likely benign | 15 | 33696354 | 33696354 | Human | 2 | name |
| 13605892 | CV529055 | single nucleotide variant | NM_001036.6(RYR3):c.8943G>A (p.Thr2981=) | Epileptic encephalopathy [RCV000637274] | likely benign | 15 | 33772046 | 33772046 | Human | 2 | name |
| 13605783 | CV529063 | single nucleotide variant | NM_001036.6(RYR3):c.9354C>T (p.Ala3118=) | Epileptic encephalopathy [RCV000637206] | likely benign | 15 | 33785747 | 33785747 | Human | 2 | name |
| 13605828 | CV529073 | single nucleotide variant | NM_001036.6(RYR3):c.725A>G (p.Asn242Ser) | Epileptic encephalopathy [RCV000637240] | likely benign | 15 | 33543700 | 33543700 | Human | 2 | name |
| 13605688 | CV529082 | single nucleotide variant | NM_001036.6(RYR3):c.991G>A (p.Asp331Asn) | Epileptic encephalopathy [RCV000637098] | uncertain significance | 15 | 33562855 | 33562855 | Human | 2 | name |
| 13605837 | CV529107 | single nucleotide variant | NM_001036.6(RYR3):c.3954A>G (p.Gln1318=) | Epileptic encephalopathy [RCV000637248]|not provided [RCV004704150] | likely benign | 15 | 33647436 | 33647436 | Human | 2 | name |
| 13605889 | CV529177 | single nucleotide variant | NM_001036.6(RYR3):c.8865A>C (p.Ala2955=) | Epileptic encephalopathy [RCV000637271] | likely benign | 15 | 33771968 | 33771968 | Human | 2 | name |
| 13811747 | CV566933 | single nucleotide variant | NM_001036.6(RYR3):c.4416G>A (p.Ala1472=) | Epileptic encephalopathy [RCV000688963] | likely benign|uncertain significance | 15 | 33660217 | 33660217 | Human | 2 | name |
| 13811945 | CV568644 | single nucleotide variant | NM_001036.6(RYR3):c.962G>A (p.Arg321Gln) | Epileptic encephalopathy [RCV000703377]|not specified [RCV005268729] | uncertain significance | 15 | 33550306 | 33550306 | Human | 2 | name |
| 13816006 | CV568689 | single nucleotide variant | NM_001036.6(RYR3):c.8706C>A (p.Gly2902=) | Epileptic encephalopathy [RCV000706076] | uncertain significance | 15 | 33768658 | 33768658 | Human | 2 | name |
| 13817334 | CV569238 | single nucleotide variant | NM_001036.6(RYR3):c.592A>G (p.Met198Val) | Epileptic encephalopathy [RCV000706951]|not provided [RCV001836869] | uncertain significance | 15 | 33540836 | 33540836 | Human | 2 | name |
| 13803446 | CV569244 | single nucleotide variant | NM_001036.6(RYR3):c.720C>A (p.Asp240Glu) | Epileptic encephalopathy [RCV000699249] | uncertain significance | 15 | 33543695 | 33543695 | Human | 2 | name |
| 13815721 | CV573146 | single nucleotide variant | NM_001036.6(RYR3):c.808C>T (p.Arg270Trp) | Epileptic encephalopathy [RCV000705885] | uncertain significance | 15 | 33548197 | 33548197 | Human | 2 | name |
| 13816665 | CV573147 | single nucleotide variant | NM_001036.6(RYR3):c.961C>T (p.Arg321Trp) | Epileptic encephalopathy [RCV000692476] | uncertain significance | 15 | 33550305 | 33550305 | Human | 2 | name |
| 14724943 | CV643013 | single nucleotide variant | NM_001036.6(RYR3):c.526G>A (p.Val176Met) | Epileptic encephalopathy [RCV000814991] | uncertain significance | 15 | 33539442 | 33539442 | Human | 2 | name |
| 14724725 | CV643014 | single nucleotide variant | NM_001036.6(RYR3):c.556G>A (p.Val186Ile) | Epileptic encephalopathy [RCV000814898]|RYR3-related Epileptic encephalopathy [RCV004799240] | uncertain significance | 15 | 33540800 | 33540800 | Human | 3 | name |
| 14706488 | CV643015 | single nucleotide variant | NM_001036.6(RYR3):c.697T>C (p.Cys233Arg) | Epileptic encephalopathy [RCV000792016] | uncertain significance | 15 | 33543672 | 33543672 | Human | 2 | name |
| 14725552 | CV643016 | single nucleotide variant | NM_001036.6(RYR3):c.776G>A (p.Arg259Gln) | Epileptic encephalopathy [RCV000815246]|not specified [RCV004857735] | uncertain significance | 15 | 33548165 | 33548165 | Human | 2 | name |
| 14708597 | CV643017 | single nucleotide variant | NM_001036.6(RYR3):c.926C>T (p.Ala309Val) | Epileptic encephalopathy [RCV000792647] | uncertain significance | 15 | 33550270 | 33550270 | Human | 2 | name |
| 14726300 | CV643018 | single nucleotide variant | NM_001036.6(RYR3):c.940A>G (p.Lys314Glu) | Epileptic encephalopathy [RCV000799148] | uncertain significance | 15 | 33550284 | 33550284 | Human | 2 | name |
| 14731102 | CV643045 | single nucleotide variant | NM_001036.6(RYR3):c.5358C>T (p.Gly1786=) | Epileptic encephalopathy [RCV000817685] | likely benign|uncertain significance | 15 | 33662888 | 33662888 | Human | 2 | name |
| 14726966 | CV643057 | single nucleotide variant | NM_001036.6(RYR3):c.6912C>T (p.His2304=) | Epileptic encephalopathy [RCV000815865] | uncertain significance | 15 | 33724176 | 33724176 | Human | 2 | name |
| 14716000 | CV643060 | single nucleotide variant | NM_001036.6(RYR3):c.7041G>A (p.Ser2347=) | Epileptic encephalopathy [RCV000794980] | likely benign|uncertain significance | 15 | 33728864 | 33728864 | Human | 2 | name |
| 15142510 | CV693652 | single nucleotide variant | NM_001036.6(RYR3):c.4521C>T (p.Phe1507=) | Epileptic encephalopathy [RCV000877882]|RYR3-related disorder [RCV003938383]|not provided [RCV004726720] | benign|likely benign | 15 | 33660322 | 33660322 | Human | 3 | name , alternate_id |
| 15145074 | CV693653 | single nucleotide variant | NM_001036.6(RYR3):c.9297C>T (p.Asp3099=) | Epileptic encephalopathy [RCV000878322]|RYR3-related disorder [RCV003908361]|not provided [RCV004705861] | likely benign | 15 | 33785690 | 33785690 | Human | 3 | name , alternate_id |
| 15184114 | CV703126 | single nucleotide variant | NM_001036.6(RYR3):c.3480C>T (p.Ile1160=) | Epileptic encephalopathy [RCV000952627] | likely benign | 15 | 33636474 | 33636474 | Human | 2 | name |
| 15180596 | CV703127 | single nucleotide variant | NM_001036.6(RYR3):c.3627C>G (p.Thr1209=) | Epileptic encephalopathy [RCV002547223] | likely benign | 15 | 33644381 | 33644381 | Human | 2 | name |
| 15179388 | CV703128 | single nucleotide variant | NM_001036.6(RYR3):c.3816G>A (p.Thr1272=) | Epileptic encephalopathy [RCV001505364] | likely benign | 15 | 33646401 | 33646401 | Human | 2 | name |
| 15154811 | CV703129 | single nucleotide variant | NM_001036.6(RYR3):c.4971G>A (p.Leu1657=) | Epileptic encephalopathy [RCV000946364]|not provided [RCV004716637] | benign | 15 | 33662501 | 33662501 | Human | 2 | name |
| 15190104 | CV703130 | single nucleotide variant | NM_001036.6(RYR3):c.5148G>A (p.Gly1716=) | Epileptic encephalopathy [RCV000954377]|not provided [RCV004704371] | likely benign | 15 | 33662678 | 33662678 | Human | 2 | name |
| 15152997 | CV703132 | single nucleotide variant | NM_001036.6(RYR3):c.6714C>T (p.Asn2238=) | Epileptic encephalopathy [RCV000945993] | likely benign | 15 | 33722809 | 33722809 | Human | 2 | name |
| 15170466 | CV714391 | single nucleotide variant | NM_001036.6(RYR3):c.3240T>C (p.Tyr1080=) | Epileptic encephalopathy [RCV000972018] | likely benign | 15 | 33635678 | 33635678 | Human | 2 | name |
| 15109828 | CV714392 | single nucleotide variant | NM_001036.6(RYR3):c.3348C>T (p.Ala1116=) | Epileptic encephalopathy [RCV000960778]|RYR3-related disorder [RCV003926129]|not provided [RCV004584836] | benign|likely benign | 15 | 33635786 | 33635786 | Human | 3 | name , alternate_id |
| 15109987 | CV714393 | single nucleotide variant | NM_001036.6(RYR3):c.4569G>A (p.Val1523=) | Epileptic encephalopathy [RCV000960811] | likely benign | 15 | 33660370 | 33660370 | Human | 2 | name |
| 15108054 | CV714394 | single nucleotide variant | NM_001036.6(RYR3):c.4692C>T (p.Leu1564=) | Epileptic encephalopathy [RCV001511574] | benign | 15 | 33662222 | 33662222 | Human | 2 | name |
| 15143687 | CV714395 | single nucleotide variant | NM_001036.6(RYR3):c.6886C>T (p.Leu2296=) | Epileptic encephalopathy [RCV001452022] | likely benign | 15 | 33724150 | 33724150 | Human | 2 | name |
| 15109430 | CV714396 | single nucleotide variant | NM_001036.6(RYR3):c.7890C>T (p.Ala2630=) | Epileptic encephalopathy [RCV001435841] | likely benign | 15 | 33742435 | 33742435 | Human | 2 | name |
| 15158727 | CV714397 | single nucleotide variant | NM_001036.6(RYR3):c.8026C>T (p.Leu2676=) | Epileptic encephalopathy [RCV001470120] | likely benign | 15 | 33748150 | 33748150 | Human | 2 | name |
| 15177269 | CV726004 | single nucleotide variant | NM_001036.6(RYR3):c.3990C>T (p.Tyr1330=) | Epileptic encephalopathy [RCV000884782] | likely benign | 15 | 33649083 | 33649083 | Human | 2 | name |
| 15202531 | CV726005 | single nucleotide variant | NM_001036.6(RYR3):c.4797C>T (p.Pro1599=) | Epileptic encephalopathy [RCV000891500] | likely benign | 15 | 33662327 | 33662327 | Human | 2 | name |
| 15167945 | CV726006 | single nucleotide variant | NM_001036.6(RYR3):c.6009C>G (p.Thr2003=) | Epileptic encephalopathy [RCV000882955] | likely benign | 15 | 33696366 | 33696366 | Human | 2 | name |
| 15188759 | CV726007 | single nucleotide variant | NM_001036.6(RYR3):c.6390G>A (p.Ser2130=) | Epileptic encephalopathy [RCV000887632]|not provided [RCV003396529] | likely benign | 15 | 33700987 | 33700987 | Human | 2 | name |
| 15169568 | CV726008 | single nucleotide variant | NM_001036.6(RYR3):c.6948C>T (p.Ile2316=) | Epileptic encephalopathy [RCV000883293] | likely benign | 15 | 33726421 | 33726421 | Human | 2 | name |
| 15195141 | CV726009 | single nucleotide variant | NM_001036.6(RYR3):c.7248T>C (p.Tyr2416=) | not provided [RCV000889420] | likely benign | 15 | 33731518 | 33731518 | Human | | name |
| 15200746 | CV726010 | single nucleotide variant | NM_001036.6(RYR3):c.8304A>G (p.Pro2768=) | Epileptic encephalopathy [RCV000890996] | benign | 15 | 33750191 | 33750191 | Human | 2 | name |
| 15169570 | CV726011 | single nucleotide variant | NM_001036.6(RYR3):c.9768G>A (p.Ala3256=) | Epileptic encephalopathy [RCV000883294] | likely benign | 15 | 33788396 | 33788396 | Human | 2 | name |
| 15141142 | CV739547 | single nucleotide variant | NM_001036.6(RYR3):c.3303C>T (p.Val1101=) | Epileptic encephalopathy [RCV001454195] | likely benign | 15 | 33635741 | 33635741 | Human | 2 | name |
| 15159023 | CV739548 | single nucleotide variant | NM_001036.6(RYR3):c.3336C>T (p.Val1112=) | Epileptic encephalopathy [RCV000902851] | likely benign | 15 | 33635774 | 33635774 | Human | 2 | name |
| 15188501 | CV739549 | single nucleotide variant | NM_001036.6(RYR3):c.3933C>T (p.Phe1311=) | not provided [RCV000909386] | likely benign | 15 | 33646518 | 33646518 | Human | | name |
| 15166577 | CV739550 | single nucleotide variant | NM_001036.6(RYR3):c.4476C>G (p.Val1492=) | Epileptic encephalopathy [RCV001479560] | likely benign | 15 | 33660277 | 33660277 | Human | 2 | name |
| 15186691 | CV739551 | single nucleotide variant | NM_001036.6(RYR3):c.4992G>A (p.Gly1664=) | Epileptic encephalopathy [RCV000908875] | likely benign | 15 | 33662522 | 33662522 | Human | 2 | name |
| 15189915 | CV739552 | single nucleotide variant | NM_001036.6(RYR3):c.8385C>T (p.Gly2795=) | Epileptic encephalopathy [RCV000909793] | likely benign | 15 | 33750272 | 33750272 | Human | 2 | name |
| 15133332 | CV739553 | single nucleotide variant | NM_001036.6(RYR3):c.8730C>T (p.Leu2910=) | Epileptic encephalopathy [RCV000898114] | likely benign | 15 | 33768682 | 33768682 | Human | 2 | name |
| 15132543 | CV739554 | single nucleotide variant | NM_001036.6(RYR3):c.9765C>T (p.Phe3255=) | Epileptic encephalopathy [RCV000897974] | likely benign | 15 | 33788393 | 33788393 | Human | 2 | name |
| 15118036 | CV754367 | single nucleotide variant | NM_001036.6(RYR3):c.3594C>T (p.Ile1198=) | Epileptic encephalopathy [RCV000917903] | likely benign | 15 | 33644348 | 33644348 | Human | 2 | name |
| 15150139 | CV754368 | single nucleotide variant | NM_001036.6(RYR3):c.3738C>T (p.Asn1246=) | Epileptic encephalopathy [RCV002544966] | likely benign | 15 | 33644492 | 33644492 | Human | 2 | name |
| 15161004 | CV754369 | single nucleotide variant | NM_001036.6(RYR3):c.4683G>A (p.Thr1561=) | Epileptic encephalopathy [RCV001415339] | likely benign | 15 | 33662213 | 33662213 | Human | 2 | name |
| 15153807 | CV754370 | single nucleotide variant | NM_001036.6(RYR3):c.5109G>A (p.Val1703=) | Epileptic encephalopathy [RCV000924129] | likely benign | 15 | 33662639 | 33662639 | Human | 2 | name |
| 15132411 | CV754371 | single nucleotide variant | NM_001036.6(RYR3):c.5610A>G (p.Pro1870=) | Epileptic encephalopathy [RCV000920336] | likely benign | 15 | 33663728 | 33663728 | Human | 2 | name |
| 15149174 | CV754373 | single nucleotide variant | NM_001036.6(RYR3):c.6312C>T (p.Ser2104=) | Epileptic encephalopathy [RCV000923236] | likely benign | 15 | 33699766 | 33699766 | Human | 2 | name |
| 15166765 | CV754374 | single nucleotide variant | NM_001036.6(RYR3):c.6690G>A (p.Pro2230=) | Epileptic encephalopathy [RCV001473291] | likely benign | 15 | 33722785 | 33722785 | Human | 2 | name |
| 15166213 | CV754375 | single nucleotide variant | NM_001036.6(RYR3):c.6777C>G (p.Pro2259=) | Epileptic encephalopathy [RCV000926814] | likely benign | 15 | 33722872 | 33722872 | Human | 2 | name |
| 15125015 | CV754376 | single nucleotide variant | NM_001036.6(RYR3):c.6894C>T (p.Arg2298=) | not provided [RCV000919080] | likely benign | 15 | 33724158 | 33724158 | Human | | name |
| 15156539 | CV754377 | single nucleotide variant | NM_001036.6(RYR3):c.7113C>T (p.Arg2371=) | not provided [RCV000924689] | likely benign | 15 | 33728936 | 33728936 | Human | | name |
| 15160757 | CV754379 | single nucleotide variant | NM_001036.6(RYR3):c.9105C>T (p.Ser3035=) | Epileptic encephalopathy [RCV001460884] | likely benign | 15 | 33773583 | 33773583 | Human | 2 | name |
| 15129220 | CV754380 | single nucleotide variant | NM_001036.6(RYR3):c.9129T>C (p.Tyr3043=) | Epileptic encephalopathy [RCV001492635] | likely benign | 15 | 33773607 | 33773607 | Human | 2 | name |
| 15129931 | CV754381 | single nucleotide variant | NM_001036.6(RYR3):c.9477A>G (p.Pro3159=) | Epileptic encephalopathy [RCV001392690] | likely benign | 15 | 33785870 | 33785870 | Human | 2 | name |
| 15101927 | CV770077 | single nucleotide variant | NM_001036.6(RYR3):c.3177T>G (p.Ala1059=) | not provided [RCV000936894] | likely benign | 15 | 33635615 | 33635615 | Human | | name |
| 15125577 | CV770078 | single nucleotide variant | NM_001036.6(RYR3):c.3882C>T (p.Val1294=) | Epileptic encephalopathy [RCV001478224] | likely benign | 15 | 33646467 | 33646467 | Human | 2 | name |
| 15189408 | CV770079 | single nucleotide variant | NM_001036.6(RYR3):c.3903C>T (p.Ser1301=) | Epileptic encephalopathy [RCV001404218] | likely benign | 15 | 33646488 | 33646488 | Human | 2 | name |
| 15141843 | CV770080 | single nucleotide variant | NM_001036.6(RYR3):c.4467G>A (p.Arg1489=) | Epileptic encephalopathy [RCV000943969] | likely benign | 15 | 33660268 | 33660268 | Human | 2 | name |
| 15176898 | CV770081 | single nucleotide variant | NM_001036.6(RYR3):c.4677C>T (p.Tyr1559=) | Epileptic encephalopathy [RCV001505423] | likely benign | 15 | 33662207 | 33662207 | Human | 2 | name |
| 15176289 | CV770082 | single nucleotide variant | NM_001036.6(RYR3):c.4989C>T (p.Pro1663=) | not provided [RCV000928884] | likely benign | 15 | 33662519 | 33662519 | Human | | name |
| 15178116 | CV770083 | single nucleotide variant | NM_001036.6(RYR3):c.5217T>C (p.Asp1739=) | not provided [RCV000929318] | likely benign | 15 | 33662747 | 33662747 | Human | | name |
| 15181636 | CV770084 | single nucleotide variant | NM_001036.6(RYR3):c.5413C>T (p.Leu1805=) | Epileptic encephalopathy [RCV001393647] | likely benign | 15 | 33662943 | 33662943 | Human | 2 | name |
| 15185334 | CV770085 | single nucleotide variant | NM_001036.6(RYR3):c.5622C>T (p.Ile1874=) | Epileptic encephalopathy [RCV000931028] | likely benign | 15 | 33669356 | 33669356 | Human | 2 | name |
| 15186170 | CV770086 | single nucleotide variant | NM_001036.6(RYR3):c.7161T>C (p.Val2387=) | Epileptic encephalopathy [RCV000931275] | likely benign | 15 | 33728984 | 33728984 | Human | 2 | name |
| 15199955 | CV770087 | single nucleotide variant | NM_001036.6(RYR3):c.7230G>A (p.Ala2410=) | Epileptic encephalopathy [RCV000935250] | likely benign | 15 | 33731500 | 33731500 | Human | 2 | name |
| 15117643 | CV770088 | single nucleotide variant | NM_001036.6(RYR3):c.7341G>A (p.Gln2447=) | Epileptic encephalopathy [RCV001435477] | likely benign | 15 | 33731611 | 33731611 | Human | 2 | name |
| 15146741 | CV770089 | single nucleotide variant | NM_001036.6(RYR3):c.7350C>T (p.Tyr2450=) | Epileptic encephalopathy [RCV001503273] | likely benign | 15 | 33731620 | 33731620 | Human | 2 | name |
| 15103321 | CV770090 | single nucleotide variant | NM_001036.6(RYR3):c.7644G>A (p.Ser2548=) | Epileptic encephalopathy [RCV001465385] | likely benign | 15 | 33738578 | 33738578 | Human | 2 | name |
| 15127660 | CV784875 | single nucleotide variant | NM_001036.6(RYR3):c.3070T>C (p.Leu1024=) | Epileptic encephalopathy [RCV001407890] | likely benign | 15 | 33634628 | 33634628 | Human | 2 | name |
| 15128867 | CV784876 | single nucleotide variant | NM_001036.6(RYR3):c.3214C>A (p.Arg1072=) | Epileptic encephalopathy [RCV001490186] | likely benign | 15 | 33635652 | 33635652 | Human | 2 | name |
| 15131066 | CV784877 | single nucleotide variant | NM_001036.6(RYR3):c.5367T>C (p.Ala1789=) | Epileptic encephalopathy [RCV000981149] | likely benign | 15 | 33662897 | 33662897 | Human | 2 | name |
| 15113484 | CV784878 | single nucleotide variant | NM_001036.6(RYR3):c.5889G>A (p.Thr1963=) | Epileptic encephalopathy [RCV001502430] | likely benign | 15 | 33696246 | 33696246 | Human | 2 | name |
| 15116486 | CV784879 | single nucleotide variant | NM_001036.6(RYR3):c.6525C>T (p.Pro2175=) | Epileptic encephalopathy [RCV001453447] | likely benign | 15 | 33706960 | 33706960 | Human | 2 | name |
| 15108050 | CV784880 | single nucleotide variant | NM_001036.6(RYR3):c.6891C>T (p.Gly2297=) | Epileptic encephalopathy [RCV001418014] | likely benign | 15 | 33724155 | 33724155 | Human | 2 | name |
| 15129470 | CV784881 | single nucleotide variant | NM_001036.6(RYR3):c.6966C>T (p.Ser2322=) | not provided [RCV000980883] | likely benign | 15 | 33726439 | 33726439 | Human | | name |
| 15138948 | CV784882 | single nucleotide variant | NM_001036.6(RYR3):c.7158G>A (p.Glu2386=) | Epileptic encephalopathy [RCV001457891] | likely benign | 15 | 33728981 | 33728981 | Human | 2 | name |
| 15135949 | CV784883 | single nucleotide variant | NM_001036.6(RYR3):c.8244C>G (p.Ala2748=) | Epileptic encephalopathy [RCV001412280] | likely benign | 15 | 33750023 | 33750023 | Human | 2 | name |
| 15142124 | CV784884 | single nucleotide variant | NM_001036.6(RYR3):c.8931C>G (p.Thr2977=) | Epileptic encephalopathy [RCV000983099] | likely benign | 15 | 33772034 | 33772034 | Human | 2 | name |
| 15139342 | CV784885 | single nucleotide variant | NM_001036.6(RYR3):c.9705G>A (p.Gln3235=) | Epileptic encephalopathy [RCV001443649] | likely benign | 15 | 33788333 | 33788333 | Human | 2 | name |
| 26892104 | CV842137 | single nucleotide variant | NM_001036.6(RYR3):c.639C>G (p.Ile213Met) | Epileptic encephalopathy [RCV001061351] | uncertain significance | 15 | 33540883 | 33540883 | Human | 2 | name |
| 26902923 | CV842138 | single nucleotide variant | NM_001036.6(RYR3):c.674G>A (p.Arg225His) | Epileptic encephalopathy [RCV001069559]|not specified [RCV004030718] | uncertain significance | 15 | 33543649 | 33543649 | Human | 2 | name |
| 26919832 | CV842139 | single nucleotide variant | NM_001036.6(RYR3):c.704C>T (p.Thr235Met) | Epileptic encephalopathy [RCV001046469] | uncertain significance | 15 | 33543679 | 33543679 | Human | 2 | name |
| 26917734 | CV842140 | single nucleotide variant | NM_001036.6(RYR3):c.860G>A (p.Arg287Gln) | Epileptic encephalopathy [RCV001042233]|not specified [RCV004857750] | uncertain significance | 15 | 33550204 | 33550204 | Human | 2 | name |
| 26915929 | CV842167 | single nucleotide variant | NM_001036.6(RYR3):c.4614G>A (p.Glu1538=) | Epileptic encephalopathy [RCV001039595] | uncertain significance | 15 | 33660415 | 33660415 | Human | 2 | name |
| 26884545 | CV842169 | single nucleotide variant | NM_001036.6(RYR3):c.4698C>T (p.Ser1566=) | Epileptic encephalopathy [RCV001052023] | uncertain significance | 15 | 33662228 | 33662228 | Human | 2 | name |
| 8635402 | CV90623 | single nucleotide variant | NM_001036.4(RYR3):c.647G>A (p.Gly216Glu) | Malignant melanoma [RCV000070721] | not provided | 15 | 33543622 | 33543622 | Human | | name |
| 38461108 | CV919565 | single nucleotide variant | NM_001036.6(RYR3):c.393C>A (p.Asp131Glu) | See cases [RCV001197271] | uncertain significance | 15 | 33533349 | 33533349 | Human | | name |
| 38476097 | CV927269 | single nucleotide variant | NM_001036.6(RYR3):c.840G>A (p.Trp280Ter) | Epileptic encephalopathy [RCV001215482] | uncertain significance | 15 | 33550184 | 33550184 | Human | 2 | name |
| 38477987 | CV936858 | single nucleotide variant | NM_001036.6(RYR3):c.565G>A (p.Gly189Ser) | Epileptic encephalopathy [RCV001205345] | uncertain significance | 15 | 33540809 | 33540809 | Human | 2 | name |
| 38482844 | CV936859 | single nucleotide variant | NM_001036.6(RYR3):c.877C>T (p.His293Tyr) | Epileptic encephalopathy [RCV001207425] | uncertain significance | 15 | 33550221 | 33550221 | Human | 2 | name |
| 38490336 | CV936875 | single nucleotide variant | NM_001036.6(RYR3):c.5721T>C (p.Cys1907=) | Epileptic encephalopathy [RCV001210610] | uncertain significance | 15 | 33669455 | 33669455 | Human | 2 | name |
| 38496006 | CV948811 | single nucleotide variant | NM_001036.6(RYR3):c.922C>T (p.Arg308Trp) | Epileptic encephalopathy [RCV001226102] | uncertain significance | 15 | 33550266 | 33550266 | Human | 2 | name |
| 38493135 | CV957382 | single nucleotide variant | NM_001036.6(RYR3):c.683A>G (p.His228Arg) | Epileptic encephalopathy [RCV001240447] | uncertain significance | 15 | 33543658 | 33543658 | Human | 2 | name |
| 38498631 | CV957383 | single nucleotide variant | NM_001036.6(RYR3):c.708A>G (p.Ile236Met) | Epileptic encephalopathy [RCV001243934]|not specified [RCV004034767] | uncertain significance | 15 | 33543683 | 33543683 | Human | 2 | name |
| 41407101 | CV980722 | single nucleotide variant | NM_001036.6(RYR3):c.302G>A (p.Arg101Lys) | RYR3-related Epileptic encephalopathy [RCV004799601]|not specified [RCV005269036] | uncertain significance | 15 | 33530614 | 33530614 | Human | 1 | name |
| 126757767 | CV996170 | single nucleotide variant | NM_001036.6(RYR3):c.511C>T (p.Leu171Phe) | Epileptic encephalopathy [RCV001308519] | uncertain significance | 15 | 33539427 | 33539427 | Human | 2 | name |
| 126766763 | CV996199 | single nucleotide variant | NM_001036.6(RYR3):c.8835C>G (p.Gly2945=) | Epileptic encephalopathy [RCV001302022] | uncertain significance | 15 | 33771938 | 33771938 | Human | 2 | name |
| 126725447 | CV996203 | single nucleotide variant | NM_001036.6(RYR3):c.9234G>A (p.Ser3078=) | Epileptic encephalopathy [RCV001302569]|not provided [RCV004692450] | likely benign|uncertain significance | 15 | 33780307 | 33780307 | Human | 2 | name |
| 126734968 | CV1011405 | single nucleotide variant | NM_001036.6(RYR3):c.1186A>G (p.Thr396Ala) | Epileptic encephalopathy [RCV001324453] | uncertain significance | 15 | 33566717 | 33566717 | Human | 2 | name |
| 126729111 | CV1011406 | single nucleotide variant | NM_001036.6(RYR3):c.1247C>T (p.Ala416Val) | Epileptic encephalopathy [RCV001312642] | uncertain significance | 15 | 33566778 | 33566778 | Human | 2 | name |
| 126730967 | CV1011407 | single nucleotide variant | NM_001036.6(RYR3):c.1606G>T (p.Ala536Ser) | Epileptic encephalopathy [RCV001312956] | uncertain significance | 15 | 33584427 | 33584427 | Human | 2 | name |
| 126769798 | CV1011408 | single nucleotide variant | NM_001036.6(RYR3):c.1876C>T (p.Arg626Trp) | Epileptic encephalopathy [RCV001322186] | uncertain significance | 15 | 33601506 | 33601506 | Human | 2 | name |
| 126759210 | CV1011409 | single nucleotide variant | NM_001036.6(RYR3):c.1924A>G (p.Ile642Val) | Epileptic encephalopathy [RCV001317999] | uncertain significance | 15 | 33603124 | 33603124 | Human | 2 | name |
| 126747563 | CV1011410 | single nucleotide variant | NM_001036.6(RYR3):c.2028G>T (p.Glu676Asp) | Epileptic encephalopathy [RCV001315367] | uncertain significance | 15 | 33603228 | 33603228 | Human | 2 | name |
| 126735908 | CV1011411 | single nucleotide variant | NM_001036.6(RYR3):c.2457G>T (p.Met819Ile) | Epileptic encephalopathy [RCV001313781] | uncertain significance | 15 | 33623906 | 33623906 | Human | 2 | name |
| 126764742 | CV1031914 | single nucleotide variant | NM_001036.6(RYR3):c.1341C>G (p.Ile447Met) | Epileptic encephalopathy [RCV001341769] | uncertain significance | 15 | 33580048 | 33580048 | Human | 2 | name |
| 126725213 | CV1031915 | single nucleotide variant | NM_001036.6(RYR3):c.1912G>C (p.Asp638His) | Epileptic encephalopathy [RCV001348081] | uncertain significance | 15 | 33601542 | 33601542 | Human | 2 | name |
| 126763329 | CV1031916 | single nucleotide variant | NM_001036.6(RYR3):c.1927C>T (p.Arg643Trp) | Epileptic encephalopathy [RCV001341236]|not provided [RCV003987840] | uncertain significance|not provided | 15 | 33603127 | 33603127 | Human | 2 | name |
| 126760204 | CV1031917 | single nucleotide variant | NM_001036.6(RYR3):c.2255G>A (p.Ser752Asn) | Epileptic encephalopathy [RCV001340346] | uncertain significance | 15 | 33613273 | 33613273 | Human | 2 | name |
| 126758299 | CV1031918 | single nucleotide variant | NM_001036.6(RYR3):c.2864A>G (p.Lys955Arg) | Epileptic encephalopathy [RCV001339809] | uncertain significance | 15 | 33631290 | 33631290 | Human | 2 | name |
| 126727002 | CV1031944 | single nucleotide variant | NM_001036.6(RYR3):c.10155C>T (p.Gly3385=) | Epileptic encephalopathy [RCV001348603] | uncertain significance | 15 | 33810607 | 33810607 | Human | 2 | name |
| 126924169 | CV1048862 | single nucleotide variant | NM_001036.6(RYR3):c.1014A>G (p.Ile338Met) | Epileptic encephalopathy [RCV001366715] | uncertain significance | 15 | 33562878 | 33562878 | Human | 2 | name |
| 126908259 | CV1048863 | single nucleotide variant | NM_001036.6(RYR3):c.1805G>A (p.Cys602Tyr) | Epileptic encephalopathy [RCV001367731] | uncertain significance | 15 | 33601435 | 33601435 | Human | 2 | name |
| 126918823 | CV1048864 | single nucleotide variant | NM_001036.6(RYR3):c.2005G>A (p.Val669Met) | Epileptic encephalopathy [RCV001361951] | uncertain significance | 15 | 33603205 | 33603205 | Human | 2 | name |
| 126916845 | CV1048868 | deletion | NM_001036.6(RYR3):c.4766del (p.Leu1589fs) | Epileptic encephalopathy [RCV001360820] | uncertain significance | 15 | 33662296 | 33662296 | Human | 2 | name |
| 126918684 | CV1048888 | single nucleotide variant | NM_001036.6(RYR3):c.13629A>G (p.Pro4543=) | Epileptic encephalopathy [RCV001372804] | uncertain significance | 15 | 33853045 | 33853045 | Human | 2 | name |
| 127259491 | CV1080988 | single nucleotide variant | NM_001036.6(RYR3):c.11097G>A (p.Glu3699=) | Epileptic encephalopathy [RCV001401964] | likely benign | 15 | 33825627 | 33825627 | Human | 2 | name |
| 127280811 | CV1080989 | single nucleotide variant | NM_001036.6(RYR3):c.11415T>C (p.Ala3805=) | Epileptic encephalopathy [RCV001410062] | likely benign | 15 | 33831043 | 33831043 | Human | 2 | name |
| 127239332 | CV1080990 | single nucleotide variant | NM_001036.6(RYR3):c.12030C>A (p.Arg4010=) | Epileptic encephalopathy [RCV001415309]|RYR3-related disorder [RCV003938714] | likely benign | 15 | 33838010 | 33838010 | Human | 3 | name , alternate_id |
| 127230613 | CV1080991 | single nucleotide variant | NM_001036.6(RYR3):c.12558C>T (p.Ser4186=) | Epileptic encephalopathy [RCV001394771] | likely benign | 15 | 33838538 | 33838538 | Human | 2 | name |
| 127258761 | CV1080992 | single nucleotide variant | NM_001036.6(RYR3):c.12696G>T (p.Leu4232=) | Epileptic encephalopathy [RCV001401749] | likely benign | 15 | 33838676 | 33838676 | Human | 2 | name |
| 127233291 | CV1080993 | single nucleotide variant | NM_001036.6(RYR3):c.12819A>C (p.Gly4273=) | Epileptic encephalopathy [RCV001396064] | likely benign | 15 | 33838799 | 33838799 | Human | 2 | name |
| 127230177 | CV1080994 | single nucleotide variant | NM_001036.6(RYR3):c.13197G>A (p.Gln4399=) | Epileptic encephalopathy [RCV001394607] | likely benign | 15 | 33842023 | 33842023 | Human | 2 | name |
| 127272725 | CV1080996 | single nucleotide variant | NM_001036.6(RYR3):c.13782G>A (p.Ala4594=) | Epileptic encephalopathy [RCV001405787] | likely benign | 15 | 33853665 | 33853665 | Human | 2 | name |
| 127241567 | CV1080997 | single nucleotide variant | NM_001036.6(RYR3):c.13878C>T (p.Ala4626=) | Epileptic encephalopathy [RCV001393181] | likely benign | 15 | 33854783 | 33854783 | Human | 2 | name |
| 127254583 | CV1080998 | single nucleotide variant | NM_001036.6(RYR3):c.13899C>T (p.Val4633=) | Epileptic encephalopathy [RCV001400834] | likely benign | 15 | 33854804 | 33854804 | Human | 2 | name |
| 127241931 | CV1080999 | single nucleotide variant | NM_001036.6(RYR3):c.14004A>G (p.Lys4668=) | Epileptic encephalopathy [RCV001398095] | likely benign | 15 | 33854909 | 33854909 | Human | 2 | name |
| 127269178 | CV1081001 | single nucleotide variant | NM_001036.6(RYR3):c.14058G>T (p.Val4686=) | Epileptic encephalopathy [RCV001404582]|RYR3-related disorder [RCV003908580] | likely benign | 15 | 33857830 | 33857830 | Human | 3 | name , alternate_id |
| 127239292 | CV1081002 | single nucleotide variant | NM_001036.6(RYR3):c.14244C>G (p.Val4748=) | Epileptic encephalopathy [RCV001392676] | likely benign | 15 | 33859676 | 33859676 | Human | 2 | name |
| 127258199 | CV1081003 | single nucleotide variant | NM_001036.6(RYR3):c.14583T>C (p.Phe4861=) | Epileptic encephalopathy [RCV001401648] | likely benign | 15 | 33865196 | 33865196 | Human | 2 | name |
| 127282104 | CV1102812 | single nucleotide variant | NM_001036.6(RYR3):c.10075T>C (p.Leu3359=) | Epileptic encephalopathy [RCV001447625] | likely benign | 15 | 33810527 | 33810527 | Human | 2 | name |
| 127254653 | CV1102814 | single nucleotide variant | NM_001036.6(RYR3):c.11329C>T (p.Leu3777=) | Epileptic encephalopathy [RCV001437299] | likely benign | 15 | 33827282 | 33827282 | Human | 2 | name |
| 127236598 | CV1102815 | single nucleotide variant | NM_001036.6(RYR3):c.11352C>T (p.Phe3784=) | Epileptic encephalopathy [RCV001433374] | likely benign | 15 | 33830980 | 33830980 | Human | 2 | name |
| 127261163 | CV1102816 | single nucleotide variant | NM_001036.6(RYR3):c.11838G>A (p.Lys3946=) | Epileptic encephalopathy [RCV001428022] | likely benign | 15 | 33837818 | 33837818 | Human | 2 | name |
| 127258591 | CV1102817 | single nucleotide variant | NM_001036.6(RYR3):c.11853A>G (p.Gln3951=) | Epileptic encephalopathy [RCV001427375] | likely benign | 15 | 33837833 | 33837833 | Human | 2 | name |
| 127272858 | CV1102819 | single nucleotide variant | NM_001036.6(RYR3):c.12874T>C (p.Leu4292=) | Epileptic encephalopathy [RCV001431433] | likely benign | 15 | 33838854 | 33838854 | Human | 2 | name |
| 127247465 | CV1102820 | single nucleotide variant | NM_001036.6(RYR3):c.12885G>T (p.Gly4295=) | Epileptic encephalopathy [RCV001424708] | likely benign | 15 | 33838865 | 33838865 | Human | 2 | name |
| 127249021 | CV1102821 | single nucleotide variant | NM_001036.6(RYR3):c.12975T>G (p.Ala4325=) | Epileptic encephalopathy [RCV001436005] | likely benign | 15 | 33838955 | 33838955 | Human | 2 | name |
| 127273372 | CV1102822 | single nucleotide variant | NM_001036.6(RYR3):c.13107G>T (p.Val4369=) | Epileptic encephalopathy [RCV001442495] | likely benign | 15 | 33841933 | 33841933 | Human | 2 | name |
| 127267448 | CV1102823 | single nucleotide variant | NM_001036.6(RYR3):c.13140G>A (p.Lys4380=) | Epileptic encephalopathy [RCV001429704] | likely benign | 15 | 33841966 | 33841966 | Human | 2 | name |
| 127264587 | CV1102825 | single nucleotide variant | NM_001036.6(RYR3):c.13998T>C (p.Asn4666=) | Epileptic encephalopathy [RCV001439674] | likely benign | 15 | 33854903 | 33854903 | Human | 2 | name |
| 127280822 | CV1102826 | single nucleotide variant | NM_001036.6(RYR3):c.14070C>T (p.Asn4690=) | Epileptic encephalopathy [RCV001446747] | likely benign | 15 | 33857842 | 33857842 | Human | 2 | name |
| 127267447 | CV1102828 | single nucleotide variant | NM_001036.6(RYR3):c.14490T>C (p.Asn4830=) | Epileptic encephalopathy [RCV001440552] | likely benign | 15 | 33864162 | 33864162 | Human | 2 | name |
| 127283540 | CV1102830 | single nucleotide variant | NM_001036.6(RYR3):c.14535G>A (p.Lys4845=) | Epileptic encephalopathy [RCV001448592] | likely benign | 15 | 33865148 | 33865148 | Human | 2 | name |
| 127306664 | CV1124238 | single nucleotide variant | NM_001036.6(RYR3):c.10185G>A (p.Ser3395=) | Epileptic encephalopathy [RCV001455604] | likely benign | 15 | 33810637 | 33810637 | Human | 2 | name |
| 127294452 | CV1124240 | single nucleotide variant | NM_001036.6(RYR3):c.10689C>T (p.Asn3563=) | Epileptic encephalopathy [RCV001476819] | likely benign | 15 | 33818667 | 33818667 | Human | 2 | name |
| 127305775 | CV1124241 | single nucleotide variant | NM_001036.6(RYR3):c.10767A>G (p.Gln3589=) | Epileptic encephalopathy [RCV001462581]|not provided [RCV005243558] | likely benign | 15 | 33820764 | 33820764 | Human | 2 | name |
| 127297636 | CV1124242 | single nucleotide variant | NM_001036.6(RYR3):c.10977C>G (p.Gly3659=) | Epileptic encephalopathy [RCV001453103] | likely benign | 15 | 33821584 | 33821584 | Human | 2 | name |
| 127287862 | CV1124243 | single nucleotide variant | NM_001036.6(RYR3):c.11793T>C (p.Tyr3931=) | Epileptic encephalopathy [RCV001450251] | likely benign | 15 | 33837773 | 33837773 | Human | 2 | name |
| 127335967 | CV1124244 | single nucleotide variant | NM_001036.6(RYR3):c.11961C>T (p.Ala3987=) | Epileptic encephalopathy [RCV001474646] | likely benign | 15 | 33837941 | 33837941 | Human | 2 | name |
| 127298789 | CV1124245 | single nucleotide variant | NM_001036.6(RYR3):c.12465C>T (p.Asp4155=) | Epileptic encephalopathy [RCV001460637] | likely benign | 15 | 33838445 | 33838445 | Human | 2 | name |
| 127320189 | CV1124246 | single nucleotide variant | NM_001036.6(RYR3):c.13191C>T (p.Ile4397=) | Epileptic encephalopathy [RCV001466843] | likely benign | 15 | 33842017 | 33842017 | Human | 2 | name |
| 127321277 | CV1124247 | single nucleotide variant | NM_001036.6(RYR3):c.13362C>T (p.Asp4454=) | Epileptic encephalopathy [RCV001467221] | likely benign | 15 | 33844927 | 33844927 | Human | 2 | name |
| 127300219 | CV1124248 | single nucleotide variant | NM_001036.6(RYR3):c.13584A>G (p.Glu4528=) | Epileptic encephalopathy [RCV001453806]|RYR3-related disorder [RCV003973315]|not specified [RCV005271288] | likely benign | 15 | 33848377 | 33848377 | Human | 3 | name , alternate_id |
| 127296204 | CV1124249 | single nucleotide variant | NM_001036.6(RYR3):c.13686T>C (p.Tyr4562=) | Epileptic encephalopathy [RCV001477282] | likely benign | 15 | 33853569 | 33853569 | Human | 2 | name |
| 127309199 | CV1124250 | single nucleotide variant | NM_001036.6(RYR3):c.13842A>G (p.Gly4614=) | Epileptic encephalopathy [RCV001463520] | likely benign | 15 | 33854431 | 33854431 | Human | 2 | name |
| 127332847 | CV1145099 | single nucleotide variant | NM_001036.6(RYR3):c.10101C>T (p.Ile3367=) | Epileptic encephalopathy [RCV001489804] | likely benign | 15 | 33810553 | 33810553 | Human | 2 | name |
| 127312810 | CV1145100 | single nucleotide variant | NM_001036.6(RYR3):c.10269A>T (p.Pro3423=) | Epileptic encephalopathy [RCV001502019] | likely benign | 15 | 33812874 | 33812874 | Human | 2 | name |
| 127287288 | CV1145101 | single nucleotide variant | NM_001036.6(RYR3):c.10419C>T (p.Ala3473=) | Epileptic encephalopathy [RCV001494846] | likely benign | 15 | 33813496 | 33813496 | Human | 2 | name |
| 127323123 | CV1145102 | single nucleotide variant | NM_001036.6(RYR3):c.10656A>G (p.Pro3552=) | Epileptic encephalopathy [RCV001485159] | likely benign | 15 | 33818634 | 33818634 | Human | 2 | name |
| 127286481 | CV1145103 | single nucleotide variant | NM_001036.6(RYR3):c.12513C>T (p.Asn4171=) | Epileptic encephalopathy [RCV001494270] | likely benign | 15 | 33838493 | 33838493 | Human | 2 | name |
| 127335884 | CV1145104 | single nucleotide variant | NM_001036.6(RYR3):c.12583C>T (p.Leu4195=) | Epileptic encephalopathy [RCV001491769] | likely benign | 15 | 33838563 | 33838563 | Human | 2 | name |
| 127301087 | CV1145105 | single nucleotide variant | NM_001036.6(RYR3):c.13152G>A (p.Pro4384=) | Epileptic encephalopathy [RCV001478587] | likely benign | 15 | 33841978 | 33841978 | Human | 2 | name |
| 127325414 | CV1145107 | single nucleotide variant | NM_001036.6(RYR3):c.13536C>A (p.Ala4512=) | Epileptic encephalopathy [RCV001506012] | likely benign | 15 | 33848329 | 33848329 | Human | 2 | name |
| 127332094 | CV1145108 | single nucleotide variant | NM_001036.6(RYR3):c.13572A>G (p.Glu4524=) | Epileptic encephalopathy [RCV001489267] | likely benign | 15 | 33848365 | 33848365 | Human | 2 | name |
| 127305005 | CV1145110 | single nucleotide variant | NM_001036.6(RYR3):c.13734C>T (p.Asp4578=) | Epileptic encephalopathy [RCV001479684] | likely benign | 15 | 33853617 | 33853617 | Human | 2 | name |
| 127320125 | CV1145112 | single nucleotide variant | NM_001036.6(RYR3):c.14475G>A (p.Leu4825=) | Epileptic encephalopathy [RCV001484075] | likely benign | 15 | 33864147 | 33864147 | Human | 2 | name |
| 127303371 | CV1157412 | single nucleotide variant | NM_001036.6(RYR3):c.1480G>A (p.Val494Ile) | Epileptic encephalopathy [RCV001515456]|not provided [RCV004716726] | benign | 15 | 33581550 | 33581550 | Human | 2 | name |
| 127303823 | CV1157414 | single nucleotide variant | NM_001036.6(RYR3):c.2191A>G (p.Ile731Val) | Epileptic encephalopathy [RCV001515626]|not provided [RCV004715450] | benign | 15 | 33613209 | 33613209 | Human | 3 | name |
| 127303823 | CV1157414 | single nucleotide variant | NM_001036.6(RYR3):c.2191A>G (p.Ile731Val) | Epileptic encephalopathy [RCV001515626]|not provided [RCV004715450] | benign | 15 | 33613209 | 33613210 | Human | 3 | name |
| 127303375 | CV1157424 | single nucleotide variant | NM_001036.6(RYR3):c.10812C>T (p.Phe3604=) | Epileptic encephalopathy [RCV001515457]|not provided [RCV004715449] | benign | 15 | 33820809 | 33820809 | Human | 2 | name |
| 127319039 | CV1157425 | single nucleotide variant | NM_001036.6(RYR3):c.10881A>G (p.Ala3627=) | Epileptic encephalopathy [RCV001521927]|not provided [RCV001709716] | benign | 15 | 33821335 | 33821335 | Human | 2 | name |
| 127294741 | CV1157428 | single nucleotide variant | NM_001036.6(RYR3):c.13434T>G (p.Arg4478=) | Epileptic encephalopathy [RCV001511881]|not provided [RCV004715435] | benign | 15 | 33844999 | 33844999 | Human | 2 | name |
| 150453321 | CV1203777 | single nucleotide variant | NM_001036.6(RYR3):c.2108A>G (p.Asn703Ser) | See cases [RCV001591733]|not specified [RCV004039488] | uncertain significance | 15 | 33603308 | 33603308 | Human | | name |
| 151824736 | CV1350994 | single nucleotide variant | NM_001036.6(RYR3):c.2695A>G (p.Lys899Glu) | Epileptic encephalopathy [RCV001919913] | uncertain significance | 15 | 33629955 | 33629955 | Human | 2 | name |
| 151874192 | CV1382441 | single nucleotide variant | NM_001036.6(RYR3):c.1124G>A (p.Arg375His) | Epileptic encephalopathy [RCV002019329] | uncertain significance | 15 | 33562988 | 33562988 | Human | 2 | name |
| 151737590 | CV1422366 | single nucleotide variant | NM_001036.6(RYR3):c.1471C>T (p.Arg491Cys) | Epileptic encephalopathy [RCV001984898] | uncertain significance | 15 | 33581541 | 33581541 | Human | 2 | name |
| 151768266 | CV1445417 | single nucleotide variant | NM_001036.6(RYR3):c.1263T>G (p.Phe421Leu) | Epileptic encephalopathy [RCV002025109] | uncertain significance | 15 | 33566794 | 33566794 | Human | 2 | name |
| 152037045 | CV1521849 | single nucleotide variant | NM_001036.6(RYR3):c.13939T>C (p.Leu4647=) | Epileptic encephalopathy [RCV002187678] | likely benign | 15 | 33854844 | 33854844 | Human | 2 | name |
| 152055911 | CV1583901 | single nucleotide variant | NM_001036.6(RYR3):c.13749C>T (p.Asp4583=) | Epileptic encephalopathy [RCV002208082] | likely benign | 15 | 33853632 | 33853632 | Human | 2 | name |
| 152170334 | CV1592376 | single nucleotide variant | NM_001036.6(RYR3):c.13026C>T (p.Ser4342=) | Epileptic encephalopathy [RCV002161735] | likely benign | 15 | 33840872 | 33840872 | Human | 2 | name |
| 152138298 | CV1603893 | single nucleotide variant | NM_001036.6(RYR3):c.10800G>A (p.Lys3600=) | Epileptic encephalopathy [RCV002219025] | likely benign | 15 | 33820797 | 33820797 | Human | 2 | name |
| 156409049 | CV1880065 | single nucleotide variant | NM_001036.6(RYR3):c.12177C>A (p.Pro4059=) | Epileptic encephalopathy [RCV003071510] | likely benign | 15 | 33838157 | 33838157 | Human | 2 | name |
| 156211267 | CV2117749 | single nucleotide variant | NM_001036.6(RYR3):c.11880C>T (p.Asp3960=) | Epileptic encephalopathy [RCV002957754] | likely benign | 15 | 33837860 | 33837860 | Human | 2 | name |
| 156182686 | CV2201907 | single nucleotide variant | NM_001036.6(RYR3):c.2870A>G (p.Tyr957Cys) | not specified [RCV004075490] | uncertain significance | 15 | 33632951 | 33632951 | Human | | name |
| 155920801 | CV2211967 | single nucleotide variant | NM_001036.6(RYR3):c.1016A>G (p.Glu339Gly) | not specified [RCV004087093] | uncertain significance | 15 | 33562880 | 33562880 | Human | | name |
| 156363686 | CV2262681 | single nucleotide variant | NM_001036.6(RYR3):c.2750A>T (p.Asn917Ile) | not specified [RCV004130874] | uncertain significance | 15 | 33630010 | 33630010 | Human | | name |
| 156071514 | CV2267269 | single nucleotide variant | NM_001036.6(RYR3):c.1586G>A (p.Arg529His) | not specified [RCV004133944] | uncertain significance | 15 | 33584407 | 33584407 | Human | | name |
| 156236233 | CV2268118 | single nucleotide variant | NM_001036.6(RYR3):c.2045T>G (p.Val682Gly) | not specified [RCV004138441] | uncertain significance | 15 | 33603245 | 33603245 | Human | | name |
| 155967768 | CV2280508 | single nucleotide variant | NM_001036.6(RYR3):c.2828C>T (p.Ala943Val) | not specified [RCV004142710] | uncertain significance | 15 | 33631254 | 33631254 | Human | | name |
| 156069093 | CV2292695 | single nucleotide variant | NM_001036.6(RYR3):c.2587C>T (p.Pro863Ser) | not specified [RCV004154377] | uncertain significance | 15 | 33628483 | 33628483 | Human | | name |
| 155971815 | CV2309341 | single nucleotide variant | NM_001036.6(RYR3):c.1510A>T (p.Ile504Phe) | not specified [RCV004165495] | uncertain significance | 15 | 33581580 | 33581580 | Human | | name |
| 156052824 | CV2320332 | single nucleotide variant | NM_001036.6(RYR3):c.1430A>G (p.Lys477Arg) | not specified [RCV004178494] | uncertain significance | 15 | 33580137 | 33580137 | Human | | name |
| 156222682 | CV2343977 | single nucleotide variant | NM_001036.6(RYR3):c.2794G>A (p.Ala932Thr) | not specified [RCV004195596] | uncertain significance | 15 | 33631220 | 33631220 | Human | | name |
| 156224674 | CV2355678 | single nucleotide variant | NM_001036.6(RYR3):c.2153A>G (p.His718Arg) | not specified [RCV004198634] | uncertain significance | 15 | 33603353 | 33603353 | Human | | name |
| 155997969 | CV2396160 | single nucleotide variant | NM_001036.6(RYR3):c.2606G>A (p.Arg869Gln) | not specified [RCV004240125] | uncertain significance | 15 | 33628502 | 33628502 | Human | | name |
| 329373052 | CV2434088 | single nucleotide variant | NM_001036.6(RYR3):c.1733A>G (p.Glu578Gly) | not specified [RCV004249987] | uncertain significance | 15 | 33586061 | 33586061 | Human | | name |
| 329394789 | CV2461470 | single nucleotide variant | NM_001036.6(RYR3):c.1624C>T (p.Leu542Phe) | not specified [RCV004267612] | uncertain significance | 15 | 33584445 | 33584445 | Human | | name |
| 401747135 | CV2698793 | single nucleotide variant | NM_001036.6(RYR3):c.2653A>G (p.Ile885Val) | not specified [RCV004301241] | uncertain significance | 15 | 33628549 | 33628549 | Human | | name |
| 401778872 | CV2705817 | single nucleotide variant | NM_001036.6(RYR3):c.2173C>T (p.Pro725Ser) | not specified [RCV004320436] | uncertain significance | 15 | 33613191 | 33613191 | Human | | name |
| 401913436 | CV2801733 | single nucleotide variant | NM_001036.6(RYR3):c.1951G>A (p.Ala651Thr) | RYR3-related disorder [RCV003400134]|not provided [RCV004546794] | uncertain significance | 15 | 33603151 | 33603151 | Human | 1 | name , alternate_id |
| 401916031 | CV2817378 | single nucleotide variant | NM_001036.6(RYR3):c.1775G>A (p.Gly592Glu) | not provided [RCV003400841] | uncertain significance | 15 | 33586103 | 33586103 | Human | | name |
| 401916033 | CV2817379 | single nucleotide variant | NM_001036.6(RYR3):c.2195A>G (p.Asn732Ser) | not provided [RCV003400842] | uncertain significance | 15 | 33613213 | 33613213 | Human | | name |
| 401916040 | CV2817382 | single nucleotide variant | NM_001036.6(RYR3):c.2945T>C (p.Leu982Ser) | not provided [RCV003400844] | uncertain significance | 15 | 33633026 | 33633026 | Human | | name |
| 401916057 | CV2817388 | single nucleotide variant | NM_001036.6(RYR3):c.12909C>G (p.Leu4303=) | not provided [RCV003400849] | likely benign | 15 | 33838889 | 33838889 | Human | | name |
| 401934275 | CV2817389 | single nucleotide variant | NM_001036.6(RYR3):c.13989A>T (p.Val4663=) | not provided [RCV003411138] | likely benign | 15 | 33854894 | 33854894 | Human | | name |
| 405271258 | CV3218955 | single nucleotide variant | NM_001036.6(RYR3):c.12021C>T (p.Asn4007=) | RYR3-related disorder [RCV003971691] | likely benign | 15 | 33838001 | 33838001 | Human | | name , trait , alternate_id |
| 405701811 | CV3310124 | single nucleotide variant | NM_001036.6(RYR3):c.1466T>C (p.Ile489Thr) | not specified [RCV004447202] | uncertain significance | 15 | 33581536 | 33581536 | Human | | name |
| 405701824 | CV3310126 | single nucleotide variant | NM_001036.6(RYR3):c.2684G>A (p.Arg895Gln) | not specified [RCV004447204] | uncertain significance | 15 | 33629944 | 33629944 | Human | | name |
| 405853005 | CV3393436 | single nucleotide variant | NM_001036.6(RYR3):c.1307T>C (p.Ile436Thr) | not provided [RCV004546166] | uncertain significance | 15 | 33580014 | 33580014 | Human | | name |
| 407425600 | CV3409604 | single nucleotide variant | NM_001036.6(RYR3):c.10014C>T (p.Ala3338=) | not provided [RCV004585536] | uncertain significance | 15 | 33807557 | 33807557 | Human | | name |
| 407468901 | CV3473323 | single nucleotide variant | NM_001036.6(RYR3):c.2692A>G (p.Asn898Asp) | not specified [RCV004661285] | uncertain significance | 15 | 33629952 | 33629952 | Human | | name |
| 407468911 | CV3473328 | single nucleotide variant | NM_001036.6(RYR3):c.1264G>T (p.Val422Phe) | not specified [RCV004661288] | uncertain significance | 15 | 33566795 | 33566795 | Human | | name |
| 407468914 | CV3473331 | single nucleotide variant | NM_001036.6(RYR3):c.2372T>A (p.Met791Lys) | not specified [RCV004661289] | uncertain significance | 15 | 33623821 | 33623821 | Human | | name |
| 407468916 | CV3473333 | single nucleotide variant | NM_001036.6(RYR3):c.1348T>A (p.Phe450Ile) | not specified [RCV004661290] | uncertain significance | 15 | 33580055 | 33580055 | Human | | name |
| 597734372 | CV3597825 | single nucleotide variant | NM_001036.6(RYR3):c.1208A>C (p.Glu403Ala) | not specified [RCV004863467] | uncertain significance | 15 | 33566739 | 33566739 | Human | | name |
| 597734397 | CV3597830 | single nucleotide variant | NM_001036.6(RYR3):c.2560G>A (p.Val854Ile) | not specified [RCV004863472] | likely benign | 15 | 33624009 | 33624009 | Human | | name |
| 597734472 | CV3597844 | single nucleotide variant | NM_001036.6(RYR3):c.1306A>G (p.Ile436Val) | not specified [RCV004863486] | uncertain significance | 15 | 33580013 | 33580013 | Human | | name |
| 597734477 | CV3597845 | single nucleotide variant | NM_001036.6(RYR3):c.2261C>T (p.Ser754Leu) | not specified [RCV004863487] | uncertain significance | 15 | 33613279 | 33613279 | Human | | name |
| 597734489 | CV3597847 | single nucleotide variant | NM_001036.6(RYR3):c.2470G>T (p.Val824Phe) | not specified [RCV004863489] | uncertain significance | 15 | 33623919 | 33623919 | Human | | name |
| 597734550 | CV3597858 | single nucleotide variant | NM_001036.6(RYR3):c.1667C>T (p.Ser556Leu) | not specified [RCV004863500] | uncertain significance | 15 | 33584488 | 33584488 | Human | | name |
| 597734618 | CV3597870 | single nucleotide variant | NM_001036.6(RYR3):c.1999G>A (p.Asp667Asn) | not specified [RCV004863512] | uncertain significance | 15 | 33603199 | 33603199 | Human | | name |
| 597734623 | CV3597871 | single nucleotide variant | NM_001036.6(RYR3):c.1748C>T (p.Ser583Leu) | not specified [RCV004863513] | uncertain significance | 15 | 33586076 | 33586076 | Human | | name |
| 597734636 | CV3597873 | single nucleotide variant | NM_001036.6(RYR3):c.1004A>G (p.Lys335Arg) | not specified [RCV004863515] | uncertain significance | 15 | 33562868 | 33562868 | Human | | name |
| 597709884 | CV3707809 | single nucleotide variant | NM_001036.6(RYR3):c.2371A>T (p.Met791Leu) | Congenital myopathy 20 [RCV005009531] | uncertain significance | 15 | 33623820 | 33623820 | Human | 1 | name |
| 598129236 | CV3888530 | single nucleotide variant | NM_001036.6(RYR3):c.10839A>G (p.Lys3613=) | not provided [RCV005244704] | likely benign | 15 | 33821293 | 33821293 | Human | | name |
| 598207445 | CV3910208 | single nucleotide variant | NM_001036.6(RYR3):c.1711G>C (p.Glu571Gln) | not specified [RCV005270043] | uncertain significance | 15 | 33586039 | 33586039 | Human | | name |
| 598207468 | CV3910212 | single nucleotide variant | NM_001036.6(RYR3):c.2941A>G (p.Ile981Val) | not specified [RCV005270047] | uncertain significance | 15 | 33633022 | 33633022 | Human | | name |
| 616939990 | CV4014285 | single nucleotide variant | NM_001036.6(RYR3):c.1472G>C (p.Arg491Pro) | not provided [RCV005413779] | uncertain significance | 15 | 33581542 | 33581542 | Human | | name |
| 13476419 | CV463972 | single nucleotide variant | NM_001036.6(RYR3):c.1073T>C (p.Ile358Thr) | Epileptic encephalopathy [RCV000526731]|not provided [RCV004716528] | benign | 15 | 33562937 | 33562937 | Human | 2 | name |
| 13480059 | CV463974 | single nucleotide variant | NM_001036.6(RYR3):c.1277A>G (p.Asn426Ser) | Epileptic encephalopathy [RCV000550799]|RYR3-related disorder [RCV003942774]|not provided [RCV005411481] | benign|likely benign | 15 | 33579984 | 33579984 | Human | 3 | name , alternate_id |
| 13498976 | CV463976 | single nucleotide variant | NM_001036.6(RYR3):c.1295T>G (p.Ile432Ser) | Epileptic encephalopathy [RCV000539537]|RYR3-related disorder [RCV003915528] | benign | 15 | 33580002 | 33580002 | Human | 3 | name , alternate_id |
| 13491602 | CV463981 | single nucleotide variant | NM_001036.6(RYR3):c.1373G>A (p.Arg458Gln) | Epileptic encephalopathy [RCV000556837]|not provided [RCV003409784]|not specified [RCV004023870] | likely benign | 15 | 33580080 | 33580080 | Human | 2 | name |
| 13489808 | CV463982 | single nucleotide variant | NM_001036.6(RYR3):c.1487A>G (p.Asn496Ser) | Epileptic encephalopathy [RCV000555548] | uncertain significance | 15 | 33581557 | 33581557 | Human | 2 | name |
| 13481029 | CV463994 | single nucleotide variant | NM_001036.6(RYR3):c.2693A>G (p.Asn898Ser) | Epileptic encephalopathy [RCV000528783] | benign | 15 | 33629953 | 33629953 | Human | 2 | name |
| 13497327 | CV463997 | single nucleotide variant | NM_001036.6(RYR3):c.2770A>G (p.Thr924Ala) | Epileptic encephalopathy [RCV000538508]|RYR3-related disorder [RCV003942775]|not provided [RCV004705656]|not specified [RCV004023873] | likely benign|uncertain significance | 15 | 33630030 | 33630030 | Human | 3 | name , alternate_id |
| 13486878 | CV464111 | single nucleotide variant | NM_001036.6(RYR3):c.11289C>T (p.Thr3763=) | Epileptic encephalopathy [RCV000531497]|not provided [RCV002510916] | benign|likely benign | 15 | 33827242 | 33827242 | Human | 2 | name |
| 13503860 | CV464113 | single nucleotide variant | NM_001036.6(RYR3):c.12516G>C (p.Val4172=) | Epileptic encephalopathy [RCV000547748]|not provided [RCV001683561] | benign | 15 | 33838496 | 33838496 | Human | 2 | name |
| 13489180 | CV464130 | single nucleotide variant | NM_001036.6(RYR3):c.13353C>G (p.Ser4451=) | Epileptic encephalopathy [RCV001473249] | likely benign | 15 | 33844918 | 33844918 | Human | 2 | name |
| 13490821 | CV464133 | single nucleotide variant | NM_001036.6(RYR3):c.14028C>T (p.Leu4676=) | Epileptic encephalopathy [RCV001426485] | likely benign | 15 | 33857800 | 33857800 | Human | 2 | name |
| 13478957 | CV464135 | single nucleotide variant | NM_001036.6(RYR3):c.14130C>T (p.Asp4710=) | Epileptic encephalopathy [RCV000527862] | likely benign | 15 | 33857902 | 33857902 | Human | 2 | name |
| 13483917 | CV464139 | single nucleotide variant | NM_001036.6(RYR3):c.14280C>T (p.Ile4760=) | Epileptic encephalopathy [RCV000552523]|RYR3-related disorder [RCV003925621]|not provided [RCV002263763] | likely benign | 15 | 33859712 | 33859712 | Human | 3 | name , alternate_id |
| 13488220 | CV464576 | single nucleotide variant | NM_001036.6(RYR3):c.1514C>T (p.Ala505Val) | Epileptic encephalopathy [RCV000554692] | uncertain significance | 15 | 33581584 | 33581584 | Human | 2 | name |
| 13465527 | CV464582 | single nucleotide variant | NM_001036.6(RYR3):c.1828G>A (p.Val610Ile) | Epileptic encephalopathy [RCV000542886]|not provided [RCV004715269] | benign | 15 | 33601458 | 33601458 | Human | 2 | name |
| 13494477 | CV464686 | single nucleotide variant | NM_001036.6(RYR3):c.12129T>C (p.Arg4043=) | Epileptic encephalopathy [RCV000558938]|not provided [RCV004715266] | benign | 15 | 33838109 | 33838109 | Human | 2 | name |
| 13504397 | CV464694 | single nucleotide variant | NM_001036.6(RYR3):c.14118T>C (p.Asp4706=) | Epileptic encephalopathy [RCV000528818]|not provided [RCV004716531] | benign | 15 | 33857890 | 33857890 | Human | 2 | name |
| 13493534 | CV464822 | single nucleotide variant | NM_001036.6(RYR3):c.1354C>A (p.Pro452Thr) | Epileptic encephalopathy [RCV000558258]|not specified [RCV004659091] | likely benign|uncertain significance | 15 | 33580061 | 33580061 | Human | 2 | name |
| 13468232 | CV464826 | single nucleotide variant | NM_001036.6(RYR3):c.1492G>A (p.Val498Ile) | Epileptic encephalopathy [RCV000544392] | uncertain significance | 15 | 33581562 | 33581562 | Human | 2 | name |
| 13493876 | CV464827 | single nucleotide variant | NM_001036.6(RYR3):c.2221G>A (p.Val741Met) | Epileptic encephalopathy [RCV000558500] | uncertain significance | 15 | 33613239 | 33613239 | Human | 2 | name |
| 13495219 | CV464828 | single nucleotide variant | NM_001036.6(RYR3):c.2486G>A (p.Arg829His) | Epileptic encephalopathy [RCV000536968]|Flexion contracture [RCV001007845]|not provided [RCV003403277] | likely benign|uncertain significance | 15 | 33623935 | 33623935 | Human | 4 | name |
| 13479087 | CV464835 | single nucleotide variant | NM_001036.6(RYR3):c.2599A>G (p.Lys867Glu) | Epileptic encephalopathy [RCV000550354]|not specified [RCV004023872] | likely benign|uncertain significance | 15 | 33628495 | 33628495 | Human | 2 | name |
| 13504323 | CV464839 | single nucleotide variant | NM_001036.6(RYR3):c.2860C>T (p.Pro954Ser) | Epileptic encephalopathy [RCV000527290] | uncertain significance | 15 | 33631286 | 33631286 | Human | 2 | name |
| 13495536 | CV464902 | single nucleotide variant | NM_001036.6(RYR3):c.10278A>G (p.Lys3426=) | Epileptic encephalopathy [RCV000537205]|not provided [RCV004715263] | benign | 15 | 33812883 | 33812883 | Human | 2 | name |
| 13496600 | CV464907 | single nucleotide variant | NM_001036.6(RYR3):c.10569C>A (p.Ser3523=) | Epileptic encephalopathy [RCV000537966] | benign | 15 | 33816928 | 33816928 | Human | 2 | name |
| 13494217 | CV464908 | single nucleotide variant | NM_001036.6(RYR3):c.10113C>A (p.Leu3371=) | Epileptic encephalopathy [RCV001396170] | likely benign | 15 | 33810565 | 33810565 | Human | 2 | name |
| 13474573 | CV464911 | single nucleotide variant | NM_001036.6(RYR3):c.10719C>T (p.Asp3573=) | Epileptic encephalopathy [RCV000548329]|not provided [RCV004715264] | benign | 15 | 33819768 | 33819768 | Human | 2 | name |
| 13480205 | CV464915 | single nucleotide variant | NM_001036.6(RYR3):c.10971C>T (p.Asn3657=) | Epileptic encephalopathy [RCV000528427]|not provided [RCV003403275] | likely benign | 15 | 33821578 | 33821578 | Human | 2 | name |
| 13485097 | CV464925 | single nucleotide variant | NM_001036.6(RYR3):c.11196G>A (p.Thr3732=) | Epileptic encephalopathy [RCV000553075]|not provided [RCV003326455] | benign|likely benign | 15 | 33826703 | 33826703 | Human | 2 | name |
| 13469819 | CV464926 | single nucleotide variant | NM_001036.6(RYR3):c.11859G>A (p.Gln3953=) | Epileptic encephalopathy [RCV000545667]|RYR3-related disorder [RCV003905363]|not provided [RCV004704062] | likely benign | 15 | 33837839 | 33837839 | Human | 3 | name , alternate_id |
| 13495812 | CV464928 | single nucleotide variant | NM_001036.6(RYR3):c.12381G>A (p.Ala4127=) | Epileptic encephalopathy [RCV000537405] | likely benign | 15 | 33838361 | 33838361 | Human | 2 | name |
| 13483074 | CV464929 | single nucleotide variant | NM_001036.6(RYR3):c.11397G>A (p.Gln3799=) | Epileptic encephalopathy [RCV000552139] | likely benign | 15 | 33831025 | 33831025 | Human | 2 | name |
| 13475191 | CV464930 | single nucleotide variant | NM_001036.6(RYR3):c.12558C>G (p.Ser4186=) | Epileptic encephalopathy [RCV000526175]|not provided [RCV004716530] | benign | 15 | 33838538 | 33838538 | Human | 2 | name |
| 13489773 | CV464931 | single nucleotide variant | NM_001036.6(RYR3):c.13365G>A (p.Glu4455=) | Epileptic encephalopathy [RCV000533096]|not provided [RCV004715267] | benign | 15 | 33844930 | 33844930 | Human | 2 | name |
| 13504555 | CV464944 | single nucleotide variant | NM_001036.6(RYR3):c.13569C>T (p.Thr4523=) | Epileptic encephalopathy [RCV000532190] | likely benign | 15 | 33848362 | 33848362 | Human | 2 | name |
| 13491911 | CV464957 | single nucleotide variant | NM_001036.6(RYR3):c.14124G>A (p.Lys4708=) | Epileptic encephalopathy [RCV000534560] | likely benign | 15 | 33857896 | 33857896 | Human | 2 | name |
| 13477212 | CV464966 | single nucleotide variant | NM_001036.6(RYR3):c.14127C>T (p.Cys4709=) | Epileptic encephalopathy [RCV000549483]|RYR3-related disorder [RCV003960291] | likely benign | 15 | 33857899 | 33857899 | Human | 3 | name , alternate_id |
| 13464400 | CV464969 | single nucleotide variant | NM_001036.6(RYR3):c.14268C>T (p.Phe4756=) | Epileptic encephalopathy [RCV000542162]|not provided [RCV004715268] | benign | 15 | 33859700 | 33859700 | Human | 2 | name |
| 13605746 | CV528612 | single nucleotide variant | NM_001036.6(RYR3):c.1342G>A (p.Ala448Thr) | Epileptic encephalopathy [RCV000637156]|not specified [RCV004857723] | uncertain significance | 15 | 33580049 | 33580049 | Human | 2 | name |
| 13605726 | CV528614 | single nucleotide variant | NM_001036.6(RYR3):c.1945G>C (p.Gly649Arg) | Epileptic encephalopathy [RCV000637136]|not provided [RCV003403465] | uncertain significance | 15 | 33603145 | 33603145 | Human | 2 | name |
| 13605662 | CV528616 | single nucleotide variant | NM_001036.6(RYR3):c.2675G>A (p.Gly892Asp) | Epileptic encephalopathy [RCV000637072] | uncertain significance | 15 | 33628571 | 33628571 | Human | 2 | name |
| 13605718 | CV528628 | single nucleotide variant | NM_001036.6(RYR3):c.1400G>A (p.Arg467His) | Epileptic encephalopathy [RCV000637128] | uncertain significance | 15 | 33580107 | 33580107 | Human | 2 | name |
| 13605897 | CV528681 | single nucleotide variant | NM_001036.6(RYR3):c.10698G>A (p.Thr3566=) | Epileptic encephalopathy [RCV000637279]|RYR3-related disorder [RCV003965341]|not provided [RCV002060736] | benign|likely benign|conflicting interpretations of pathogenicity|uncertain significance | 15 | 33818676 | 33818676 | Human | 3 | name , alternate_id |
| 13605772 | CV528686 | single nucleotide variant | NM_001036.6(RYR3):c.10806A>G (p.Lys3602=) | Epileptic encephalopathy [RCV000637182] | likely benign | 15 | 33820803 | 33820803 | Human | 2 | name |
| 13605894 | CV528709 | single nucleotide variant | NM_001036.6(RYR3):c.14319C>T (p.Phe4773=) | Epileptic encephalopathy [RCV000637276] | likely benign | 15 | 33860614 | 33860614 | Human | 2 | name |
| 13605841 | CV528737 | single nucleotide variant | NM_001036.6(RYR3):c.11514C>T (p.Asp3838=) | Epileptic encephalopathy [RCV000637252] | likely benign | 15 | 33835018 | 33835018 | Human | 2 | name |
| 13605798 | CV528740 | single nucleotide variant | NM_001036.6(RYR3):c.11931T>G (p.Val3977=) | Epileptic encephalopathy [RCV000637191] | likely benign | 15 | 33837911 | 33837911 | Human | 2 | name |
| 13605824 | CV529071 | single nucleotide variant | NM_001036.6(RYR3):c.10674C>G (p.Leu3558=) | Epileptic encephalopathy [RCV000637235] | likely benign | 15 | 33818652 | 33818652 | Human | 2 | name |
| 13605819 | CV529080 | single nucleotide variant | NM_001036.6(RYR3):c.13635T>C (p.Phe4545=) | Epileptic encephalopathy [RCV001472831] | likely benign | 15 | 33853051 | 33853051 | Human | 2 | name |
| 13605709 | CV529085 | single nucleotide variant | NM_001036.6(RYR3):c.1777C>T (p.Arg593Trp) | Epileptic encephalopathy [RCV000637119] | uncertain significance | 15 | 33586105 | 33586105 | Human | 2 | name |
| 13605701 | CV529093 | single nucleotide variant | NM_001036.6(RYR3):c.2102G>A (p.Gly701Glu) | Epileptic encephalopathy [RCV000637111] | uncertain significance | 15 | 33603302 | 33603302 | Human | 2 | name |
| 13605804 | CV529096 | single nucleotide variant | NM_001036.6(RYR3):c.13938A>G (p.Leu4646=) | Epileptic encephalopathy [RCV000637214]|RYR3-related disorder [RCV003953129] | benign|likely benign | 15 | 33854843 | 33854843 | Human | 3 | name , alternate_id |
| 13605809 | CV529204 | single nucleotide variant | NM_001036.6(RYR3):c.10959C>T (p.Ile3653=) | Epileptic encephalopathy [RCV000637219] | likely benign | 15 | 33821566 | 33821566 | Human | 2 | name |
| 13605831 | CV529209 | single nucleotide variant | NM_001036.6(RYR3):c.11067T>G (p.Ser3689=) | Epileptic encephalopathy [RCV000637243] | likely benign | 15 | 33823067 | 33823067 | Human | 2 | name |
| 13605890 | CV529223 | single nucleotide variant | NM_001036.6(RYR3):c.14370A>G (p.Lys4790=) | Epileptic encephalopathy [RCV001521954] | benign | 15 | 33861083 | 33861083 | Human | 2 | name |
| 13822342 | CV566905 | single nucleotide variant | NM_001036.6(RYR3):c.1072A>G (p.Ile358Val) | Epileptic encephalopathy [RCV000697175] | uncertain significance | 15 | 33562936 | 33562936 | Human | 2 | name |
| 13815810 | CV566907 | single nucleotide variant | NM_001036.6(RYR3):c.1303C>T (p.Pro435Ser) | Epileptic encephalopathy [RCV000705939] | uncertain significance | 15 | 33580010 | 33580010 | Human | 2 | name |
| 13815550 | CV566909 | single nucleotide variant | NM_001036.6(RYR3):c.2083G>A (p.Gly695Arg) | Epileptic encephalopathy [RCV000691675] | uncertain significance | 15 | 33603283 | 33603283 | Human | 2 | name |
| 13822385 | CV568647 | single nucleotide variant | NM_001036.6(RYR3):c.1463G>T (p.Cys488Phe) | Epileptic encephalopathy [RCV000697234] | uncertain significance | 15 | 33581533 | 33581533 | Human | 2 | name |
| 13814423 | CV568648 | single nucleotide variant | NM_001036.6(RYR3):c.1904T>A (p.Leu635Gln) | Epileptic encephalopathy [RCV000690866] | uncertain significance | 15 | 33601534 | 33601534 | Human | 2 | name |
| 13812129 | CV568651 | single nucleotide variant | NM_001036.6(RYR3):c.2812G>T (p.Ala938Ser) | Epileptic encephalopathy [RCV000703503]|not specified [RCV004026630] | uncertain significance | 15 | 33631238 | 33631238 | Human | 2 | name |
| 13821936 | CV569251 | single nucleotide variant | NM_001036.6(RYR3):c.1312G>A (p.Glu438Lys) | Epileptic encephalopathy [RCV000696583] | uncertain significance | 15 | 33580019 | 33580019 | Human | 2 | name |
| 13815722 | CV569254 | single nucleotide variant | NM_001036.6(RYR3):c.2443C>G (p.Pro815Ala) | Epileptic encephalopathy [RCV000705886] | uncertain significance | 15 | 33623892 | 33623892 | Human | 2 | name |
| 13811492 | CV573152 | single nucleotide variant | NM_001036.6(RYR3):c.1994T>C (p.Ile665Thr) | Epileptic encephalopathy [RCV000688786]|not specified [RCV004659167] | uncertain significance | 15 | 33603194 | 33603194 | Human | 2 | name |
| 13804449 | CV573155 | single nucleotide variant | NM_001036.6(RYR3):c.2785A>G (p.Thr929Ala) | Epileptic encephalopathy [RCV000699618] | uncertain significance | 15 | 33631211 | 33631211 | Human | 2 | name |
| 13808599 | CV573183 | single nucleotide variant | NM_001036.6(RYR3):c.11124G>T (p.Gly3708=) | Epileptic encephalopathy [RCV000687347] | likely benign|uncertain significance | 15 | 33825654 | 33825654 | Human | 2 | name |
| 14729469 | CV643019 | single nucleotide variant | NM_001036.6(RYR3):c.1067A>G (p.Gln356Arg) | Epileptic encephalopathy [RCV000816966]|not specified [RCV004028902] | uncertain significance | 15 | 33562931 | 33562931 | Human | 2 | name |
| 14702587 | CV643020 | single nucleotide variant | NM_001036.6(RYR3):c.1157A>G (p.His386Arg) | Epileptic encephalopathy [RCV000807025] | uncertain significance | 15 | 33566688 | 33566688 | Human | 2 | name |
| 14738897 | CV643021 | single nucleotide variant | NM_001036.6(RYR3):c.1279C>T (p.Arg427Cys) | Epileptic encephalopathy [RCV000804722] | uncertain significance | 15 | 33579986 | 33579986 | Human | 2 | name |
| 14721974 | CV643022 | single nucleotide variant | NM_001036.6(RYR3):c.1280G>A (p.Arg427His) | Epileptic encephalopathy [RCV000813710]|not provided [RCV004693354] | uncertain significance | 15 | 33579987 | 33579987 | Human | 2 | name |
| 14708078 | CV643023 | single nucleotide variant | NM_001036.6(RYR3):c.1291C>G (p.Pro431Ala) | Epileptic encephalopathy [RCV000792497] | likely benign|uncertain significance | 15 | 33579998 | 33579998 | Human | 2 | name |
| 14724709 | CV643024 | single nucleotide variant | NM_001036.6(RYR3):c.1392C>G (p.Asn464Lys) | Epileptic encephalopathy [RCV000798501] | uncertain significance | 15 | 33580099 | 33580099 | Human | 2 | name |
| 14722279 | CV643025 | single nucleotide variant | NM_001036.6(RYR3):c.1472G>A (p.Arg491His) | Epileptic encephalopathy [RCV000797470] | uncertain significance | 15 | 33581542 | 33581542 | Human | 2 | name |
| 14731357 | CV643026 | single nucleotide variant | NM_001036.6(RYR3):c.1585C>T (p.Arg529Cys) | Epileptic encephalopathy [RCV000801379] | uncertain significance | 15 | 33584406 | 33584406 | Human | 2 | name |
| 14738055 | CV643027 | single nucleotide variant | NM_001036.6(RYR3):c.1623C>A (p.Asn541Lys) | Epileptic encephalopathy [RCV000804337] | uncertain significance | 15 | 33584444 | 33584444 | Human | 2 | name |
| 14715526 | CV643028 | single nucleotide variant | NM_001036.6(RYR3):c.1877G>A (p.Arg626Gln) | Epileptic encephalopathy [RCV000794799] | uncertain significance | 15 | 33601507 | 33601507 | Human | 2 | name |
| 14726598 | CV643029 | single nucleotide variant | NM_001036.6(RYR3):c.1900C>T (p.Arg634Ter) | Epileptic encephalopathy [RCV000815696] | uncertain significance | 15 | 33601530 | 33601530 | Human | 2 | name |
| 14708317 | CV643030 | single nucleotide variant | NM_001036.6(RYR3):c.2235C>A (p.Cys745Ter) | Epileptic encephalopathy [RCV000809046] | uncertain significance | 15 | 33613253 | 33613253 | Human | 2 | name |
| 14736302 | CV643098 | single nucleotide variant | NM_001036.6(RYR3):c.14031G>A (p.Leu4677=) | Epileptic encephalopathy [RCV000819964] | likely benign|uncertain significance | 15 | 33857803 | 33857803 | Human | 2 | name |
| 15146609 | CV693654 | single nucleotide variant | NM_001036.6(RYR3):c.13167C>T (p.Ala4389=) | Epileptic encephalopathy [RCV000878587] | benign | 15 | 33841993 | 33841993 | Human | 2 | name |
| 15153026 | CV703120 | single nucleotide variant | NM_001036.6(RYR3):c.1007G>A (p.Arg336Gln) | Epileptic encephalopathy [RCV000945999] | likely benign | 15 | 33562871 | 33562871 | Human | 2 | name |
| 15192554 | CV703122 | single nucleotide variant | NM_001036.6(RYR3):c.1840G>A (p.Ala614Thr) | Epileptic encephalopathy [RCV000955106]|not specified [RCV004800646] | benign|uncertain significance | 15 | 33601470 | 33601470 | Human | 2 | name |
| 15104575 | CV703134 | single nucleotide variant | NM_001036.6(RYR3):c.13207C>T (p.Leu4403=) | Epileptic encephalopathy [RCV000959714]|not provided [RCV001532253] | likely benign|uncertain significance | 15 | 33842033 | 33842033 | Human | 2 | name |
| 15109817 | CV714389 | single nucleotide variant | NM_001036.6(RYR3):c.2747A>C (p.Lys916Thr) | Epileptic encephalopathy [RCV000960776] | likely benign | 15 | 33630007 | 33630007 | Human | 2 | name |
| 15142927 | CV714398 | single nucleotide variant | NM_001036.6(RYR3):c.14163C>T (p.Tyr4721=) | Epileptic encephalopathy [RCV000966577]|RYR3-related disorder [RCV003936021] | likely benign | 15 | 33859595 | 33859595 | Human | 3 | name , alternate_id |
| 15188302 | CV726012 | single nucleotide variant | NM_001036.6(RYR3):c.10743C>G (p.Ser3581=) | Epileptic encephalopathy [RCV000887495]|not provided [RCV003884786] | likely benign | 15 | 33819792 | 33819792 | Human | 2 | name |
| 15167952 | CV726013 | single nucleotide variant | NM_001036.6(RYR3):c.13698C>T (p.Tyr4566=) | Epileptic encephalopathy [RCV001505848] | likely benign | 15 | 33853581 | 33853581 | Human | 2 | name |
| 15122965 | CV739555 | single nucleotide variant | NM_001036.6(RYR3):c.12096C>T (p.Ile4032=) | Epileptic encephalopathy [RCV000896329] | likely benign | 15 | 33838076 | 33838076 | Human | 2 | name |
| 15160230 | CV739556 | single nucleotide variant | NM_001036.6(RYR3):c.14046T>C (p.Tyr4682=) | not provided [RCV000903102] | likely benign | 15 | 33857818 | 33857818 | Human | | name |
| 15158898 | CV739557 | single nucleotide variant | NM_001036.6(RYR3):c.14097C>T (p.Ser4699=) | Epileptic encephalopathy [RCV000902826] | likely benign | 15 | 33857869 | 33857869 | Human | 2 | name |
| 15168650 | CV739559 | single nucleotide variant | NM_001036.6(RYR3):c.14418T>C (p.His4806=) | Epileptic encephalopathy [RCV000904900] | likely benign | 15 | 33861131 | 33861131 | Human | 2 | name |
| 15137169 | CV739560 | single nucleotide variant | NM_001036.6(RYR3):c.14511G>A (p.Thr4837=) | Epileptic encephalopathy [RCV000898754] | likely benign | 15 | 33864183 | 33864183 | Human | 2 | name |
| 15134829 | CV739561 | single nucleotide variant | NM_001036.6(RYR3):c.14571C>T (p.Ala4857=) | Epileptic encephalopathy [RCV000898356] | likely benign | 15 | 33865184 | 33865184 | Human | 2 | name |
| 15128281 | CV754382 | single nucleotide variant | NM_001036.6(RYR3):c.12402G>A (p.Gly4134=) | Epileptic encephalopathy [RCV000919627] | likely benign | 15 | 33838382 | 33838382 | Human | 2 | name |
| 15098030 | CV754383 | single nucleotide variant | NM_001036.6(RYR3):c.13380G>A (p.Ala4460=) | Epileptic encephalopathy [RCV000914150] | likely benign | 15 | 33844945 | 33844945 | Human | 2 | name |
| 15099613 | CV754384 | single nucleotide variant | NM_001036.6(RYR3):c.13716T>A (p.Ala4572=) | not provided [RCV000914482] | likely benign | 15 | 33853599 | 33853599 | Human | | name |
| 15163186 | CV754385 | single nucleotide variant | NM_001036.6(RYR3):c.14034C>T (p.Ala4678=) | Epileptic encephalopathy [RCV000926066] | likely benign | 15 | 33857806 | 33857806 | Human | 2 | name |
| 15163463 | CV754386 | single nucleotide variant | NM_001036.6(RYR3):c.14103C>T (p.Asp4701=) | Epileptic encephalopathy [RCV000926134]|not provided [RCV004808964] | likely benign | 15 | 33857875 | 33857875 | Human | 2 | name |
| 15197713 | CV770091 | single nucleotide variant | NM_001036.6(RYR3):c.10731C>T (p.Tyr3577=) | not provided [RCV000934591] | likely benign | 15 | 33819780 | 33819780 | Human | | name |
| 15176175 | CV770092 | single nucleotide variant | NM_001036.6(RYR3):c.11298C>A (p.Val3766=) | Epileptic encephalopathy [RCV000928858]|RYR3-related disorder [RCV003903076] | likely benign | 15 | 33827251 | 33827251 | Human | 3 | name , alternate_id |
| 15193093 | CV770093 | single nucleotide variant | NM_001036.6(RYR3):c.11695C>T (p.Leu3899=) | Epileptic encephalopathy [RCV000933269] | likely benign | 15 | 33837675 | 33837675 | Human | 2 | name |
| 15144501 | CV770094 | single nucleotide variant | NM_001036.6(RYR3):c.12642G>A (p.Val4214=) | Epileptic encephalopathy [RCV001492709] | likely benign | 15 | 33838622 | 33838622 | Human | 2 | name |
| 15103349 | CV770095 | single nucleotide variant | NM_001036.6(RYR3):c.13071A>G (p.Lys4357=) | Epileptic encephalopathy [RCV001394050] | likely benign | 15 | 33841897 | 33841897 | Human | 2 | name |
| 15134000 | CV770096 | single nucleotide variant | NM_001036.6(RYR3):c.13437C>T (p.Ala4479=) | Epileptic encephalopathy [RCV001440412] | likely benign | 15 | 33845002 | 33845002 | Human | 2 | name |
| 15116386 | CV770097 | single nucleotide variant | NM_001036.6(RYR3):c.13801C>T (p.Leu4601=) | Epileptic encephalopathy [RCV001406969] | likely benign | 15 | 33854390 | 33854390 | Human | 2 | name |
| 15115660 | CV770098 | single nucleotide variant | NM_001036.6(RYR3):c.13884T>C (p.Tyr4628=) | Epileptic encephalopathy [RCV001429670] | likely benign | 15 | 33854789 | 33854789 | Human | 2 | name |
| 15125612 | CV784886 | single nucleotide variant | NM_001036.6(RYR3):c.12810G>T (p.Gly4270=) | Epileptic encephalopathy [RCV001483457] | likely benign | 15 | 33838790 | 33838790 | Human | 2 | name |
| 21074559 | CV797111 | single nucleotide variant | NM_001036.6(RYR3):c.1539G>A (p.Trp513Ter) | not provided [RCV000995287] | uncertain significance | 15 | 33581609 | 33581609 | Human | | name |
| 25322660 | CV805051 | single nucleotide variant | NM_001036.6(RYR3):c.2000A>G (p.Asp667Gly) | Congenital myopathy 20 [RCV003160165]|Flexion contracture [RCV001007853] | pathogenic|uncertain significance | 15 | 33603200 | 33603200 | Human | 3 | name |
| 26896762 | CV842141 | single nucleotide variant | NM_001036.6(RYR3):c.1079G>A (p.Ser360Asn) | Epileptic encephalopathy [RCV001064869] | uncertain significance | 15 | 33562943 | 33562943 | Human | 2 | name |
| 26920155 | CV842142 | single nucleotide variant | NM_001036.6(RYR3):c.1111G>A (p.Ala371Thr) | Epileptic encephalopathy [RCV001047064] | uncertain significance | 15 | 33562975 | 33562975 | Human | 2 | name |
| 26905296 | CV842143 | single nucleotide variant | NM_001036.6(RYR3):c.1234C>T (p.Arg412Trp) | Epileptic encephalopathy [RCV001071797] | uncertain significance | 15 | 33566765 | 33566765 | Human | 2 | name |
| 26913083 | CV842144 | single nucleotide variant | NM_001036.6(RYR3):c.1413C>G (p.Asn471Lys) | Epileptic encephalopathy [RCV001035155]|not specified [RCV004030947] | uncertain significance | 15 | 33580120 | 33580120 | Human | 2 | name |
| 26884752 | CV842145 | single nucleotide variant | NM_001036.6(RYR3):c.2317G>A (p.Gly773Arg) | Epileptic encephalopathy [RCV001052480] | uncertain significance | 15 | 33613335 | 33613335 | Human | 2 | name |
| 26920295 | CV842146 | single nucleotide variant | NM_001036.6(RYR3):c.2353G>A (p.Val785Ile) | Epileptic encephalopathy [RCV001047300] | uncertain significance | 15 | 33613371 | 33613371 | Human | 2 | name |
| 26921946 | CV842147 | single nucleotide variant | NM_001036.6(RYR3):c.2363G>A (p.Arg788His) | Epileptic encephalopathy [RCV001051102] | uncertain significance | 15 | 33623812 | 33623812 | Human | 2 | name |
| 26917963 | CV842148 | single nucleotide variant | NM_001036.6(RYR3):c.2420C>T (p.Ala807Val) | Epileptic encephalopathy [RCV001042549]|not specified [RCV005268864] | uncertain significance | 15 | 33623869 | 33623869 | Human | 2 | name |
| 26921490 | CV842149 | single nucleotide variant | NM_001036.6(RYR3):c.2470G>C (p.Val824Leu) | Epileptic encephalopathy [RCV001050026] | uncertain significance | 15 | 33623919 | 33623919 | Human | 2 | name |
| 26916129 | CV842150 | single nucleotide variant | NM_001036.6(RYR3):c.2593C>G (p.Leu865Val) | Epileptic encephalopathy [RCV001039950] | uncertain significance | 15 | 33628489 | 33628489 | Human | 2 | name |
| 26891967 | CV842151 | single nucleotide variant | NM_001036.6(RYR3):c.2621A>T (p.Glu874Val) | Epileptic encephalopathy [RCV001061154] | uncertain significance | 15 | 33628517 | 33628517 | Human | 2 | name |
| 26916103 | CV842152 | single nucleotide variant | NM_001036.6(RYR3):c.2654T>C (p.Ile885Thr) | Epileptic encephalopathy [RCV001039898] | uncertain significance | 15 | 33628550 | 33628550 | Human | 2 | name |
| 26891038 | CV842153 | single nucleotide variant | NM_001036.6(RYR3):c.2705A>G (p.His902Arg) | Epileptic encephalopathy [RCV001060055] | uncertain significance | 15 | 33629965 | 33629965 | Human | 2 | name |
| 26905477 | CV842154 | single nucleotide variant | NM_001036.6(RYR3):c.2801G>A (p.Gly934Glu) | Epileptic encephalopathy [RCV001071968] | uncertain significance | 15 | 33631227 | 33631227 | Human | 2 | name |
| 26891231 | CV842155 | single nucleotide variant | NM_001036.6(RYR3):c.2872A>G (p.Met958Val) | Epileptic encephalopathy [RCV001060239]|not specified [RCV005268892] | uncertain significance | 15 | 33632953 | 33632953 | Human | 2 | name |
| 8635403 | CV90624 | single nucleotide variant | NM_001036.6(RYR3):c.2168G>A (p.Arg723Gln) | Epileptic encephalopathy [RCV001215388] | uncertain significance|not provided | 15 | 33613186 | 33613186 | Human | 2 | name |
| 40903991 | CV918088 | single nucleotide variant | NM_001036.6(RYR3):c.2567C>G (p.Thr856Ser) | Premature ovarian failure [RCV001270226] | uncertain significance | 15 | 33624016 | 33624016 | Human | 2 | name |
| 38476417 | CV927270 | single nucleotide variant | NM_001036.6(RYR3):c.1650C>G (p.Asp550Glu) | Epileptic encephalopathy [RCV001215631] | uncertain significance | 15 | 33584471 | 33584471 | Human | 2 | name |
| 38480249 | CV927271 | single nucleotide variant | NM_001036.6(RYR3):c.1901G>A (p.Arg634Gln) | Epileptic encephalopathy [RCV001217455] | uncertain significance | 15 | 33601531 | 33601531 | Human | 2 | name |
| 38477001 | CV927272 | single nucleotide variant | NM_001036.6(RYR3):c.2074C>T (p.Pro692Ser) | Epileptic encephalopathy [RCV001215931] | uncertain significance | 15 | 33603274 | 33603274 | Human | 2 | name |
| 38485413 | CV927273 | single nucleotide variant | NM_001036.6(RYR3):c.2500A>C (p.Ile834Leu) | Epileptic encephalopathy [RCV001219861] | uncertain significance | 15 | 33623949 | 33623949 | Human | 2 | name |
| 38487855 | CV927274 | single nucleotide variant | NM_001036.6(RYR3):c.2756A>T (p.Asn919Ile) | Epileptic encephalopathy [RCV001220919] | uncertain significance | 15 | 33630016 | 33630016 | Human | 2 | name |
| 38483872 | CV927297 | single nucleotide variant | NM_001036.6(RYR3):c.14058G>A (p.Val4686=) | Epileptic encephalopathy [RCV001219153] | uncertain significance | 15 | 33857830 | 33857830 | Human | 2 | name |
| 38484293 | CV936860 | single nucleotide variant | NM_001036.6(RYR3):c.1204C>T (p.Arg402Cys) | Epileptic encephalopathy [RCV001207988] | uncertain significance | 15 | 33566735 | 33566735 | Human | 2 | name |
| 38479188 | CV936861 | single nucleotide variant | NM_001036.6(RYR3):c.1987G>A (p.Glu663Lys) | Epileptic encephalopathy [RCV001205872] | uncertain significance | 15 | 33603187 | 33603187 | Human | 2 | name |
| 38464988 | CV936862 | single nucleotide variant | NM_001036.6(RYR3):c.2677A>G (p.Lys893Glu) | Epileptic encephalopathy [RCV001212574] | uncertain significance | 15 | 33628573 | 33628573 | Human | 2 | name |
| 38484006 | CV936863 | single nucleotide variant | NM_001036.6(RYR3):c.2846A>G (p.Lys949Arg) | Epileptic encephalopathy [RCV001207866]|not specified [RCV004033709] | uncertain significance | 15 | 33631272 | 33631272 | Human | 2 | name |
| 38479943 | CV936864 | single nucleotide variant | NM_001036.6(RYR3):c.2884G>A (p.Gly962Ser) | Epileptic encephalopathy [RCV001206191] | uncertain significance | 15 | 33632965 | 33632965 | Human | 2 | name |
| 38485394 | CV948812 | single nucleotide variant | NM_001036.6(RYR3):c.1321C>A (p.Gln441Lys) | Epileptic encephalopathy [RCV001236739] | uncertain significance | 15 | 33580028 | 33580028 | Human | 2 | name |
| 38478782 | CV948813 | single nucleotide variant | NM_001036.6(RYR3):c.1884C>A (p.Asn628Lys) | Epileptic encephalopathy [RCV001234041] | uncertain significance | 15 | 33601514 | 33601514 | Human | 2 | name |
| 38497655 | CV948814 | single nucleotide variant | NM_001036.6(RYR3):c.2646G>T (p.Met882Ile) | Epileptic encephalopathy [RCV001227224] | uncertain significance | 15 | 33628542 | 33628542 | Human | 2 | name |
| 126738193 | CV996171 | single nucleotide variant | NM_001036.6(RYR3):c.1096T>A (p.Tyr366Asn) | Epileptic encephalopathy [RCV001304968] | uncertain significance | 15 | 33562960 | 33562960 | Human | 2 | name |
| 126760327 | CV996172 | single nucleotide variant | NM_001036.6(RYR3):c.1289C>T (p.Ala430Val) | Epileptic encephalopathy [RCV001299761] | uncertain significance | 15 | 33579996 | 33579996 | Human | 2 | name |
| 126758084 | CV996173 | single nucleotide variant | NM_001036.6(RYR3):c.1606G>A (p.Ala536Thr) | Epileptic encephalopathy [RCV001308612]|not specified [RCV004034173] | uncertain significance | 15 | 33584427 | 33584427 | Human | 2 | name |
| 126735961 | CV996174 | single nucleotide variant | NM_001036.6(RYR3):c.1688A>C (p.His563Pro) | Epileptic encephalopathy [RCV001304675]|RYR3-related disorder [RCV003405522] | uncertain significance | 15 | 33586016 | 33586016 | Human | 3 | name , alternate_id |
| 126755470 | CV996175 | single nucleotide variant | NM_001036.6(RYR3):c.1823A>G (p.Asn608Ser) | Epileptic encephalopathy [RCV001307867] | uncertain significance | 15 | 33601453 | 33601453 | Human | 2 | name |
| 126766644 | CV996176 | single nucleotide variant | NM_001036.6(RYR3):c.2165G>C (p.Gly722Ala) | Epileptic encephalopathy [RCV001301967] | uncertain significance | 15 | 33613183 | 33613183 | Human | 2 | name |
| 126743072 | CV996177 | single nucleotide variant | NM_001036.6(RYR3):c.2753A>G (p.Tyr918Cys) | Epileptic encephalopathy [RCV001296135] | uncertain significance | 15 | 33630013 | 33630013 | Human | 2 | name |
| 8643621 | CV102886 | single nucleotide variant | NM_001036.6(RYR3):c.4529T>C (p.Val1510Ala) | not provided [RCV000083247] | not provided | 15 | 33660330 | 33660330 | Human | | name |
| 401742806 | CV2673878 | single nucleotide variant | NM_001036.6(RYR3):c.5614G>A (p.Glu1872Lys) | not specified [RCV004293256] | uncertain significance | 15 | 33663732 | 33663732 | Human | | name |
| 401750254 | CV2701106 | single nucleotide variant | NM_001036.6(RYR3):c.6732G>T (p.Met2244Ile) | not specified [RCV004309701] | uncertain significance | 15 | 33722827 | 33722827 | Human | | name |
| 401759939 | CV2701795 | single nucleotide variant | NM_001036.6(RYR3):c.3152T>C (p.Ile1051Thr) | not specified [RCV004314188] | uncertain significance | 15 | 33634710 | 33634710 | Human | | name |
| 401738969 | CV2708261 | single nucleotide variant | NM_001036.6(RYR3):c.4931C>T (p.Pro1644Leu) | not specified [RCV004311605] | uncertain significance | 15 | 33662461 | 33662461 | Human | | name |
| 401766763 | CV2721308 | single nucleotide variant | NM_001036.6(RYR3):c.4724G>A (p.Arg1575His) | not specified [RCV004322070] | uncertain significance | 15 | 33662254 | 33662254 | Human | | name |
| 401868069 | CV2767142 | single nucleotide variant | NM_001036.6(RYR3):c.9554G>A (p.Gly3185Asp) | not specified [RCV004347540] | uncertain significance | 15 | 33785947 | 33785947 | Human | | name |
| 401887454 | CV2771948 | single nucleotide variant | NM_001036.6(RYR3):c.3986A>T (p.Tyr1329Phe) | not specified [RCV004344643] | uncertain significance | 15 | 33649079 | 33649079 | Human | | name |
| 401877991 | CV2786925 | single nucleotide variant | NM_001036.6(RYR3):c.3352G>A (p.Asp1118Asn) | not specified [RCV004366066] | uncertain significance | 15 | 33635790 | 33635790 | Human | | name |
| 401871993 | CV2792950 | single nucleotide variant | NM_001036.6(RYR3):c.3590A>G (p.Gln1197Arg) | not specified [RCV004360299] | uncertain significance | 15 | 33644344 | 33644344 | Human | | name |
| 401933534 | CV2800368 | single nucleotide variant | NM_001036.6(RYR3):c.4490C>A (p.Pro1497His) | RYR3-related disorder [RCV003410380] | uncertain significance | 15 | 33660291 | 33660291 | Human | | name , trait , alternate_id |
| 401916050 | CV2817385 | single nucleotide variant | NM_001036.6(RYR3):c.7777G>A (p.Asp2593Asn) | not provided [RCV003400847] | uncertain significance | 15 | 33739952 | 33739952 | Human | | name |
| 405042031 | CV2930870 | single nucleotide variant | NM_001036.6(RYR3):c.3280G>A (p.Val1094Met) | Epileptic encephalopathy [RCV003591600] | uncertain significance | 15 | 33635718 | 33635718 | Human | 2 | name |
| 405076535 | CV3081667 | single nucleotide variant | NM_001036.6(RYR3):c.4006G>C (p.Ala1336Pro) | Congenital myopathy 20 [RCV003764492] | uncertain significance | 15 | 33649099 | 33649099 | Human | 1 | name |
| 405269159 | CV3187227 | single nucleotide variant | NM_001036.6(RYR3):c.7589C>T (p.Ala2530Val) | not provided [RCV003887311] | uncertain significance | 15 | 33738523 | 33738523 | Human | | name |
| 405274995 | CV3204582 | single nucleotide variant | NM_001036.6(RYR3):c.6775C>T (p.Pro2259Ser) | RYR3-related disorder [RCV003951997] | uncertain significance | 15 | 33722870 | 33722870 | Human | | name , trait , alternate_id |
| 405262526 | CV3213003 | single nucleotide variant | NM_001036.6(RYR3):c.4744A>G (p.Ser1582Gly) | RYR3-related disorder [RCV003944781] | uncertain significance | 15 | 33662274 | 33662274 | Human | | name , trait , alternate_id |
| 405701831 | CV3310127 | single nucleotide variant | NM_001036.6(RYR3):c.3052C>T (p.Arg1018Cys) | not specified [RCV004447205] | uncertain significance | 15 | 33634610 | 33634610 | Human | | name |
| 405701852 | CV3310130 | single nucleotide variant | NM_001036.6(RYR3):c.4130G>A (p.Arg1377Gln) | not specified [RCV004447208] | uncertain significance | 15 | 33649223 | 33649223 | Human | | name |
| 405701858 | CV3310131 | single nucleotide variant | NM_001036.6(RYR3):c.4552C>T (p.Arg1518Cys) | not specified [RCV004447209] | uncertain significance | 15 | 33660353 | 33660353 | Human | | name |
| 405701865 | CV3310132 | single nucleotide variant | NM_001036.6(RYR3):c.5147G>A (p.Gly1716Glu) | not specified [RCV004447210] | uncertain significance | 15 | 33662677 | 33662677 | Human | | name |
| 405701871 | CV3310133 | single nucleotide variant | NM_001036.6(RYR3):c.5258C>G (p.Ser1753Cys) | not specified [RCV004447211] | uncertain significance | 15 | 33662788 | 33662788 | Human | | name |
| 405701879 | CV3310134 | single nucleotide variant | NM_001036.6(RYR3):c.5260G>T (p.Val1754Leu) | not specified [RCV004447212] | uncertain significance | 15 | 33662790 | 33662790 | Human | | name |
| 405701886 | CV3310135 | single nucleotide variant | NM_001036.6(RYR3):c.5438A>G (p.Tyr1813Cys) | not specified [RCV004447213] | uncertain significance | 15 | 33663556 | 33663556 | Human | | name |
| 405701900 | CV3310137 | single nucleotide variant | NM_001036.6(RYR3):c.5759A>C (p.Asp1920Ala) | not specified [RCV004447215] | uncertain significance | 15 | 33670455 | 33670455 | Human | | name |
| 405701906 | CV3310138 | single nucleotide variant | NM_001036.6(RYR3):c.6474C>A (p.Asp2158Glu) | not specified [RCV004447216] | uncertain significance | 15 | 33701071 | 33701071 | Human | | name |
| 405701911 | CV3310139 | single nucleotide variant | NM_001036.6(RYR3):c.6707G>C (p.Gly2236Ala) | not specified [RCV004447217] | uncertain significance | 15 | 33722802 | 33722802 | Human | | name |
| 405701914 | CV3310140 | single nucleotide variant | NM_001036.6(RYR3):c.7195C>A (p.Leu2399Ile) | not specified [RCV004447218] | uncertain significance | 15 | 33729018 | 33729018 | Human | | name |
| 405701921 | CV3310141 | single nucleotide variant | NM_001036.6(RYR3):c.7271T>A (p.Leu2424His) | not specified [RCV004447219] | uncertain significance | 15 | 33731541 | 33731541 | Human | | name |
| 405701928 | CV3310142 | single nucleotide variant | NM_001036.6(RYR3):c.8183T>C (p.Leu2728Pro) | not specified [RCV004447220] | uncertain significance | 15 | 33748514 | 33748514 | Human | | name |
| 405701935 | CV3310143 | single nucleotide variant | NM_001036.6(RYR3):c.9178G>T (p.Ala3060Ser) | not specified [RCV004447221] | uncertain significance | 15 | 33780251 | 33780251 | Human | | name |
| 405701943 | CV3310144 | single nucleotide variant | NM_001036.6(RYR3):c.9304C>G (p.Pro3102Ala) | not specified [RCV004447222] | uncertain significance | 15 | 33785697 | 33785697 | Human | | name |
| 405853029 | CV3393460 | single nucleotide variant | NM_001036.6(RYR3):c.4261A>G (p.Met1421Val) | not provided [RCV004546190] | uncertain significance | 15 | 33652836 | 33652836 | Human | | name |
| 407468872 | CV3473310 | single nucleotide variant | NM_001036.6(RYR3):c.6160T>G (p.Tyr2054Asp) | not specified [RCV004661275] | uncertain significance | 15 | 33697907 | 33697907 | Human | | name |
| 407468878 | CV3473313 | single nucleotide variant | NM_001036.6(RYR3):c.9621G>C (p.Arg3207Ser) | not specified [RCV004661277] | uncertain significance | 15 | 33788249 | 33788249 | Human | | name |
| 407468882 | CV3473314 | single nucleotide variant | NM_001036.6(RYR3):c.8980A>G (p.Thr2994Ala) | not specified [RCV004661278] | uncertain significance | 15 | 33772083 | 33772083 | Human | | name |
| 407468888 | CV3473316 | single nucleotide variant | NM_001036.6(RYR3):c.6026C>G (p.Thr2009Ser) | not specified [RCV004661280] | uncertain significance | 15 | 33696383 | 33696383 | Human | | name |
| 407468893 | CV3473319 | single nucleotide variant | NM_001036.6(RYR3):c.4839C>G (p.Ile1613Met) | not specified [RCV004661282] | uncertain significance | 15 | 33662369 | 33662369 | Human | | name |
| 407468896 | CV3473320 | single nucleotide variant | NM_001036.6(RYR3):c.4204T>C (p.Ser1402Pro) | not specified [RCV004661283] | uncertain significance | 15 | 33652779 | 33652779 | Human | | name |
| 407468898 | CV3473321 | single nucleotide variant | NM_001036.6(RYR3):c.9540C>G (p.Ile3180Met) | not specified [RCV004661284] | uncertain significance | 15 | 33785933 | 33785933 | Human | | name |
| 407514350 | CV3473330 | single nucleotide variant | NM_001036.6(RYR3):c.9766G>A (p.Ala3256Thr) | not specified [RCV004674412] | uncertain significance | 15 | 33788394 | 33788394 | Human | | name |
| 407506857 | CV3496199 | single nucleotide variant | NM_001036.6(RYR3):c.5512C>T (p.Gln1838Ter) | not provided [RCV004698040] | uncertain significance | 15 | 33663630 | 33663630 | Human | | name |
| 597655793 | CV3552214 | single nucleotide variant | NM_001036.6(RYR3):c.4298C>G (p.Thr1433Ser) | Congenital myopathy 20 [RCV004821072] | uncertain significance | 15 | 33652873 | 33652873 | Human | 1 | name |
| 597734306 | CV3597814 | single nucleotide variant | NM_001036.6(RYR3):c.4726G>A (p.Val1576Met) | not specified [RCV004863456] | uncertain significance | 15 | 33662256 | 33662256 | Human | | name |
| 597734313 | CV3597815 | single nucleotide variant | NM_001036.6(RYR3):c.3053G>A (p.Arg1018His) | not specified [RCV004863457] | uncertain significance | 15 | 33634611 | 33634611 | Human | | name |
| 597734320 | CV3597816 | single nucleotide variant | NM_001036.6(RYR3):c.7571G>T (p.Trp2524Leu) | not specified [RCV004863458] | uncertain significance | 15 | 33738505 | 33738505 | Human | | name |
| 597734326 | CV3597817 | single nucleotide variant | NM_001036.6(RYR3):c.7572G>C (p.Trp2524Cys) | not specified [RCV004863459] | uncertain significance | 15 | 33738506 | 33738506 | Human | | name |
| 597734331 | CV3597818 | single nucleotide variant | NM_001036.6(RYR3):c.3187G>T (p.Val1063Leu) | not specified [RCV004863460] | uncertain significance | 15 | 33635625 | 33635625 | Human | | name |
| 597734355 | CV3597822 | single nucleotide variant | NM_001036.6(RYR3):c.9259G>A (p.Glu3087Lys) | not specified [RCV004863464] | uncertain significance | 15 | 33780332 | 33780332 | Human | | name |
| 597734360 | CV3597823 | single nucleotide variant | NM_001036.6(RYR3):c.4294G>A (p.Gly1432Ser) | not specified [RCV004863465] | uncertain significance | 15 | 33652869 | 33652869 | Human | | name |
| 597734365 | CV3597824 | single nucleotide variant | NM_001036.6(RYR3):c.4753G>A (p.Asp1585Asn) | not specified [RCV004863466] | uncertain significance | 15 | 33662283 | 33662283 | Human | | name |
| 597734387 | CV3597828 | single nucleotide variant | NM_001036.6(RYR3):c.4763A>T (p.Gln1588Leu) | not specified [RCV004863470] | uncertain significance | 15 | 33662293 | 33662293 | Human | | name |
| 597734392 | CV3597829 | single nucleotide variant | NM_001036.6(RYR3):c.3994A>G (p.Ile1332Val) | not specified [RCV004863471] | uncertain significance | 15 | 33649087 | 33649087 | Human | | name |
| 597734419 | CV3597834 | single nucleotide variant | NM_001036.6(RYR3):c.5773G>A (p.Gly1925Arg) | not specified [RCV004863476] | uncertain significance | 15 | 33670469 | 33670469 | Human | | name |
| 597734424 | CV3597835 | single nucleotide variant | NM_001036.6(RYR3):c.5138C>A (p.Pro1713His) | not specified [RCV004863477] | uncertain significance | 15 | 33662668 | 33662668 | Human | | name |
| 597734444 | CV3597839 | single nucleotide variant | NM_001036.6(RYR3):c.4928T>G (p.Phe1643Cys) | not specified [RCV004863481] | uncertain significance | 15 | 33662458 | 33662458 | Human | | name |
| 597734451 | CV3597840 | single nucleotide variant | NM_001036.6(RYR3):c.3190G>C (p.Glu1064Gln) | not specified [RCV004863482] | uncertain significance | 15 | 33635628 | 33635628 | Human | | name |
| 597734467 | CV3597843 | single nucleotide variant | NM_001036.6(RYR3):c.5250T>G (p.Ile1750Met) | not specified [RCV004863485] | uncertain significance | 15 | 33662780 | 33662780 | Human | | name |
| 597734484 | CV3597846 | single nucleotide variant | NM_001036.6(RYR3):c.8546A>G (p.Lys2849Arg) | not specified [RCV004863488] | uncertain significance | 15 | 33756336 | 33756336 | Human | | name |
| 597734494 | CV3597848 | single nucleotide variant | NM_001036.6(RYR3):c.9036G>C (p.Gln3012His) | not specified [RCV004863490] | uncertain significance | 15 | 33772139 | 33772139 | Human | | name |
| 597734505 | CV3597850 | single nucleotide variant | NM_001036.6(RYR3):c.9891A>C (p.Glu3297Asp) | not specified [RCV004863492] | uncertain significance | 15 | 33800830 | 33800830 | Human | | name |
| 597734511 | CV3597851 | single nucleotide variant | NM_001036.6(RYR3):c.4085A>C (p.Asn1362Thr) | not specified [RCV004863493] | uncertain significance | 15 | 33649178 | 33649178 | Human | | name |
| 597734520 | CV3597852 | single nucleotide variant | NM_001036.6(RYR3):c.5770A>G (p.Thr1924Ala) | not specified [RCV004863494] | uncertain significance | 15 | 33670466 | 33670466 | Human | | name |
| 597734526 | CV3597853 | single nucleotide variant | NM_001036.6(RYR3):c.8821G>C (p.Val2941Leu) | not specified [RCV004863495] | uncertain significance | 15 | 33771924 | 33771924 | Human | | name |
| 597734541 | CV3597856 | single nucleotide variant | NM_001036.6(RYR3):c.7364G>A (p.Gly2455Glu) | not specified [RCV004863498] | uncertain significance | 15 | 33731634 | 33731634 | Human | | name |
| 597734568 | CV3597861 | single nucleotide variant | NM_001036.6(RYR3):c.3308G>T (p.Trp1103Leu) | not specified [RCV004863503] | uncertain significance | 15 | 33635746 | 33635746 | Human | | name |
| 597734574 | CV3597862 | single nucleotide variant | NM_001036.6(RYR3):c.7626C>G (p.Phe2542Leu) | not specified [RCV004863504] | uncertain significance | 15 | 33738560 | 33738560 | Human | | name |
| 597734580 | CV3597863 | single nucleotide variant | NM_001036.6(RYR3):c.3182C>T (p.Ser1061Leu) | not specified [RCV004863505] | uncertain significance | 15 | 33635620 | 33635620 | Human | | name |
| 597734585 | CV3597864 | single nucleotide variant | NM_001036.6(RYR3):c.4262T>C (p.Met1421Thr) | not specified [RCV004863506] | uncertain significance | 15 | 33652837 | 33652837 | Human | | name |
| 597734590 | CV3597865 | single nucleotide variant | NM_001036.6(RYR3):c.7258G>A (p.Ala2420Thr) | not specified [RCV004863507] | uncertain significance | 15 | 33731528 | 33731528 | Human | | name |
| 597734607 | CV3597868 | single nucleotide variant | NM_001036.6(RYR3):c.5417A>G (p.Gln1806Arg) | not specified [RCV004863510] | uncertain significance | 15 | 33662947 | 33662947 | Human | | name |
| 597734612 | CV3597869 | single nucleotide variant | NM_001036.6(RYR3):c.3584T>C (p.Leu1195Pro) | not specified [RCV004863511] | uncertain significance | 15 | 33644338 | 33644338 | Human | | name |
| 597734630 | CV3597872 | single nucleotide variant | NM_001036.6(RYR3):c.8731G>C (p.Val2911Leu) | not specified [RCV004863514] | uncertain significance | 15 | 33768683 | 33768683 | Human | | name |
| 598127065 | CV3887945 | single nucleotide variant | NM_001036.6(RYR3):c.9646A>T (p.Ile3216Phe) | not provided [RCV005242631] | uncertain significance | 15 | 33788274 | 33788274 | Human | | name |
| 598234448 | CV3910188 | single nucleotide variant | NM_001036.6(RYR3):c.7525A>G (p.Asn2509Asp) | not specified [RCV005275052] | uncertain significance | 15 | 33738459 | 33738459 | Human | | name |
| 598234455 | CV3910189 | single nucleotide variant | NM_001036.6(RYR3):c.7366C>T (p.Arg2456Cys) | not specified [RCV005275053] | uncertain significance | 15 | 33731636 | 33731636 | Human | | name |
| 598234463 | CV3910190 | single nucleotide variant | NM_001036.6(RYR3):c.4612G>C (p.Glu1538Gln) | not specified [RCV005275054] | uncertain significance | 15 | 33660413 | 33660413 | Human | | name |
| 598207365 | CV3910197 | single nucleotide variant | NM_001036.6(RYR3):c.4336G>T (p.Ala1446Ser) | not specified [RCV005270032] | uncertain significance | 15 | 33659747 | 33659747 | Human | | name |
| 598207380 | CV3910199 | single nucleotide variant | NM_001036.6(RYR3):c.8715C>G (p.Cys2905Trp) | not specified [RCV005270034] | uncertain significance | 15 | 33768667 | 33768667 | Human | | name |
| 598207386 | CV3910200 | single nucleotide variant | NM_001036.6(RYR3):c.9314C>A (p.Pro3105His) | not specified [RCV005270035] | uncertain significance | 15 | 33785707 | 33785707 | Human | | name |
| 598207397 | CV3910202 | single nucleotide variant | NM_001036.6(RYR3):c.8096G>A (p.Arg2699Gln) | not specified [RCV005270037] | uncertain significance | 15 | 33748220 | 33748220 | Human | | name |
| 598207413 | CV3910204 | single nucleotide variant | NM_001036.6(RYR3):c.3406G>A (p.Gly1136Arg) | not specified [RCV005270039] | uncertain significance | 15 | 33636400 | 33636400 | Human | | name |
| 598207462 | CV3910211 | single nucleotide variant | NM_001036.6(RYR3):c.9994A>C (p.Lys3332Gln) | not specified [RCV005270046] | uncertain significance | 15 | 33801944 | 33801944 | Human | | name |
| 598207480 | CV3910214 | single nucleotide variant | NM_001036.6(RYR3):c.6908T>C (p.Met2303Thr) | not specified [RCV005270049] | uncertain significance | 15 | 33724172 | 33724172 | Human | | name |
| 616939946 | CV4014333 | single nucleotide variant | NM_001036.6(RYR3):c.3787A>G (p.Met1263Val) | not provided [RCV005413827] | uncertain significance | 15 | 33646372 | 33646372 | Human | | name |
| 40903992 | CV918089 | single nucleotide variant | NM_001036.6(RYR3):c.6604G>A (p.Ala2202Thr) | Premature ovarian failure [RCV001270228] | uncertain significance | 15 | 33707039 | 33707039 | Human | 2 | name |
| 38486842 | CV927276 | single nucleotide variant | NM_001036.6(RYR3):c.4735G>C (p.Ala1579Pro) | Epileptic encephalopathy [RCV001220469] | uncertain significance | 15 | 33662265 | 33662265 | Human | 2 | name |
| 38493096 | CV927277 | single nucleotide variant | NM_001036.6(RYR3):c.6045C>G (p.Ile2015Met) | Epileptic encephalopathy [RCV001224038] | uncertain significance | 15 | 33696402 | 33696402 | Human | 2 | name |
| 38487965 | CV927279 | single nucleotide variant | NM_001036.6(RYR3):c.8731G>A (p.Val2911Ile) | Epileptic encephalopathy [RCV001220963] | uncertain significance | 15 | 33768683 | 33768683 | Human | 2 | name |
| 38487280 | CV927280 | single nucleotide variant | NM_001036.6(RYR3):c.8758A>G (p.Ser2920Gly) | Epileptic encephalopathy [RCV001220519] | uncertain significance | 15 | 33769114 | 33769114 | Human | 2 | name |
| 38494306 | CV927284 | single nucleotide variant | NM_001036.6(RYR3):c.9442C>T (p.Arg3148Trp) | Epileptic encephalopathy [RCV001224877]|not provided [RCV004697078] | uncertain significance | 15 | 33785835 | 33785835 | Human | 2 | name |
| 38488203 | CV936866 | single nucleotide variant | NM_001036.6(RYR3):c.3719G>A (p.Arg1240His) | Epileptic encephalopathy [RCV001209640] | uncertain significance | 15 | 33644473 | 33644473 | Human | 2 | name |
| 38484921 | CV936877 | single nucleotide variant | NM_001036.6(RYR3):c.5829G>C (p.Glu1943Asp) | Epileptic encephalopathy [RCV001208280] | uncertain significance | 15 | 33670525 | 33670525 | Human | 2 | name |
| 38484229 | CV936878 | single nucleotide variant | NM_001036.6(RYR3):c.6073C>T (p.Arg2025Cys) | Epileptic encephalopathy [RCV001207964] | uncertain significance | 15 | 33696430 | 33696430 | Human | 2 | name |
| 38489789 | CV936881 | single nucleotide variant | NM_001036.6(RYR3):c.8773A>G (p.Met2925Val) | Epileptic encephalopathy [RCV001210358]|not specified [RCV004659392] | uncertain significance | 15 | 33769129 | 33769129 | Human | 2 | name |
| 38484713 | CV936882 | single nucleotide variant | NM_001036.6(RYR3):c.9271C>G (p.Leu3091Val) | Epileptic encephalopathy [RCV001208166] | uncertain significance | 15 | 33785664 | 33785664 | Human | 2 | name |
| 38484397 | CV948815 | single nucleotide variant | NM_001036.6(RYR3):c.3000A>C (p.Lys1000Asn) | Epileptic encephalopathy [RCV001236321] | uncertain significance | 15 | 33633081 | 33633081 | Human | 2 | name |
| 38485158 | CV948816 | single nucleotide variant | NM_001036.6(RYR3):c.3815C>T (p.Thr1272Met) | Epileptic encephalopathy [RCV001236641] | uncertain significance | 15 | 33646400 | 33646400 | Human | 2 | name |
| 38499050 | CV948824 | single nucleotide variant | NM_001036.6(RYR3):c.5398C>A (p.Pro1800Thr) | Epileptic encephalopathy [RCV001228137] | uncertain significance | 15 | 33662928 | 33662928 | Human | 2 | name |
| 38485132 | CV948825 | single nucleotide variant | NM_001036.6(RYR3):c.5609C>A (p.Pro1870Gln) | Epileptic encephalopathy [RCV001236630] | uncertain significance | 15 | 33663727 | 33663727 | Human | 2 | name |
| 38496314 | CV948826 | single nucleotide variant | NM_001036.6(RYR3):c.5947T>G (p.Phe1983Val) | Epileptic encephalopathy [RCV001226308] | uncertain significance | 15 | 33696304 | 33696304 | Human | 2 | name |
| 38490389 | CV948827 | single nucleotide variant | NM_001036.6(RYR3):c.6064G>A (p.Gly2022Ser) | Epileptic encephalopathy [RCV001238808] | uncertain significance | 15 | 33696421 | 33696421 | Human | 2 | name |
| 38489655 | CV948828 | single nucleotide variant | NM_001036.6(RYR3):c.7152G>C (p.Leu2384Phe) | Epileptic encephalopathy [RCV001238506] | uncertain significance | 15 | 33728975 | 33728975 | Human | 2 | name |
| 38487528 | CV948831 | single nucleotide variant | NM_001036.6(RYR3):c.7775T>A (p.Val2592Glu) | Epileptic encephalopathy [RCV001237615] | uncertain significance | 15 | 33739950 | 33739950 | Human | 2 | name |
| 38496554 | CV948832 | single nucleotide variant | NM_001036.6(RYR3):c.7781C>T (p.Ala2594Val) | Epileptic encephalopathy [RCV001226468]|not specified [RCV004857768] | uncertain significance | 15 | 33739956 | 33739956 | Human | 2 | name |
| 38487443 | CV948834 | single nucleotide variant | NM_001036.6(RYR3):c.9802A>G (p.Met3268Val) | Epileptic encephalopathy [RCV001237575]|not specified [RCV005269009] | uncertain significance | 15 | 33788430 | 33788430 | Human | 2 | name |
| 38499623 | CV957384 | single nucleotide variant | NM_001036.6(RYR3):c.3755C>T (p.Pro1252Leu) | Epileptic encephalopathy [RCV001244871] | uncertain significance | 15 | 33644509 | 33644509 | Human | 2 | name |
| 38490513 | CV957385 | single nucleotide variant | NM_001036.6(RYR3):c.4509G>A (p.Met1503Ile) | Epileptic encephalopathy [RCV001238869]|not specified [RCV004034588] | uncertain significance | 15 | 33660310 | 33660310 | Human | 2 | name |
| 38495893 | CV957386 | single nucleotide variant | NM_001036.6(RYR3):c.5132G>A (p.Arg1711Gln) | Epileptic encephalopathy [RCV001242218] | uncertain significance | 15 | 33662662 | 33662662 | Human | 2 | name |
| 38499820 | CV957389 | single nucleotide variant | NM_001036.6(RYR3):c.6671G>A (p.Arg2224His) | Epileptic encephalopathy [RCV001245131] | uncertain significance | 15 | 33722766 | 33722766 | Human | 2 | name |
| 39456466 | CV965540 | single nucleotide variant | NM_001036.6(RYR3):c.4593G>A (p.Met1531Ile) | RYR3-related Epileptic encephalopathy [RCV004799340]|not provided [RCV004692357]|not specified [RCV004035346] | uncertain significance | 15 | 33660394 | 33660394 | Human | 1 | name |
| 40888441 | CV971461 | single nucleotide variant | NM_001036.6(RYR3):c.5465G>A (p.Arg1822Gln) | not provided [RCV004799539]|not specified [RCV004035413] | uncertain significance | 15 | 33663583 | 33663583 | Human | | name |
| 40887250 | CV973942 | single nucleotide variant | NM_001036.6(RYR3):c.3778G>A (p.Asp1260Asn) | Inborn genetic diseases [RCV001266737] | uncertain significance | 15 | 33646363 | 33646363 | Human | 1 | name |
| 40887764 | CV973943 | single nucleotide variant | NM_001036.6(RYR3):c.9793T>A (p.Phe3265Ile) | Inborn genetic diseases [RCV001267356] | uncertain significance | 15 | 33788421 | 33788421 | Human | 1 | name |
| 41407125 | CV980723 | single nucleotide variant | NM_001036.6(RYR3):c.7855A>G (p.Thr2619Ala) | Congenital myopathy 20 [RCV004799638]|Epileptic encephalopathy [RCV001367490] | uncertain significance | 15 | 33742400 | 33742400 | Human | 3 | name |
| 401933317 | CV2797617 | single nucleotide variant | NM_001036.6(RYR3):c.10304T>A (p.Val3435Asp) | RYR3-related disorder [RCV003392789] | uncertain significance | 15 | 33812909 | 33812909 | Human | | trait , alternate_id |
| 401905513 | CV2798004 | single nucleotide variant | NM_001036.6(RYR3):c.14478G>A (p.Met4826Ile) | RYR3-related disorder [RCV003420858] | uncertain significance | 15 | 33864150 | 33864150 | Human | | trait , alternate_id |
| 13476940 | CV464627 | single nucleotide variant | NM_001036.6(RYR3):c.7812C>G (p.Asn2604Lys) | Epileptic encephalopathy [RCV001083494]|RYR3-related disorder [RCV003915531]|not provided [RCV000845095] | likely benign|not provided | 15 | 33739987 | 33739987 | Human | 3 | alternate_id |
| 13487739 | CV464646 | single nucleotide variant | NM_001036.6(RYR3):c.9254C>G (p.Pro3085Arg) | Epileptic encephalopathy [RCV000531976]|RYR3-related disorder [RCV003915532]|not provided [RCV002060308] | benign|likely benign|conflicting interpretations of pathogenicity|uncertain significance | 15 | 33780327 | 33780327 | Human | 3 | alternate_id |
| 13464556 | CV464866 | single nucleotide variant | NM_001036.6(RYR3):c.6617A>C (p.Asn2206Thr) | Epileptic encephalopathy [RCV000542273]|RYR3-related disorder [RCV003935437]|not provided [RCV001824819] | benign|likely benign|not provided | 15 | 33707052 | 33707052 | Human | 3 | alternate_id |
| 13482428 | CV464885 | single nucleotide variant | NM_001036.6(RYR3):c.8117G>T (p.Ser2706Ile) | Epileptic encephalopathy [RCV000529400]|RYR3-related disorder [RCV003960293] | benign | 15 | 33748241 | 33748241 | Human | 3 | alternate_id |
| 13495570 | CV464894 | single nucleotide variant | NM_001036.6(RYR3):c.8542G>A (p.Glu2848Lys) | Epileptic encephalopathy [RCV000559724]|RYR3-related disorder [RCV003935438] | likely benign | 15 | 33756332 | 33756332 | Human | 3 | alternate_id |
| 13496701 | CV464895 | single nucleotide variant | NM_001036.6(RYR3):c.8555G>A (p.Arg2852His) | Epileptic encephalopathy [RCV000538031]|RYR3-related disorder [RCV003942776]|not provided [RCV003222022] | benign|likely benign | 15 | 33756345 | 33756345 | Human | 3 | alternate_id |
| 13485683 | CV464896 | single nucleotide variant | NM_001036.6(RYR3):c.9143G>T (p.Arg3048Leu) | Epileptic encephalopathy [RCV000553337]|RYR3-related disorder [RCV003925624]|not specified [RCV004586771] | benign|likely benign | 15 | 33780216 | 33780216 | Human | 3 | alternate_id |
| 13492420 | CV464919 | single nucleotide variant | NM_001036.6(RYR3):c.11545A>C (p.Asn3849His) | Epileptic encephalopathy [RCV000557435]|RYR3-related disorder [RCV003915527] | benign | 15 | 33835049 | 33835049 | Human | 3 | alternate_id |
| 13475427 | CV464954 | single nucleotide variant | NM_001036.6(RYR3):c.14110G>A (p.Glu4704Lys) | Epileptic encephalopathy [RCV000548700]|RYR3-related disorder [RCV003915529]|not provided [RCV001824818] | benign|likely benign|not provided | 15 | 33857882 | 33857882 | Human | 3 | alternate_id |
| 13605886 | CV529061 | single nucleotide variant | NM_001036.6(RYR3):c.8956G>A (p.Val2986Ile) | Epileptic encephalopathy [RCV000637268]|RYR3-related disorder [RCV003953130] | likely benign | 15 | 33772059 | 33772059 | Human | 3 | alternate_id |
| 13605769 | CV529067 | single nucleotide variant | NM_001036.6(RYR3):c.9355G>A (p.Glu3119Lys) | Epileptic encephalopathy [RCV000637179]|RYR3-related disorder [RCV003965338]|not provided [RCV001532252] | likely benign | 15 | 33785748 | 33785748 | Human | 3 | alternate_id |
| 13818004 | CV568677 | single nucleotide variant | NM_001036.6(RYR3):c.8496A>C (p.Gln2832His) | Epileptic encephalopathy [RCV000693419]|RYR3-related disorder [RCV003420232] | uncertain significance | 15 | 33755161 | 33755161 | Human | 3 | alternate_id |
| 13812473 | CV569301 | single nucleotide variant | NM_001036.6(RYR3):c.12463G>A (p.Asp4155Asn) | Epileptic encephalopathy [RCV000703719]|RYR3-related disorder [RCV003953245]|not specified [RCV004026638] | likely benign|uncertain significance | 15 | 33838443 | 33838443 | Human | 3 | alternate_id |
| 15103007 | CV754372 | single nucleotide variant | NM_001036.6(RYR3):c.6125A>C (p.Asn2042Thr) | Epileptic encephalopathy [RCV001418879]|RYR3-related disorder [RCV003902944] | likely benign | 15 | 33696482 | 33696482 | Human | 3 | alternate_id |
| 127330107 | CV1145106 | indel | NM_001036.6(RYR3):c.13497+8_13497+9delinsCA | Epileptic encephalopathy [RCV001487868] | likely benign | 15 | 33845070 | 33845071 | Human | | name |
| 401916054 | CV2817387 | deletion | NM_001036.6(RYR3):c.10503-1446_10503-1445del | not provided [RCV003400848] | likely benign | 15 | 33815416 | 33815417 | Human | | name |
| 127325195 | CV1145111 | microsatellite | NM_001036.6(RYR3):c.14142+6AGCCCACCCACTGCGGGGCC[3] | Epileptic encephalopathy [RCV001485727] | likely benign | 15 | 33857919 | 33857920 | Human | | name |